10844

Biochemistry 1991, 30, 10844-10849

Peale, F. V., Jr., Ludwig, L. B., Zain, S., Hilf, R., & Bambara, R. A. (1988) Proc. Natl. Acad.Sci. U.S.A. 85, 1038-1041. Ptashne, M. (1984) Nature 308, 753-754. Record, M. T., Jr., Lohman, T. M., & De Haseth, P. (1976) J . Mol. Biol. 107, 145-158. Record, M. T., Jr., Ha, J.-H., & Fisher, M. A. (1991) Methods Enzymol. (in press). Rodriguez, R., Carson, M. A,, Weigel, N. L., O’Malley, B. W., & Schrader, W. T. (1989) Mol. Endocrinol. 3, 356-362. SAS Institute Inc. (1988) SASISTAT Users’s Guide, SAS lnstitute Inc., Cary, NC.

Skafar, D. F., & Notides, A. C. (1985) J. Biol. Chem. 260, 12208-1 221 3. Travers, A. (1983) Nature 303, 7 5 5 . Travers, A. (1984) Nature 308, 754. von Hippel, P. H., & Berg, 0. G. (1989) J . Biol. Chem. 264, 675-678. Walker, P., Germond, J.-E., Luedi-Brown, M., Givel, F., & Wahli, W. (1984) Nucleic Acids Res. 12, 8611-8626. Yamamoto, K. R., & Alberts, B. (1974) J . Biol. Chem. 249, 7076-7086. Yamamoto, K. R., & Alberts, B. (1975) Cell 4, 301-310.

Gene Structure and Expression of the Rat Cytochrome P450IIC13, a Polymorphic, Male-Specific Cytochrome in the P450IIC Subfamily+** Hidetaka Eguchi, Stefan Westin, Anders Strom, Jan-bike Gustafsson, and Peter G. Zaphiropoulos*>s Department of Medical Nutrition, F60, Karolinska Institute, Novum, Huddinge University Hospital, SI 41 -86 Huddinge, Sweden Received June 14, 1991; Revised Manuscript Received August 22, 1991

ABSTRACT: The male-specific CYP2C13 gene has been isolated from two independent rat genomic libraries. This gene spans more than 50 kb and contains eight introns which are subject to the GT-AG rule. Two allelic forms of the CYP2C13 gene were identified. Determination of the exonic sequences revealed that one of them encodes cytochrome P450(+g) and the other encodes cytochrome P450(-g). Using allele-specific restriction enzyme sites, a good correlation between the genotype and the phenotype of CYP2C13 was shown. Nucleotide substitutions between the (+g) and the (-8) genes exist not only in the exons but also in the introns and the 5’-flanking region. Although five nucleotide differences were identified within 287 base pairs of the (+g) and (-8) 5’-flanking regions, the transcription initiation sites were identical. In addition to a canonical TATA box located 31 base pairs upstream of the start site of transcription, putative binding sites for the liver-enriched and liver-specific transcription factors H N F l /LF-B 1/APF, HNF3, HNF4/AF- 1, C/EBP, LAP, and eH-TF/TGT3 and the ubiquitous factors NF-1 and OTF-1 were identified.

C y t o c h r o m e P4501IC13 (P450g)’ is a constitutive malespecific form of cytochrome P450 in rat liver, which, in a reconstituted system, catalyzes the hydroxylation of testosterone at the 66- and I5a-positions (Ryan et al., 1984). Cytochrome P45011C13 is known to possess a phenotypic polymorphism indicated by the high, low, or intermediate protein levels found in livers of outbred strains of male Long Evans or Sprague-Dawley rats. On the other hand, inbred ACI rats express only high levels, while inbred Fischer rats express only low levels of P450IIC13 (Bandiera et al., 1986; McClellan-Green et al., 1987; Rampersaud et al., 1987). In contrast to the protein levels which apparently differ from strain to strain, the amount of P450IIC13 mRNA is found to be almost identical (McClellan-Green et al., 1987, 1989a). Genetic experiments demonstrated additive inheritance for the P45011C13 phenotype (Rampersaud et al., 1987; Rampersaud & Walz, 1987a,b). Two different groups have isolated and sequenced cDNAs for P450IIC13 from male Sprague-Dawley ‘This study was supported by a grant from the Swedish Medical Research Council (No. 03x-06807). *The gcnctic sequence reported in this paper has been submitted to GenBank under Accession Number 505352. * To whom correspondence should be addressed. #Supported by the Swedish Medical Research Council (No. 13P08437).

