Genetic Diversity and Antibiotic Resistance Patterns of Staphylococcus Aureus Isolated from Leaf Vegetables in Korea Jisoo Hong, Yangkyun Kim, Jonguk Kim, Sunggi Heu, Se-ri Kim, Kwang-Pyo Kim, and Eunjung Roh
Staphylococcus aureus is an important foodborne pathogen on global basis. The current study investigated the genetic patterns in S. aureus isolates from leaf vegetables (n = 53). Additional isolates from livestock (n = 31) and humans (n = 27) were compared with the leaf vegetable isolates. Genes associated with toxins, antibiotic resistance, and pulsed-field gel electrophoresis (PFGE) patterns were analyzed. At least 1 enterotoxin-encoding gene (sea, seb, sec, sed, and see) was detected in 11 of 53 (20.75%) leaf vegetable isolates. When the agr (accessory gene regulator) grouping was analyzed, agr II was the major group, whereas agr IV was not present in leaf vegetable isolates. All S. aureus isolates from leaf vegetables were resistant to more than one of the antibiotics tested. Nineteen of 53 (35.85%) isolates from leaf vegetables exhibited multidrug-resistance, and 11 of these were MRSA (methicillin-resistant S. aureus). A dendrogram displaying the composite types of S. aureus isolates from 3 origins was generated based on the combination of the toxin genes, agr genes, antibiotic resistance, and PFGE patterns. The isolates could be clustered into 8 major composite types. The genetic patterns of S. aureus isolates from leaf vegetables and humans were similar, whereas those from livestock had unique patterns. This suggests some S. aureus isolates from leaf vegetables to be of human origin. Abstract:
M: Food Microbiology & Safety
Keywords: agr, antibiotic resistance, enterotoxin, PFGE, Staphylococcus aureus
Introduction Staphylococcus aureus is an important opportunistic pathogen that produces a wide variety of exoproteins that facilitate colonization. Staphylococcal food poisoning is one of the most common illnesses that results from the contamination of food by S. aureus enterotoxins (Kadariya and others 2014). Leaf vegetables that are in contact with the soil might harbor various pathogens (Liao and Fett 2001). Lettuce, sprouts, and perilla leaves are popular leaf vegetables in Korea, and several studies have shown that leaf vegetables can be contaminated by S. aureus (Jung and others 2005; Seo and others 2010). S. aureus secretes specific enzymes and cytotoxins (Dinges and others 2000), including toxic shock syndrome toxin-1 (TSST1) and enterotoxins (SEs, including SEA, SEB, SEC, SED, SEE, SEG, SHE, and SEI). TSST-1 and SEs are known as pyrogenic toxin superantigens (Dinges and others 2000). The pathogenicity of S. aureus is dependent on the production of virulence factors. In S. aureus, the accessory gene regulator (agr) locus, which encodes a two-component signaling pathway activated by an agr-encoded autoinducing peptide, was identified as a regulator of virulence factors that controls a large set of genes including most cell-wallassociated and extracellular proteins (Novick 2003). The part of the agr locus that consists of agrB, agrC, and agrD exhibits extensive sequence variation, which distinguishes S. aureus specificity groups (Jarraud and others 2000). S. aureus can be divided into 4 agr groups based on autoinducer receptor specificity (Yarwood and Schlievert 2003).
MS 20142131 Submitted 12/30/2015, Accepted 4/20/2015. Authors Hong, Kim, Kim, Heu, Kim, Roh, are with Microbial Safety Team, Natl. Academy of Agricultural Science, RDA, Wanju 565–851, Republic of Korea. Author Kim is with Dept. of Food Science, School of Agriculture and Life Sciences, Chonbuk Natl. Univ., Jeonju, Chonbuk 561–756, Republic of Korea. Direct inquiries to author Roh (E-mail: [email protected]).
M1526
Journal of Food Science r Vol. 80, Nr. 7, 2015
The increasing global prevalence of multidrug-resistant S. aureus and MRSA (methicillin-resistant S. aureus) is an important issue (Ayliffe 1997). The resistance of S. aureus to antimicrobial compounds reduces antimicrobial effectiveness and increases healthcare costs (Coast and Smith 2003). A previous study indicated that a number of genetic alterations related to antibiotic resistance also changed the virulence of some S. aureus strains (Gordon and Lowy 2008; Cameron and others 2011). The aim of this study was to assess the genetic diversity of S. aureus isolates from leaf vegetables in Korea and compare the resulting data with isolates from a variety of sources to track the route of contamination.
Materials and Methods Bacterial isolation From 2009 to 2011, a total of 84 S. aureus isolates were isolated from leaf vegetables and livestock. S. aureus from Lettuce and perilla leaf were sampled quarterly during 3 y at markets in Gyeonggi-do, Korea. Sprout was sampled quarterly during 1 y at markets in Gyeonggi-do, Korea. S. aureus from livestock was sampled during 3 y at farms in Jeollabuk-do and Chungcheongnamdo, Korea. Ten grams of each sample were added to 90 g of peptone water in the stomacher bag and homogenized with the stomacher. Samples were cultured on Baird-Parker agar (Difco, N.J., U.S.A.) at 37 °C for 24 h. All isolates were identified using ´ an API Staph ID kit (BioM´erieux, Marcy-l’Etoile, France; Barros and others 2007). The isolate identification was confirmed using species-specific polymerase chain reaction (PCR) for the S. aureus nuclease (nucA) gene (Brakstad and others 1992) and 16S rRNA sequence. S. aureus CCARM (culture collection antimicrobialresistant microbes, Seoul Women’s Univ., Korea) strains, which are clinical isolates from humans, were used in comparative analyses. R C 2015 Institute of Food Technologists
doi: 10.1111/1750-3841.12909 Further reproduction without permission is prohibited
Genetic diversity and antibiotic resistance . . . Table 1––Primers used in this study. Primer name
nucA
nucA-1 nucA-2 GMECAR-1 GMECAR-2 GSEAR-1 GSEAR-2 GSEBR-1 GSEBR-2 GSECR-1 GSECR-2 GSEDR-1 GSEDR-2 GSEER-1 GSEER-2 GTSSTR-1 GTSSTR-2 agr I-F agr I-R agr II-F agr II-R agr III-F agr III-R agr IV-F agr IV-R
mecA sea seb sec sed see TSST-1 agr I agr II agr III agr IV
Sequence (5’-3’) GCGATTGATGGTGATACGGTT AGCCAAGCCTTGACGAACTAAAGC ACTGCTATCCACCCTCAAAC CTGGTGAAGTTGTAATCTGG GGTTATCAATGTGCGGGTGG CGGCACTTTTTTCTCTTCGG GTATGGTGGTGTAACTGAGC CCAAATAGTGACGAGTTAGG AGATGAAGTAGTTGATGTGTATGG CACACTTTTAGAATCAACCG CCAATAATAGGAGAAAATAAAAG ATTGGTATTTTTTTTCGTTC AGGTTTTTTCACAGGTCATCC CTTTTTTTTCTTCGGTCAATC ACCCCTGTTCCCTTATCATC TTTTCAGTATTTGTAACGCC ATCGCAGCTTATAGTACTTGT CTTGATTACGTTTATATTTCATC AACGCTTGCAGCAGTTTATTT CGACATTATAAGTATTACAACA TATATAAATTGTGATTTTTTATTG TTCTTTAAGAGTAAATTGAGAA GTTGCTTCTTATAGTACATGTT CTTAAAAATATAGTGATTCCAATA
Table 2––Staphylococcus aureus used in this study. Origin Leaf vegetable Livestocka Humanb Total
Samples
Isolation sites
Nr. of isolates
Lettuce Sprout Perilla leaf Chicken Pig Cow Clinical samples
Local supermarket Local supermarket Local supermarket Farm Farm Farm Hospital
6 23 24 5 2 24 27 111
a
Chicken: skin, arthritis; pig: small intestine, neck; cow :raw milk (mastitis); Culture Collection Antimicrobial Resistant Microbes(CCARM, Korea) were isolated from Korean hospitals.
b
DNA extraction Staphylococcal cells were harvested from 3-mL overnight cultures by centrifugation at 8000 × g for 15 min. The harvested cells were resuspended in 0.1 mL of a freshly prepared mixture containing 5 µL of proteinase K (20 mg/mL) and 5 µL of lysostaphin (10 mg/mL), and incubated for 90 min at 45 °C. Then, 0.1 mL of 10 mM Tris-HCl (pH 8.0) and 2.5 mg/mL lysozyme were added, and the mixture was incubated at 37 °C for 2 h. DNA was then extracted using a G-spin genomic DNA extraction kit (Intron Biotechnology, Seongnam, Korea)
PCR The sequences of the primers used in this study are shown in Table 1. The PCR mixtures contained 50 nM of each of primer and 1 µg of genomic DNA. The thermal cycling conditions were 5 min at 95 °C, 30 cycles of 30 s at 95 °C, 30 s at 50 °C 57 °C, and 60 s at 72 °C, followed by 5 min at 72 °C. After PCR amplification, 10 µL of each reaction mixture were analyzed on a 1.0% agarose gel.
Product size (bp)
TM (°C)
280
57
Brakstad and others (1992)
163
57
Ryffel and others (1990)
102
57
Betley and Mekalanos (1988)
164
57
Jones and Khan (1986)
451
57
Bohach and Schlievert (1987)
278
57
Bayles and Iandolo (1989)
209
57
Couch and others (1988)
326
57
Blomster-Hautamaa and others (1986)
739
53
Jarraud and others (2000)
691
50
Jarraud and others (2000)
712
50
Jarraud and others (2000)
683
50
Jarraud and others (2000)
Reference
Disk diffusion method The antibiotic resistance of S. aureus to 17 antimicrobial agents was assessed using the disc diffusion method as described by the Clinical and Laboratory Standards Inst. (CLSI 2013). All isolates were incubated on TSA (Tryptic Soy Agar) overnight at 37 °C, and the density of the tested isolates were adjusted to a 0.5-McFarland turbidity standard (1–2 × 108 CFU/mL) using a spectrophotometer. Mueller-Hinton agar (MHA; Oxoid, Basingstoke, Hampshire, U.K.) was dispensed into a plastic culture plate to yield a uniform depth of 4 mm. A sterile swab was dipped into the adjusted suspension and streaked onto the entire surface of the MHA. After streaking, the inoculum was dried and an antimicrobial disk was applied onto the surface using a dispenser within 12 min of the inoculation. A total of 17 antimicrobial disks were tested: penicillin (10 U), oxacillin (1 µg), gentamycin (10 µg), erythromycin (15 µg), amoxicillin-clavulanic acid (30 µg), cephalothin (30 µg), imipenem (10 µg), ciprofloxacin (5 µg), tetracycline (30 µg), quinupristin/dalfopristin (15 µg), telithromycin (15 µg), clindamycin (2 µg), chloramphenicol (30 µg), linezolid (30 µg), trimethoprim/sulfamethoxazole (25 µg), nitrofurantoin (300 µg), and vancomycin (30 µg). All plates were incubated at 37 °C (or 30 °C for oxacillin) for 24 h. S. aureus ATCC 25923 was used as the quality control organism. MRSA was decided as presence of the mecA gene and oxacillin resistance. All experiments were repeated 3 times. Pulsed-field gel electrophoresis (PFGE) The PulseNet protocol (Swaminathan and others 2001) was adjusted to obtain clear and reproducible PFGE banding patterns using SmaI (TaKaRa, Otsu, Shiga, Japan). The isolates were cultured on TSA at 37 °C for 12 h. Cells were then harvested using a sterile cotton swab and suspended in 1 mL of TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0). The suspension was adjusted to an optical density at 600 nm (OD60 ) of 0.5 to 0.7. A 180-µL aliquot of the adjusted cell suspension was transferred to a microtube containing 20 µL of lysostaphin stock solution Vol. 80, Nr. 7, 2015 r Journal of Food Science M1527
M: Food Microbiology & Safety
Gene
Genetic diversity and antibiotic resistance . . . Table 3––Distribution of toxin genes and agr group. Nr. of positive isolates / Nr. of total isolates (%) Enterotoxin genes Origins Leaf vegetable Livestock Human Total a
sea
seb
sec
sed
see
sea-seea
tsst-1
agr I
agr II
agr III
agr IV
3/53 (5.66) 0/31 (0.00) 5/27 (18.52) 8/111 (7.20)
1/53 (1.89) 0/31 (0.00) 1/27 (3.70) 2/111 (1.80)
7/53 (13.21) 2/31 (6.46) 10/27 (37.04) 19/111 (17.13)
1/53 (1.89) 10/31 (32.26) 1/27 (3.70) 12/111 (10.97)
3/53 (5.66) 0/31 (0.00) 3/27 (11.11) 6/111 (5.41)
11/53 (20.75) 12/31 (38.71) 16/27 (59.26) 39/111 (35.14)
7/53 (13.21) 2/31 (6.45) 10/27 (37.04) 19/111 (17.12)
19/53 (35.85) 8/31 (25.81) 11/27 (40.74) 38/111 (34.23)
31/53 (58.49) 16/31 (51.61) 12/27 (44.44) 59/111 (53.15)
3/53 (5.66) 0/31 (0.00) 4/27 (14.81) 7/111 (6.79)
0/53 (0.00) 7/31 (22.58) 0/27 (0.00) 7/111 (6.79)
Number of S. aureus which were detected at least 1 or more enterotoxin gene(s) from sea to see.
M: Food Microbiology & Safety
(0.2 mg/mL in 20 mM sodium acetate, pH 4.5), and incubated at 37 °C for 20 min. After incubation, 40 µL of proteinase K were added. A bacterial suspension was embedded in a plug mold (BioRad, Hercules, Caflif., U.S.A.) consisting of 1.2% low-meltingR point agarose (SeaKem gold , Bio-Rad) and allowed to solidify at room temperature. Subsequently, the plug gel was incubated in EC lysis buffer (6 mM Tris-HCl, 1 M NaCl, 100 mM EDTA, 0.5% Brij-58, 0.2% sodium deoxycholate, 0.5% sodium lauroyl sarcosine) at 37 °C for 4 h. The plug gel was then washed with TE buffer 10 times in a shaking incubator at 55 °C for 10 min, and digested with SmaI for 4 h at 25 °C. The DNA fragments in the plug gel slice were separated by electrophoresis in 1% SeaKem gold agarose gels (0.5× Tris-borate-EDTA running buffer) using a CHEF Mapper system (Bio-Rad) with switch times of 5 to 40 s at 6 V/cm for 17 h at 14 °C. XbaI (TaKaRa) fragments of the cellular DNA from Salmonella serotype Braenerup strain H9812 were used as a standard (Hunter and others 2005). Gels were stained for 1 h R in 0.5× TBE buffer containing SYBR Gold stain (Invitrogen, Paisley, U.K.).
gene in livestock isolates, followed by sec. In contrast, sea and see were not found in livestock isolates. Conversely, sec was the most common gene in S. aureus isolates from leaf vegetables and humans followed by sea, see, and seb and sed. In leaf vegetable isolates, enterotoxin genes were detected from perilla leaves and lettuce, but not sprout. Because lettuce, perilla leaves, and sprouts were exposed to various conditions during growth, harvesting, and packaging, their enterotoxin gene profiles might differ. In Korea, the packaging process of perilla leaf and lettuce has more opportunities to contact with workers than sprout which is grown in automated rotary drum. These results demonstrate that good hygiene practices during the cultivation of leaf vegetables should be implemented to prevent contamination.