0006-2960/91/0430-10844%02.50/0

rats (McClellan-Green et al., 1989a; Zaphiropoulos et ai., 1990a; Yeowell et al., 1990). Although the 5’-noncoding leader sequence and the 3’-noncoding region of the cDNA isolated from the (-g) phenotype (low protein levels) were identical to that of the (+g) phenotype (high protein levels), the coding sequence differed by nine bases resulting in seven amino acids changes (Yeowell et ai., 1990). In our laboratory the growth hormone (GH) effects on the expression of sex-specific cytochrome P450s have been extensively investigated. For example, the female-specific P450IIC12 (P45015/3) requires continuous GH exposure for expression (Zaphiropoulos et al., 1988). On the other hand, P450IIC13 is dramatically suppressed by continuous GH treatment in inbred ACI rats (McClellan-Green et al., 1989b). Since P450IIC12 and -1IC13 have highly similar primary structures, the mechanisms underlying their dramatically opposed GH regulation are under intense investigation. In the present work, we used genomic libraries from outbred Sprague-Dawley rats to isolate the genes encoding the (+g) and the (-8) forms of P450IIC 13 as a means to study regulation of expression at the gene level. This allowed the dem~~

~~~

~

~

Abbreviations: P450, cytochrome P450; kb, kilobase pair(s); bp, base pair(s); GH, growth hormone; SDS, sodium dodecyl sulfate; 1 X SSC, 0.015 M sodium citrate/O.l5 M NaCl (pH 7.0) I

Q 1991 American Chemical Societv

Biochemistry, Vol. 30, No. 45, 1991

Gene Structure of CYP2C13 onstration of a direct correlation between the presence of the (+g) or (-8) gene with the expression of the corresponding phenotype, thus establishing the allelic polymorphism of P45011C 13. MATERIALS A N D METHODS Materiuls. [ ( u - ~ ~ P I ~ C (3000 T P Ci/mmol), [y-32P]ATP (5000 Ci/mmol), [w3%]dATP (1000 Ci/mmol), and Multi-prime labeling kits were supplied by Amersham (Arlington Heights, IL). The Sequenase sequencing kit was obtained from the U S . Biochemical Corp. (Cleveland, OH). Rat genomic libraries Charon 4A and EMBL3/SP6/T7 were from Clontcch laboratories (Palo Alto, CA). Oligo(dT)-cellulose type 7 and NICK columns were from Pharmacia LKB Biotechnology Inc. (Uppsala, Sweden). Gene Screen Plus nylon membranes were from New England Nuclear (Boston, MA). Animals. Sprague-Dawley rats were obtained from Charles River Animal Laboratory (Sulzfeld, Germany). Fischer rats were from Mollegaards Avelslaboratorium (Skensved, Denmark). The animals were sacrificed at week seven. Bacterial Strains and Propagation of Virus. X phage Charon 4A and EMBL3/SP6/T7 were propagated in Escherichia coli LE392. Plasmid DNA was grown in E . coli XL-I Blue and purified by the alkaline-SDS method described in Sambrook et at. (1989). Screening of Rat Genomic Libraries and Sequencing of Positive Clones. More than 1 million plaque-forming units of rat genomic libraries in X phage Charon 4A and EMBL3/SP6/T7 were screened in duplicate, by in situ plaque filter hybridization (Sambrook et at., 1989), with P450l IC I3(-g) cDNA fragments (0.3-kb EcoRI/EcoRI, 0.9-kb Arnl/EcoRI, and 0.6-kb XballEcoRI fragments; Zaphiropoulos et al., 1990a). These fragments were radiolabeled by random priming with [ ( u - ~ ~ P I ~ C toTaPspecific activity of about 1 X IO9 cpm/pg. Filter hybridization was performed overnight at 42 OC in a solution of 6x SSC (1x SSC, 0. I5 M NaCl containing 15 mM sodium citrate), 50% formamide, and I ’% SDS. The filters were washed quickly twice in 2x SSC at room temperature, then twice for 30 min each in 2x SSC/l’% SDS, 0 . 5 ~SSC/l% SDS, and finally 0 . 1 ~ SSC/ 1% SDS at 68 OC. Phage DNA was prepared essentially according to Sambrook et al. (1989). The clones which contained exons 1-8 were isolated from the EMBL3/SP6/T7 library and the clone containing exon 9 was isolated from the Charon 4A library. After subcloning into the pGEM3Z vector, sequencing was performed with the use of universal and P45011C 13-specific oligonucleotide primers. At least two primcrs for each of the P45011C13 exons, allowing sequencing in opposite directions, were used. Six independent clones for the (+g) and five for the (-g) alleles were sequenced. Isolatiori of Genomir D N A and Poly(A)+RNA. Genomic DNA was prepared from livers of Sprague-Dawley or Fischer rats by thc phcnol/chloroform extraction protocol described in Sambrook et al. (1989). Total liver RNA was prepared by the acid guanidinium thiocyanate/phenol/chloroform method (Chomczynski et al., 1987), and poly(A)+ RNA was enriched by oligo(dT) column chromatography. Southern Blot Analysis. Rat chromosomal DNA or cloned phage DNA was digested with restriction enzymes and subjected to 0.8-1 ’% agarose gel electrophoresis. DNA fragments were transferred to Gene Screen Plus filters and hybridized with radiolabeled cDNA or oligonucleotide probes. Hybridization and washing conditions were as described above. Northern Blot Analysis. Total RNAs of individual rats were subjected to 2.2% formaldehyde/l.2% agarose gel electrophoresis and transferred to Gene Screen Plus filters. Two

A

B

B

B

B

B

B

B B B B B B

B

B

B

B B B B B B

0

1

234

I

I 1 I

5

10845

2%

1 kb

H

I

7 I

+9

I

8 1

i

9 ig 1

234

li

nrn

5 n

7 7 n

n

0 I

(A) Schematic diagram of the structure of the rat CYP2C13 gene. The (+g) gene is shown above and the (-g) gene is shown below the solid line. Rectangles indicate exons. The (-g) gene exons whose sequences differ from that of the (+g) are represented by open rectangles. The locations of BamHI sites (B) are shown. (B) Representative X phage clones for CYP2C13 from which sequencing information was obtained. FIGURE 1:

21-base oligonucleotides complementary to a region containing three base changes between the (+g) and (-g) cDNAs (positions 700-720) were synthesized and purified by the oligonucleotide synthesis facilities of NOVUM, Huddinge University Hospital. The (+g) probe 5’-AAG CCA TGT ATG ATT TTT GAA-3’ and the (-8) probe 5’-AAC CCA TGT ATA ATT TTT TAA-3’ were phosphorylated by T4 polynucleotide kinase using [ T - ~ ~ P ] A Tand P purified by NICK column chromatography. Hybridization was carried out overnight at 45 OC in 6x SSC/l% SDS containing salmon sperm DNA at the concentration of 100 mg/mL. The filters were washed twice with 6x SSC/l% SDS at 45 OC. Primer Extension. For primer extension, the oligonucleotide 5’-CCA TAG AGA CAG GAA-3’, which is complementary to positions 46-60 of the coding sequence, was hybridized with 10 pg of poly(A)+ RNA. The complex was incubated with 100 units of AMV reverse transcriptase for 60 min at 42 OC (Van het Schip et al., 1987). Extended DNA fragments were analyzed on 6% acrylamide/7 M urea gels. The same oligonucleotide was used with cloned genomic DNA to generate a sequencing ladder as molecular weight markers. RESULTS Isolation of the CYP2C13 Genes. Using P450IIC13(-g) cDNA segments as probes, rat genomic libraries in X phage Charon 4A and EMBL3/SP6/T7 were screened. Twenty-five positive clones were isolated. Southern blot analysis of these X phage clones with the (+g)- and the (-g)-specific oligonucleotides as well as direct sequencing of the exonic regions showed that they could be divided into two groups, one of which codes for P450(+g), and the other for P450(-g) (data not shown). The coding sequence and the 3’-untranslated region of both the (+g) and the (-g) genes were in complete agreement with that of the corresponding cDNAs (McClelIan-Green et at., 1989a; Zaphiropoulos et at., 1990a; Yeowell et at., 1990). The CYP2Cl3 gene appears to encompass more than 50 kb. A schematic representation of the gene structure and of some isolated X phage clones is shown in Figure 1. Although we succeeded in determining whether the X phage clones containing exons 1-8 are of the (+g) or (-g) type, the clone containing exon 9 could not be categorized because this