Results and Discussion
agr Subtyping All leaf vegetable isolates were classified into only 3 agr groups. Nineteen (35.85%) isolates belonged to agr group I, 31 (58.49%) to group II, and 3 (5.66%) to group III. The agr gene patterns of S. aureus isolates from leaf vegetables were similar to those from humans. The presence of the agr groups in the current study differed from previous reports (Peacock and others 2002; Ben Ayed and others 2006). This might reflect different ecological and geographical conditions. agr group II was the most frequent type (53.15%) of S. aureus (Table 3). Conversely, 7 of 31 (22.58%) isolates from livestock belonged to agr group IV, which was found only rarely in previous studies. The absence or low frequency of agr group IV isolates from other studies (Jarraud and others 2000; Shopsin and others 2003) suggests that competition does not favor these isolates. agr group IV S. aureus did not exhibit toxin genes or antibiotic resistance genes, with the exception of penicillin resistance, in the current study.
Distribution of toxin genes To assess the distribution of enterotoxins and TSST-1 genes, which cause foodborne disease, 53 S. aureus isolates from leaf vegetables were tested and compared with 31 and 27 S. aureus isolates from livestock and humans, respectively (Table 2). S. aureus isolates were collected from lettuce, sprout, and perilla leaves, which are the most popular leaf vegetables in Korea, and checked for the presence of common staphylococcal enterotoxin genes (sea, seb, sec, sed, and see). Among the 53 isolates from leaf vegetables, 11 (20.75%) isolates had 1 or more enterotoxin genes. Conversely, enterotoxin genes were detected in 59.26% of human and 38.71% of livestock isolates (Table 3). S. aureus isolates from human sources had more of the sampled enterotoxin genes than did those from leaf vegetables and livestock. In addition, sec was always detected together with tsst-1 (Figure 1). sed was the most common S. aureus
Antibiotic resistance patterns To understand the distribution of antibiotic resistance, 111 S. aureus samples isolated from leaf vegetables and others sources were analyzed (Table 4). The resistance of the S. aureus isolates was tested against 17 antibiotics: penicillin, oxacillin, gentamicin, erythromycin, amoxicillin/clavulanic acid, cephalothin, imipenem, ciprofloxacin, tetracycline, quinupristin/dalfopristin, telithromycin, clindamycin, chloramphenicol, linezolid, trimethoprim/sulfamethoxazole, nitrofurantoin, and vancomycin. Most isolates exhibited resistance to penicillin, but none to nitrofurantoin or vancomycin. In the antibiotic resistance trials, 19 of 53 (35.85%) isolates from leaf vegetables, 14 of 31 (46.32%) isolates from livestock production, and all human isolates exhibited multidrug resistance (supplementary data). Among the 53 isolates from vegetables, 15 (28.30%) had a positive reaction on the oxacillin disk
Data analysis PCR patterns of agr and toxin genes, antibiotic resistance tests and PFGE were performed at least 3 times. PFGE banding patterns were analyzed using Fingerprint II software (Bio-Rad). Images of gels were normalized by alignment with the appropriate size standard lane. For composite data of PFGE, PCR patterns and antibiotic resistance results, dendrogram was determined by the unweighted pair group method with averages performed using the Dice coefficient with a tolerance of 1%.
M1528 Journal of Food Science r Vol. 80, Nr. 7, 2015
Genetic diversity and antibiotic resistance . . . isolates were isolated from perilla leaves (supplementary data). Perilla leaf has trichome structures which are specialized epidermal structures that originate from epidermal cells of above-ground plant tissues. Previous studies demonstrate that bacteria do not occur in a uniform pattern across leaf surfaces, but are localized in particular sites such as trichomes (Beattie and Lindow 1999; Barak and others 2011). Perilla leaves has much more opportunities than other vegetables to contact with hands of workers because perilla leaves were tied about a dozen of leaves with hands during
M: Food Microbiology & Safety
test, but 4 of these exhibited negative PCR results for amplification of the mecA gene, which encodes the modified penicillin binding protein PBP-2a. Eleven S. aureus isolates from vegetables were MRSA, which indicates the presence of the mecA gene and phenotypic resistance to oxacillin. Although isolates from leaf vegetables had lower antibiotic resistance than did those from humans, they have antibiotic resistance against quinupristin/dalfopristin and linezolid which was not exist in S. aureus isolates from human. In leaf vegetable isolates, 15 of 19 (78.95%) multidrug-resistance
Figure 1–Dendrogram displaying the composite type S. aureus isolates based on a combination of PFGE, virulence factors (toxin gene and agr group) and antibiotic resistance patterns. The 72 composite types among 111 isolates were assigned to 8 major groups (including 20 composite types in 53 isolates of leaf vegetables). Vol. 80, Nr. 7, 2015 r Journal of Food Science M1529
Genetic diversity and antibiotic resistance . . . Table 4––Antibiotics and frequency of resistance in 111 S. aureus isolates. Nr. of antibiotic resistant S. aureus (%) Leaf vegetable
Livestock
Human
Total nr.
Antibiotics
Nr.
%
Nr.
%
Nr.
%
Nr.
%
Penicillin Oxacillin Gentamicin Erythromycin Amoxicillin-clavulanic acid Cephalothin Imipenem Ciprofloxacin Tetracycline Quinupristin-dalfopristin Telithromycin Clindamycin Chloramphenicol Linezolid Trimethoprim-sulfamethoxazole Nitrofurantoin Vancomycin Resistant to none Total nr. of S. aureus
51 15 10 11 10 9 7 7 7 2 1 1 1 1 0 0 0 0 53
96.23 28.30 18.87 20.75 18.87 16.98 13.21 13.21 13.21 3.77 1.89 1.89 1.89 1.89 0.00 0.00 0.00 0.00 100.00
25 10 10 7 4 3 5 4 6 0 4 4 1 0 0 0 0 4 31
80.65 32.26 32.26 22.58 12.90 9.68 16.13 12.90 19.35 0.00 12.90 12.90 3.23 0.00 0.00 0.00 0.00 12.90 100.00
25 24 23 23 23 22 18 16 16 0 16 16 2 0 2 0 0 0 27
92.59 88.89 85.19 85.19 85.19 81.48 66.67 59.26 59.26 0.00 59.26 59.26 7.41 0.00 7.41 0.00 0.00 0.00 100.00
101 49 43 41 37 34 30 27 29 2 21 21 4 1 2 0 0 4 111
90.99 44.14 38.74 36.94 33.33 30.63 27.03 24.32 26.13 1.80 18.92 18.92 3.60 0.90 1.80 0.00 0.00 3.60 100.00
M: Food Microbiology & Safety
packaging process. It can be explain S. aureus isolated from perilla leaf has high frequency of multidrug resistance. These results suggest that it is important to control the risk of S. aureus in leaf vegetables.
collect and pack perilla leaves and lettuces manually. This suggests that fresh leaf vegetables that are not processed using heat or other sterilization methods might be a vehicle for S. aureus transmission. Although the antibiotic resistance of S. aureus isolated from leaf vegetables was not higher than from other sources, they remain a threat because the antibiotic resistance could be transferred to other bacteria nearby. The toxin and agr gene patterns differed between S. aureus isolates from livestock and leaf vegetables and human isolates. This might reflect the environment in Korea, where most farms are separated from agricultural land and residential areas. Therefore, physical distance might affect bacterial transmission. No studies have compared S. aureus from agricultural origins, livestock, and human origins in Korea, although individual studies of S. aureus from each origin have been performed. The current study suggests that S. aureus contamination pathways exist, and provides data to guide the postharvest management of agricultural products.
Composite results with PFGE For the genetic characterization of S. aureus, several genotyping methods have been used to differentiate isolates beyond the species level. PFGE has been used successfully in epidemiological studies. Composite typing, which combines the PFGE patterns, enterotoxin gene distribution, and antibiotic resistance, was used to cluster isolates by calculating cut-off values. The 111 S. aureus isolates were clustered into 8 groups and 72 composite types (Figure 1). Four of the 8 groups (groups 2, 3, 6, and 8) did not possess enterotoxin genes, and belonged to agr groups III, I, II, and IV, respectively. Groups 1 (leaf vegetables), 2 (human), 4 (humans), and 8 (livestock) consisted entirely of S. aureus isolates from the same source, whereas the other groups consisted of S. aureus isolates from various sources. Groups 3 and 6 had resistance to a variety of Acknowledgment antibiotics, but no toxin genes. Group 5 and 7 had 1 or more toxin This work was supported by a grant (PJ010921) from the Rural genes and a relatively high resistance to antibiotics. In particular, Development Administration, Republic of Korea S. aureus strains belonging to group 7 had the tsst-1 and sec genes, and had the highest resistance to antibiotics. All group 7 isolates were agr group II. Although our composite results were consistent References with agr grouping, there was no direct correlation between arg Ayliffe GA. 1997. The progressive intercontinental spread of methicillin-resistant Staphylococcus aureus. Clin Infect Dis 24(Suppl 1):S74–S79. grouping and antibiotic resistance but agr grouping was linked to Barak JD, Kramer LC, Hao LY. 2011. Colonization of tomato plants by Salmonella enterica is cultivar dependent, and type 1 trichomes are preferred colonization sites. Appl Environ enterotoxin gene patterns. A previous study revealed that preferMicrobiol 77(2):498–504. ential association between certain agr alleles, certain toxin genes, Barros EM, Iorio NL, Bastos Mdo C, dos Santos KR, Giambiagi-deMarval M. 2007. Specieslevel identification of clinical staphylococcal isolates based on polymerase chain reaction– and a particular genetic background may make the activation of restriction fragment length polymorphism analysis of a partial groEL gene sequence. Diagn virulence factors more efficient (Jarraud and others 2002). The Microbiol Infect Dis 59(3):251–7. number of enterotoxin and PFGE types and antibiotic resistance Bayles KW, Iandolo JJ. 1989. Genetic and molecular analyses of the gene encoding staphylococcal enterotoxin D. J Bacteriol 171(9):4799–806. patterns suggests that the S. aureus populations in Korea are highly Beattie GA, Lindow SE. 1999. Bacterial colonization of leaves: a spectrum of strategies. Phydiverse. topathology 89(5):353–9.
Conclusions In this study, the genetic profiles, including toxin genes, antibiotic resistance, agr gene grouping, and PFGE patterns, of S. aureus isolates from leaf vegetables were compared with those from livestock and humans. The distribution patterns of toxin genes were similar in human and leaf vegetable isolates. In Korea, workers M1530 Journal of Food Science r Vol. 80, Nr. 7, 2015
Ben Ayed S, Boutiba-Ben Boubaker I, Samir E, Ben Redjeb S. 2006. Prevalence of agr specificity groups among methicilin resistant Staphylococcus aureus circulating at Charles Nicolle hospital of Tunis. Pathol Biol (Paris) 54(8-9):435–8. Betley MJ, Mekalanos JJ. 1988. Nucleotide sequence of the type A staphylococcal enterotoxin gene. J Bacteriol 170(1):34–41. Blomster-Hautamaa DA, Kreiswirth BN, Kornblum JS, Novick RP, Schlievert PM. 1986. The nucleotide and partial amino acid sequence of toxic shock syndrome toxin-1. J Biol Chem 261(33):15783–6. Bohach GA, Schlievert PM. 1987. Nucleotide sequence of the staphylococcal enterotoxin C1 gene and relatedness to other pyrogenic toxins. Mol Gen Genet: MGG 209(1):15–20.
Genetic diversity and antibiotic resistance . . . Liao CH, Fett WF. 2001. Analysis of native microflora and selection of strains antagonistic to human pathogens on fresh produce. J Food Prot 64(8):1110–5. Novick RP. 2003. Autoinduction and signal transduction in the regulation of staphylococcal virulence. Mol Microbiol 48(6):1429–49. Peacock SJ, Moore CE, Justice A, Kantzanou M, Story L, Mackie K, O’Neill G, Day NP. 2002. Virulent combinations of adhesin and toxin genes in natural populations of Staphylococcus aureus. Infect Immun 70(9):4987–96. Ryffel C, Tesch W, Birch-Machin I, Reynolds PE, Barberis-Maino L, Kayser FH, Berger-Bachi B. 1990. Sequence comparison of mecA genes isolated from methicillin-resistant Staphylococcus aureus and Staphylococcus epidermidis. Gene 94(1):137–8. Seo Y-H, Jang J-H, Moon K-D. 2010. Occurrence and characterization of enterotoxigenic Staphylococcus aureus Isolated from minimally processed vegetables and sprouts in Korea. Food Sci Biotechnol 19(2):313–9. Shopsin B, Mathema B, Alcabes P, Said-Salim B, Lina G, Matsuka A, Martinez J, Kreiswirth BN. 2003. Prevalence of agr specificity groups among Staphylococcus aureus strains colonizing children and their guardians. J Clin Microbiol 41(1):456–9. Swaminathan B, Barrett TJ, Hunter SB, Tauxe RV. 2001. PulseNet: the molecular subtyping network for foodborne bacterial disease surveillance, United States. Emerg Infect Dis 7(3):382–9. Yarwood JM, Schlievert PM. 2003. Quorum sensing in Staphylococcus infections. J Clin Invest 112(11):1620–25.
Supporting Information Additional Supporting Information may be found in the online version of this article at the publisher.s website: jfds12909-sup-0001-data
M: Food Microbiology & Safety
Brakstad OG, Aasbakk K, Maeland JA. 1992. Detection of Staphylococcus aureus by polymerase chain reaction amplification of the nuc gene. J Clin Microbiol 30(7):1654–60. Cameron DR, Howden BP, Peleg AY. 2011. The interface between antibiotic resistance and virulence in Staphylococcus aureus and its impact upon clinical outcomes. Clin Infect Dis 53(6):576–82. CLSI. 2013. Performance standards for antimicrobial susceptibility testing; 23th informational supplement. CLSI document M100-S23. Clinical and Laboratory Standards Institute, Wayne, PA, USA. Coast J, Smith RD. 2003. Solving the problem of antimicrobial resistance: is a global approach necessary? Drug Discov Today 8(1):1–2. Couch JL, Soltis MT, Betley MJ. 1988. Cloning and nucleotide sequence of the type E staphylococcal enterotoxin gene. J Bacteriol 170(7):2954–60. Dinges MM, Orwin PM, Schlievert PM. 2000. Exotoxins of Staphylococcus aureus. Clin Microbiol Rev 13(1):16–34. Gordon RJ, Lowy FD. 2008. Pathogenesis of methicillin-resistant staphylococcus aureus infection. Clin Infect Dis 46(Suppl 5):S350–S9. Hunter SB, Vauterin P, Lambert-Fair MA, VanDuyne MS, Kubota K, Graves L, Wrigley D, Barrett T, Ribot E. 2005. Establishment of a universal size standard strain for use with the PulseNet standardized pulsed-field gel electrophoresis protocols: converting the national databases to the new size standard. J Clin Microbiol 43(3):1045–50. Jarraud S, Lyon GJ, Figueiredo AM, Gerard L, Vandenesch F, Etienne J, Muir TW, Novick RP. 2000. Exfoliatin-producing strains define a fourth agr specificity group in Staphylococcus aureus. J Bacteriol 182(22):6517–22. Jarraud S, Mougel C, Thioulouse J, Lina G, Meugnier H, Forey F, Nesme X, Etienne J, Vandenesch F. 2002. Relationships between Staphylococcus aureus genetic background, virulence factors, agr groups (alleles), and human disease. Infect Immun 70(2):631–41. Jones CL, Khan SA. 1986. Nucleotide sequence of the enterotoxin B gene from Staphylococcus aureus. J Bacteriol 166(1):29–33. Jung H-J, Cho J-I, Park S-H, Ha S-D, Lee K-H, Kim C-H, Song E-S, Chung DH, Kim M-G, Kim K-Y, Kim K-S. 2005. Genotypic and Phenotypic Characteristics of Staphylococcus aureus Isolates from Lettuces and Raw Milk. KOREAN J. Food Sci Technol 37(1):134–141. Kadariya J, Smith TC, Thapaliya D. 2014. Staphylococcus aureus and staphylococcal food-borne disease: an ongoing challenge in public health. BioMed Res Int 2014: Article ID 827965, 9 pages.
Vol. 80, Nr. 7, 2015 r Journal of Food Science M1531
Staphylococcus aureus is an important foodborne pathogen on global basis. The current study investigated the genetic patterns in S. aureus isolates from leaf vegetables (n = 53). Additional isolates from livestock (n = 31) and humans (n = 27) were compared with the leaf vegetable isolates. Genes associated with toxins, antibiotic resistance, and pulsed-field gel electrophoresis (PFGE) patterns were analyzed. At least 1 enterotoxin-encoding gene (sea, seb, sec, sed, and see) was detected in 11 of 53 (20.75%) leaf vegetable isolates. When the agr (accessory gene regulator) grouping was analyzed, agr II was the major group, whereas agr IV was not present in leaf vegetable isolates. All S. aureus isolates from leaf vegetables were resistant to more than one of the antibiotics tested. Nineteen of 53 (35.85%) isolates from leaf vegetables exhibited multidrug-resistance, and 11 of these were MRSA (methicillin-resistant S. aureus). A dendrogram displaying the composite types of S. aureus isolates from 3 origins was generated based on the combination of the toxin genes, agr genes, antibiotic resistance, and PFGE patterns. The isolates could be clustered into 8 major composite types. The genetic patterns of S. aureus isolates from leaf vegetables and humans were similar, whereas those from livestock had unique patterns. This suggests some S. aureus isolates from leaf vegetables to be of human origin. Abstract:
M: Food Microbiology & Safety
Keywords: agr, antibiotic resistance, enterotoxin, PFGE, Staphylococcus aureus
Introduction Staphylococcus aureus is an important opportunistic pathogen that produces a wide variety of exoproteins that facilitate colonization. Staphylococcal food poisoning is one of the most common illnesses that results from the contamination of food by S. aureus enterotoxins (Kadariya and others 2014). Leaf vegetables that are in contact with the soil might harbor various pathogens (Liao and Fett 2001). Lettuce, sprouts, and perilla leaves are popular leaf vegetables in Korea, and several studies have shown that leaf vegetables can be contaminated by S. aureus (Jung and others 2005; Seo and others 2010). S. aureus secretes specific enzymes and cytotoxins (Dinges and others 2000), including toxic shock syndrome toxin-1 (TSST1) and enterotoxins (SEs, including SEA, SEB, SEC, SED, SEE, SEG, SHE, and SEI). TSST-1 and SEs are known as pyrogenic toxin superantigens (Dinges and others 2000). The pathogenicity of S. aureus is dependent on the production of virulence factors. In S. aureus, the accessory gene regulator (agr) locus, which encodes a two-component signaling pathway activated by an agr-encoded autoinducing peptide, was identified as a regulator of virulence factors that controls a large set of genes including most cell-wallassociated and extracellular proteins (Novick 2003). The part of the agr locus that consists of agrB, agrC, and agrD exhibits extensive sequence variation, which distinguishes S. aureus specificity groups (Jarraud and others 2000). S. aureus can be divided into 4 agr groups based on autoinducer receptor specificity (Yarwood and Schlievert 2003).
MS 20142131 Submitted 12/30/2015, Accepted 4/20/2015. Authors Hong, Kim, Kim, Heu, Kim, Roh, are with Microbial Safety Team, Natl. Academy of Agricultural Science, RDA, Wanju 565–851, Republic of Korea. Author Kim is with Dept. of Food Science, School of Agriculture and Life Sciences, Chonbuk Natl. Univ., Jeonju, Chonbuk 561–756, Republic of Korea. Direct inquiries to author Roh (E-mail: [email protected]).
M1526
Journal of Food Science r Vol. 80, Nr. 7, 2015
The increasing global prevalence of multidrug-resistant S. aureus and MRSA (methicillin-resistant S. aureus) is an important issue (Ayliffe 1997). The resistance of S. aureus to antimicrobial compounds reduces antimicrobial effectiveness and increases healthcare costs (Coast and Smith 2003). A previous study indicated that a number of genetic alterations related to antibiotic resistance also changed the virulence of some S. aureus strains (Gordon and Lowy 2008; Cameron and others 2011). The aim of this study was to assess the genetic diversity of S. aureus isolates from leaf vegetables in Korea and compare the resulting data with isolates from a variety of sources to track the route of contamination.
Materials and Methods Bacterial isolation From 2009 to 2011, a total of 84 S. aureus isolates were isolated from leaf vegetables and livestock. S. aureus from Lettuce and perilla leaf were sampled quarterly during 3 y at markets in Gyeonggi-do, Korea. Sprout was sampled quarterly during 1 y at markets in Gyeonggi-do, Korea. S. aureus from livestock was sampled during 3 y at farms in Jeollabuk-do and Chungcheongnamdo, Korea. Ten grams of each sample were added to 90 g of peptone water in the stomacher bag and homogenized with the stomacher. Samples were cultured on Baird-Parker agar (Difco, N.J., U.S.A.) at 37 °C for 24 h. All isolates were identified using ´ an API Staph ID kit (BioM´erieux, Marcy-l’Etoile, France; Barros and others 2007). The isolate identification was confirmed using species-specific polymerase chain reaction (PCR) for the S. aureus nuclease (nucA) gene (Brakstad and others 1992) and 16S rRNA sequence. S. aureus CCARM (culture collection antimicrobialresistant microbes, Seoul Women’s Univ., Korea) strains, which are clinical isolates from humans, were used in comparative analyses. R C 2015 Institute of Food Technologists
doi: 10.1111/1750-3841.12909 Further reproduction without permission is prohibited
Genetic diversity and antibiotic resistance . . . Table 1––Primers used in this study. Primer name
nucA
nucA-1 nucA-2 GMECAR-1 GMECAR-2 GSEAR-1 GSEAR-2 GSEBR-1 GSEBR-2 GSECR-1 GSECR-2 GSEDR-1 GSEDR-2 GSEER-1 GSEER-2 GTSSTR-1 GTSSTR-2 agr I-F agr I-R agr II-F agr II-R agr III-F agr III-R agr IV-F agr IV-R
mecA sea seb sec sed see TSST-1 agr I agr II agr III agr IV
Sequence (5’-3’) GCGATTGATGGTGATACGGTT AGCCAAGCCTTGACGAACTAAAGC ACTGCTATCCACCCTCAAAC CTGGTGAAGTTGTAATCTGG GGTTATCAATGTGCGGGTGG CGGCACTTTTTTCTCTTCGG GTATGGTGGTGTAACTGAGC CCAAATAGTGACGAGTTAGG AGATGAAGTAGTTGATGTGTATGG CACACTTTTAGAATCAACCG CCAATAATAGGAGAAAATAAAAG ATTGGTATTTTTTTTCGTTC AGGTTTTTTCACAGGTCATCC CTTTTTTTTCTTCGGTCAATC ACCCCTGTTCCCTTATCATC TTTTCAGTATTTGTAACGCC ATCGCAGCTTATAGTACTTGT CTTGATTACGTTTATATTTCATC AACGCTTGCAGCAGTTTATTT CGACATTATAAGTATTACAACA TATATAAATTGTGATTTTTTATTG TTCTTTAAGAGTAAATTGAGAA GTTGCTTCTTATAGTACATGTT CTTAAAAATATAGTGATTCCAATA
Table 2––Staphylococcus aureus used in this study. Origin Leaf vegetable Livestocka Humanb Total
Samples
Isolation sites
Nr. of isolates
Lettuce Sprout Perilla leaf Chicken Pig Cow Clinical samples
Local supermarket Local supermarket Local supermarket Farm Farm Farm Hospital
6 23 24 5 2 24 27 111
a
Chicken: skin, arthritis; pig: small intestine, neck; cow :raw milk (mastitis); Culture Collection Antimicrobial Resistant Microbes(CCARM, Korea) were isolated from Korean hospitals.
b
DNA extraction Staphylococcal cells were harvested from 3-mL overnight cultures by centrifugation at 8000 × g for 15 min. The harvested cells were resuspended in 0.1 mL of a freshly prepared mixture containing 5 µL of proteinase K (20 mg/mL) and 5 µL of lysostaphin (10 mg/mL), and incubated for 90 min at 45 °C. Then, 0.1 mL of 10 mM Tris-HCl (pH 8.0) and 2.5 mg/mL lysozyme were added, and the mixture was incubated at 37 °C for 2 h. DNA was then extracted using a G-spin genomic DNA extraction kit (Intron Biotechnology, Seongnam, Korea)
PCR The sequences of the primers used in this study are shown in Table 1. The PCR mixtures contained 50 nM of each of primer and 1 µg of genomic DNA. The thermal cycling conditions were 5 min at 95 °C, 30 cycles of 30 s at 95 °C, 30 s at 50 °C 57 °C, and 60 s at 72 °C, followed by 5 min at 72 °C. After PCR amplification, 10 µL of each reaction mixture were analyzed on a 1.0% agarose gel.
Product size (bp)
TM (°C)
280
57
Brakstad and others (1992)
163
57
Ryffel and others (1990)
102
57
Betley and Mekalanos (1988)
164
57
Jones and Khan (1986)
451
57
Bohach and Schlievert (1987)
278
57
Bayles and Iandolo (1989)
209
57
Couch and others (1988)
326
57
Blomster-Hautamaa and others (1986)
739
53
Jarraud and others (2000)
691
50
Jarraud and others (2000)
712
50
Jarraud and others (2000)
683
50
Jarraud and others (2000)
Reference
Disk diffusion method The antibiotic resistance of S. aureus to 17 antimicrobial agents was assessed using the disc diffusion method as described by the Clinical and Laboratory Standards Inst. (CLSI 2013). All isolates were incubated on TSA (Tryptic Soy Agar) overnight at 37 °C, and the density of the tested isolates were adjusted to a 0.5-McFarland turbidity standard (1–2 × 108 CFU/mL) using a spectrophotometer. Mueller-Hinton agar (MHA; Oxoid, Basingstoke, Hampshire, U.K.) was dispensed into a plastic culture plate to yield a uniform depth of 4 mm. A sterile swab was dipped into the adjusted suspension and streaked onto the entire surface of the MHA. After streaking, the inoculum was dried and an antimicrobial disk was applied onto the surface using a dispenser within 12 min of the inoculation. A total of 17 antimicrobial disks were tested: penicillin (10 U), oxacillin (1 µg), gentamycin (10 µg), erythromycin (15 µg), amoxicillin-clavulanic acid (30 µg), cephalothin (30 µg), imipenem (10 µg), ciprofloxacin (5 µg), tetracycline (30 µg), quinupristin/dalfopristin (15 µg), telithromycin (15 µg), clindamycin (2 µg), chloramphenicol (30 µg), linezolid (30 µg), trimethoprim/sulfamethoxazole (25 µg), nitrofurantoin (300 µg), and vancomycin (30 µg). All plates were incubated at 37 °C (or 30 °C for oxacillin) for 24 h. S. aureus ATCC 25923 was used as the quality control organism. MRSA was decided as presence of the mecA gene and oxacillin resistance. All experiments were repeated 3 times. Pulsed-field gel electrophoresis (PFGE) The PulseNet protocol (Swaminathan and others 2001) was adjusted to obtain clear and reproducible PFGE banding patterns using SmaI (TaKaRa, Otsu, Shiga, Japan). The isolates were cultured on TSA at 37 °C for 12 h. Cells were then harvested using a sterile cotton swab and suspended in 1 mL of TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0). The suspension was adjusted to an optical density at 600 nm (OD60 ) of 0.5 to 0.7. A 180-µL aliquot of the adjusted cell suspension was transferred to a microtube containing 20 µL of lysostaphin stock solution Vol. 80, Nr. 7, 2015 r Journal of Food Science M1527
M: Food Microbiology & Safety
Gene
Genetic diversity and antibiotic resistance . . . Table 3––Distribution of toxin genes and agr group. Nr. of positive isolates / Nr. of total isolates (%) Enterotoxin genes Origins Leaf vegetable Livestock Human Total a
sea
seb
sec
sed
see
sea-seea
tsst-1
agr I
agr II
agr III
agr IV
3/53 (5.66) 0/31 (0.00) 5/27 (18.52) 8/111 (7.20)
1/53 (1.89) 0/31 (0.00) 1/27 (3.70) 2/111 (1.80)
7/53 (13.21) 2/31 (6.46) 10/27 (37.04) 19/111 (17.13)
1/53 (1.89) 10/31 (32.26) 1/27 (3.70) 12/111 (10.97)
3/53 (5.66) 0/31 (0.00) 3/27 (11.11) 6/111 (5.41)
11/53 (20.75) 12/31 (38.71) 16/27 (59.26) 39/111 (35.14)
7/53 (13.21) 2/31 (6.45) 10/27 (37.04) 19/111 (17.12)
19/53 (35.85) 8/31 (25.81) 11/27 (40.74) 38/111 (34.23)
31/53 (58.49) 16/31 (51.61) 12/27 (44.44) 59/111 (53.15)
3/53 (5.66) 0/31 (0.00) 4/27 (14.81) 7/111 (6.79)
0/53 (0.00) 7/31 (22.58) 0/27 (0.00) 7/111 (6.79)
Number of S. aureus which were detected at least 1 or more enterotoxin gene(s) from sea to see.
M: Food Microbiology & Safety
(0.2 mg/mL in 20 mM sodium acetate, pH 4.5), and incubated at 37 °C for 20 min. After incubation, 40 µL of proteinase K were added. A bacterial suspension was embedded in a plug mold (BioRad, Hercules, Caflif., U.S.A.) consisting of 1.2% low-meltingR point agarose (SeaKem gold , Bio-Rad) and allowed to solidify at room temperature. Subsequently, the plug gel was incubated in EC lysis buffer (6 mM Tris-HCl, 1 M NaCl, 100 mM EDTA, 0.5% Brij-58, 0.2% sodium deoxycholate, 0.5% sodium lauroyl sarcosine) at 37 °C for 4 h. The plug gel was then washed with TE buffer 10 times in a shaking incubator at 55 °C for 10 min, and digested with SmaI for 4 h at 25 °C. The DNA fragments in the plug gel slice were separated by electrophoresis in 1% SeaKem gold agarose gels (0.5× Tris-borate-EDTA running buffer) using a CHEF Mapper system (Bio-Rad) with switch times of 5 to 40 s at 6 V/cm for 17 h at 14 °C. XbaI (TaKaRa) fragments of the cellular DNA from Salmonella serotype Braenerup strain H9812 were used as a standard (Hunter and others 2005). Gels were stained for 1 h R in 0.5× TBE buffer containing SYBR Gold stain (Invitrogen, Paisley, U.K.).
gene in livestock isolates, followed by sec. In contrast, sea and see were not found in livestock isolates. Conversely, sec was the most common gene in S. aureus isolates from leaf vegetables and humans followed by sea, see, and seb and sed. In leaf vegetable isolates, enterotoxin genes were detected from perilla leaves and lettuce, but not sprout. Because lettuce, perilla leaves, and sprouts were exposed to various conditions during growth, harvesting, and packaging, their enterotoxin gene profiles might differ. In Korea, the packaging process of perilla leaf and lettuce has more opportunities to contact with workers than sprout which is grown in automated rotary drum. These results demonstrate that good hygiene practices during the cultivation of leaf vegetables should be implemented to prevent contamination.
Results and Discussion
agr Subtyping All leaf vegetable isolates were classified into only 3 agr groups. Nineteen (35.85%) isolates belonged to agr group I, 31 (58.49%) to group II, and 3 (5.66%) to group III. The agr gene patterns of S. aureus isolates from leaf vegetables were similar to those from humans. The presence of the agr groups in the current study differed from previous reports (Peacock and others 2002; Ben Ayed and others 2006). This might reflect different ecological and geographical conditions. agr group II was the most frequent type (53.15%) of S. aureus (Table 3). Conversely, 7 of 31 (22.58%) isolates from livestock belonged to agr group IV, which was found only rarely in previous studies. The absence or low frequency of agr group IV isolates from other studies (Jarraud and others 2000; Shopsin and others 2003) suggests that competition does not favor these isolates. agr group IV S. aureus did not exhibit toxin genes or antibiotic resistance genes, with the exception of penicillin resistance, in the current study.
Distribution of toxin genes To assess the distribution of enterotoxins and TSST-1 genes, which cause foodborne disease, 53 S. aureus isolates from leaf vegetables were tested and compared with 31 and 27 S. aureus isolates from livestock and humans, respectively (Table 2). S. aureus isolates were collected from lettuce, sprout, and perilla leaves, which are the most popular leaf vegetables in Korea, and checked for the presence of common staphylococcal enterotoxin genes (sea, seb, sec, sed, and see). Among the 53 isolates from leaf vegetables, 11 (20.75%) isolates had 1 or more enterotoxin genes. Conversely, enterotoxin genes were detected in 59.26% of human and 38.71% of livestock isolates (Table 3). S. aureus isolates from human sources had more of the sampled enterotoxin genes than did those from leaf vegetables and livestock. In addition, sec was always detected together with tsst-1 (Figure 1). sed was the most common S. aureus
Antibiotic resistance patterns To understand the distribution of antibiotic resistance, 111 S. aureus samples isolated from leaf vegetables and others sources were analyzed (Table 4). The resistance of the S. aureus isolates was tested against 17 antibiotics: penicillin, oxacillin, gentamicin, erythromycin, amoxicillin/clavulanic acid, cephalothin, imipenem, ciprofloxacin, tetracycline, quinupristin/dalfopristin, telithromycin, clindamycin, chloramphenicol, linezolid, trimethoprim/sulfamethoxazole, nitrofurantoin, and vancomycin. Most isolates exhibited resistance to penicillin, but none to nitrofurantoin or vancomycin. In the antibiotic resistance trials, 19 of 53 (35.85%) isolates from leaf vegetables, 14 of 31 (46.32%) isolates from livestock production, and all human isolates exhibited multidrug resistance (supplementary data). Among the 53 isolates from vegetables, 15 (28.30%) had a positive reaction on the oxacillin disk
Data analysis PCR patterns of agr and toxin genes, antibiotic resistance tests and PFGE were performed at least 3 times. PFGE banding patterns were analyzed using Fingerprint II software (Bio-Rad). Images of gels were normalized by alignment with the appropriate size standard lane. For composite data of PFGE, PCR patterns and antibiotic resistance results, dendrogram was determined by the unweighted pair group method with averages performed using the Dice coefficient with a tolerance of 1%.
M1528 Journal of Food Science r Vol. 80, Nr. 7, 2015
Genetic diversity and antibiotic resistance . . . isolates were isolated from perilla leaves (supplementary data). Perilla leaf has trichome structures which are specialized epidermal structures that originate from epidermal cells of above-ground plant tissues. Previous studies demonstrate that bacteria do not occur in a uniform pattern across leaf surfaces, but are localized in particular sites such as trichomes (Beattie and Lindow 1999; Barak and others 2011). Perilla leaves has much more opportunities than other vegetables to contact with hands of workers because perilla leaves were tied about a dozen of leaves with hands during
M: Food Microbiology & Safety
test, but 4 of these exhibited negative PCR results for amplification of the mecA gene, which encodes the modified penicillin binding protein PBP-2a. Eleven S. aureus isolates from vegetables were MRSA, which indicates the presence of the mecA gene and phenotypic resistance to oxacillin. Although isolates from leaf vegetables had lower antibiotic resistance than did those from humans, they have antibiotic resistance against quinupristin/dalfopristin and linezolid which was not exist in S. aureus isolates from human. In leaf vegetable isolates, 15 of 19 (78.95%) multidrug-resistance
Figure 1–Dendrogram displaying the composite type S. aureus isolates based on a combination of PFGE, virulence factors (toxin gene and agr group) and antibiotic resistance patterns. The 72 composite types among 111 isolates were assigned to 8 major groups (including 20 composite types in 53 isolates of leaf vegetables). Vol. 80, Nr. 7, 2015 r Journal of Food Science M1529
Genetic diversity and antibiotic resistance . . . Table 4––Antibiotics and frequency of resistance in 111 S. aureus isolates. Nr. of antibiotic resistant S. aureus (%) Leaf vegetable
Livestock
Human
Total nr.
Antibiotics
Nr.
%
Nr.
%
Nr.
%
Nr.
%
Penicillin Oxacillin Gentamicin Erythromycin Amoxicillin-clavulanic acid Cephalothin Imipenem Ciprofloxacin Tetracycline Quinupristin-dalfopristin Telithromycin Clindamycin Chloramphenicol Linezolid Trimethoprim-sulfamethoxazole Nitrofurantoin Vancomycin Resistant to none Total nr. of S. aureus
51 15 10 11 10 9 7 7 7 2 1 1 1 1 0 0 0 0 53
96.23 28.30 18.87 20.75 18.87 16.98 13.21 13.21 13.21 3.77 1.89 1.89 1.89 1.89 0.00 0.00 0.00 0.00 100.00
25 10 10 7 4 3 5 4 6 0 4 4 1 0 0 0 0 4 31
80.65 32.26 32.26 22.58 12.90 9.68 16.13 12.90 19.35 0.00 12.90 12.90 3.23 0.00 0.00 0.00 0.00 12.90 100.00
25 24 23 23 23 22 18 16 16 0 16 16 2 0 2 0 0 0 27
92.59 88.89 85.19 85.19 85.19 81.48 66.67 59.26 59.26 0.00 59.26 59.26 7.41 0.00 7.41 0.00 0.00 0.00 100.00
101 49 43 41 37 34 30 27 29 2 21 21 4 1 2 0 0 4 111
90.99 44.14 38.74 36.94 33.33 30.63 27.03 24.32 26.13 1.80 18.92 18.92 3.60 0.90 1.80 0.00 0.00 3.60 100.00
M: Food Microbiology & Safety
packaging process. It can be explain S. aureus isolated from perilla leaf has high frequency of multidrug resistance. These results suggest that it is important to control the risk of S. aureus in leaf vegetables.
collect and pack perilla leaves and lettuces manually. This suggests that fresh leaf vegetables that are not processed using heat or other sterilization methods might be a vehicle for S. aureus transmission. Although the antibiotic resistance of S. aureus isolated from leaf vegetables was not higher than from other sources, they remain a threat because the antibiotic resistance could be transferred to other bacteria nearby. The toxin and agr gene patterns differed between S. aureus isolates from livestock and leaf vegetables and human isolates. This might reflect the environment in Korea, where most farms are separated from agricultural land and residential areas. Therefore, physical distance might affect bacterial transmission. No studies have compared S. aureus from agricultural origins, livestock, and human origins in Korea, although individual studies of S. aureus from each origin have been performed. The current study suggests that S. aureus contamination pathways exist, and provides data to guide the postharvest management of agricultural products.
Composite results with PFGE For the genetic characterization of S. aureus, several genotyping methods have been used to differentiate isolates beyond the species level. PFGE has been used successfully in epidemiological studies. Composite typing, which combines the PFGE patterns, enterotoxin gene distribution, and antibiotic resistance, was used to cluster isolates by calculating cut-off values. The 111 S. aureus isolates were clustered into 8 groups and 72 composite types (Figure 1). Four of the 8 groups (groups 2, 3, 6, and 8) did not possess enterotoxin genes, and belonged to agr groups III, I, II, and IV, respectively. Groups 1 (leaf vegetables), 2 (human), 4 (humans), and 8 (livestock) consisted entirely of S. aureus isolates from the same source, whereas the other groups consisted of S. aureus isolates from various sources. Groups 3 and 6 had resistance to a variety of Acknowledgment antibiotics, but no toxin genes. Group 5 and 7 had 1 or more toxin This work was supported by a grant (PJ010921) from the Rural genes and a relatively high resistance to antibiotics. In particular, Development Administration, Republic of Korea S. aureus strains belonging to group 7 had the tsst-1 and sec genes, and had the highest resistance to antibiotics. All group 7 isolates were agr group II. Although our composite results were consistent References with agr grouping, there was no direct correlation between arg Ayliffe GA. 1997. The progressive intercontinental spread of methicillin-resistant Staphylococcus aureus. Clin Infect Dis 24(Suppl 1):S74–S79. grouping and antibiotic resistance but agr grouping was linked to Barak JD, Kramer LC, Hao LY. 2011. Colonization of tomato plants by Salmonella enterica is cultivar dependent, and type 1 trichomes are preferred colonization sites. Appl Environ enterotoxin gene patterns. A previous study revealed that preferMicrobiol 77(2):498–504. ential association between certain agr alleles, certain toxin genes, Barros EM, Iorio NL, Bastos Mdo C, dos Santos KR, Giambiagi-deMarval M. 2007. Specieslevel identification of clinical staphylococcal isolates based on polymerase chain reaction– and a particular genetic background may make the activation of restriction fragment length polymorphism analysis of a partial groEL gene sequence. Diagn virulence factors more efficient (Jarraud and others 2002). The Microbiol Infect Dis 59(3):251–7. number of enterotoxin and PFGE types and antibiotic resistance Bayles KW, Iandolo JJ. 1989. Genetic and molecular analyses of the gene encoding staphylococcal enterotoxin D. J Bacteriol 171(9):4799–806. patterns suggests that the S. aureus populations in Korea are highly Beattie GA, Lindow SE. 1999. Bacterial colonization of leaves: a spectrum of strategies. Phydiverse. topathology 89(5):353–9.
Conclusions In this study, the genetic profiles, including toxin genes, antibiotic resistance, agr gene grouping, and PFGE patterns, of S. aureus isolates from leaf vegetables were compared with those from livestock and humans. The distribution patterns of toxin genes were similar in human and leaf vegetable isolates. In Korea, workers M1530 Journal of Food Science r Vol. 80, Nr. 7, 2015
Ben Ayed S, Boutiba-Ben Boubaker I, Samir E, Ben Redjeb S. 2006. Prevalence of agr specificity groups among methicilin resistant Staphylococcus aureus circulating at Charles Nicolle hospital of Tunis. Pathol Biol (Paris) 54(8-9):435–8. Betley MJ, Mekalanos JJ. 1988. Nucleotide sequence of the type A staphylococcal enterotoxin gene. J Bacteriol 170(1):34–41. Blomster-Hautamaa DA, Kreiswirth BN, Kornblum JS, Novick RP, Schlievert PM. 1986. The nucleotide and partial amino acid sequence of toxic shock syndrome toxin-1. J Biol Chem 261(33):15783–6. Bohach GA, Schlievert PM. 1987. Nucleotide sequence of the staphylococcal enterotoxin C1 gene and relatedness to other pyrogenic toxins. Mol Gen Genet: MGG 209(1):15–20.
Genetic diversity and antibiotic resistance . . . Liao CH, Fett WF. 2001. Analysis of native microflora and selection of strains antagonistic to human pathogens on fresh produce. J Food Prot 64(8):1110–5. Novick RP. 2003. Autoinduction and signal transduction in the regulation of staphylococcal virulence. Mol Microbiol 48(6):1429–49. Peacock SJ, Moore CE, Justice A, Kantzanou M, Story L, Mackie K, O’Neill G, Day NP. 2002. Virulent combinations of adhesin and toxin genes in natural populations of Staphylococcus aureus. Infect Immun 70(9):4987–96. Ryffel C, Tesch W, Birch-Machin I, Reynolds PE, Barberis-Maino L, Kayser FH, Berger-Bachi B. 1990. Sequence comparison of mecA genes isolated from methicillin-resistant Staphylococcus aureus and Staphylococcus epidermidis. Gene 94(1):137–8. Seo Y-H, Jang J-H, Moon K-D. 2010. Occurrence and characterization of enterotoxigenic Staphylococcus aureus Isolated from minimally processed vegetables and sprouts in Korea. Food Sci Biotechnol 19(2):313–9. Shopsin B, Mathema B, Alcabes P, Said-Salim B, Lina G, Matsuka A, Martinez J, Kreiswirth BN. 2003. Prevalence of agr specificity groups among Staphylococcus aureus strains colonizing children and their guardians. J Clin Microbiol 41(1):456–9. Swaminathan B, Barrett TJ, Hunter SB, Tauxe RV. 2001. PulseNet: the molecular subtyping network for foodborne bacterial disease surveillance, United States. Emerg Infect Dis 7(3):382–9. Yarwood JM, Schlievert PM. 2003. Quorum sensing in Staphylococcus infections. J Clin Invest 112(11):1620–25.
Supporting Information Additional Supporting Information may be found in the online version of this article at the publisher.s website: jfds12909-sup-0001-data
M: Food Microbiology & Safety
Brakstad OG, Aasbakk K, Maeland JA. 1992. Detection of Staphylococcus aureus by polymerase chain reaction amplification of the nuc gene. J Clin Microbiol 30(7):1654–60. Cameron DR, Howden BP, Peleg AY. 2011. The interface between antibiotic resistance and virulence in Staphylococcus aureus and its impact upon clinical outcomes. Clin Infect Dis 53(6):576–82. CLSI. 2013. Performance standards for antimicrobial susceptibility testing; 23th informational supplement. CLSI document M100-S23. Clinical and Laboratory Standards Institute, Wayne, PA, USA. Coast J, Smith RD. 2003. Solving the problem of antimicrobial resistance: is a global approach necessary? Drug Discov Today 8(1):1–2. Couch JL, Soltis MT, Betley MJ. 1988. Cloning and nucleotide sequence of the type E staphylococcal enterotoxin gene. J Bacteriol 170(7):2954–60. Dinges MM, Orwin PM, Schlievert PM. 2000. Exotoxins of Staphylococcus aureus. Clin Microbiol Rev 13(1):16–34. Gordon RJ, Lowy FD. 2008. Pathogenesis of methicillin-resistant staphylococcus aureus infection. Clin Infect Dis 46(Suppl 5):S350–S9. Hunter SB, Vauterin P, Lambert-Fair MA, VanDuyne MS, Kubota K, Graves L, Wrigley D, Barrett T, Ribot E. 2005. Establishment of a universal size standard strain for use with the PulseNet standardized pulsed-field gel electrophoresis protocols: converting the national databases to the new size standard. J Clin Microbiol 43(3):1045–50. Jarraud S, Lyon GJ, Figueiredo AM, Gerard L, Vandenesch F, Etienne J, Muir TW, Novick RP. 2000. Exfoliatin-producing strains define a fourth agr specificity group in Staphylococcus aureus. J Bacteriol 182(22):6517–22. Jarraud S, Mougel C, Thioulouse J, Lina G, Meugnier H, Forey F, Nesme X, Etienne J, Vandenesch F. 2002. Relationships between Staphylococcus aureus genetic background, virulence factors, agr groups (alleles), and human disease. Infect Immun 70(2):631–41. Jones CL, Khan SA. 1986. Nucleotide sequence of the enterotoxin B gene from Staphylococcus aureus. J Bacteriol 166(1):29–33. Jung H-J, Cho J-I, Park S-H, Ha S-D, Lee K-H, Kim C-H, Song E-S, Chung DH, Kim M-G, Kim K-Y, Kim K-S. 2005. Genotypic and Phenotypic Characteristics of Staphylococcus aureus Isolates from Lettuces and Raw Milk. KOREAN J. Food Sci Technol 37(1):134–141. Kadariya J, Smith TC, Thapaliya D. 2014. Staphylococcus aureus and staphylococcal food-borne disease: an ongoing challenge in public health. BioMed Res Int 2014: Article ID 827965, 9 pages.
Vol. 80, Nr. 7, 2015 r Journal of Food Science M1531