Eguchi et al.

10846 Biochemistry, Vol. 30, No. 45, 1991

A

1 2 3 4 5 6 7 8 9 1011121314151617

+

+ ++++++ +++ +++++++ ++++++++

Table I: Localization of the Intron-Exon" Boundaries of CYP2C13 Intron size (bp)

Intron number

10

B

1 2 3 4 5 6 7 8 91011121314151617

+

+

++++++

+++

1 2 3 4 5 6 7 8 9 1011121314151617

+++++++++++++++

9000

CCGAA-aagcttatttctc CAGCA-8.t

FIGURE 2: (A)

Genomic Southern hybridization of individual rats digested with BumH I and hybridized with the 0.3-kb EcoRI/EcoRI cDNA segment. ( B ) Northern blot analysis of total hepatic RNA isolated from the same individual rats (lanes 1-15, male SpragueDawley; lanes 16 and 17, male Fischer) and hybridized with oligonucleotide probes specific for (+g) and (-g).

exon is located far downstream (>20 kb) and could not be linked with exon 7, where nucleotide substitutions between the (+g) and the (-g) genes do exist. Correlation between Gene Structure and m RNA Expression of CYPZCU. In order to investigate the polymorphic nature of P45011C13, Southern and Northern hybridizations were performed with genomic DNA and RNA isolated from 17 individual rats. Chromosomal DNA was digested with BamHI, an enzyme that generates a different restriction pattern between the (+g) and the (-g) genes (see Figure 1, intron 5), subjected to agarose gel electrophoresis, and transferred to a Gene Screcn Plus filter. The filter was hybridized with a 0.3-kb EcoRI/EcoRI cDNA fragment that encompasses the complete first exon and part of the second exon. Rats possessing thc (+g) CYP2C 1 3 gene are expected to reveal a band of 6 kb while the presence of the (-g) gene will be indicated by a 9-kb band. Three different types of hybridization patterns were observed: type 1, only a 6-kb band (rat 1,2,4,5,7, and 14); type 2, only a 9-kb band (rat 16 and 17); type 3, both a 6-kb and a 9-kb band (rat 3,6,8,9, 10, 11, 12, 13, and 15) (Figure 2A). The 9-kb band that is seen in rat 5 is apparently an artifact, sincc it was not reproducible in additional experiments with chromosomal DNA from the same rat (data not shown), and it therefore was not considered in the above classification. I n addition to the genomic Southern hybridization, Northern blot analysis of the same rats with (+g)and (-g)-specific oligonucleotide probes was performed (Figure 2B). It was found that the type 1 rats expressed only the (+g) mRNA, type 2 expressed only the (-g), and type 3 expressed both of them. This correlated very well with the presence or absence of the (+g) or (-g) CYP2C13 genes. Taken together, these observations confirmed that the P450IIC13(+g) and the P45011C13(-g) are products of the allelic CYP2C13 genes. Intron Sequences of CYP2C13. All of the exon/intron boundaries of the CY P2C 13 gene were well conserved relative to the other P450IIC subfamily members and were always subject to the GT-AG rule (Table I). Nucleotide substitutions between the (+g) and the (-8) genes were found to occur also within intron sequences (Table I). Worth noting is a nucleotide deletion in intron 4 with the (+g) gene having a stretch of eight T's while only seven T's are present in the (-g) gene (Table I).

>13000

agaaactcat

"The exonic sequences are denoted by uppercase letters while the intronic are denoted by lowercase letters. *The (-8) nucleotides which differ from the (+g) nucleotides are shown on the upper lines. The deleted nucleotide in intron 4 of (-8) is indicated by a bar (-). Two (+g) and two (-g) clones were used to verify the differences in intron 2, two (+g) and two (-g) clones were used for intron 4, and two (+g) and one (-g) clones were used for intron 6. T GAATCCGGGCTAATAGCCACTTAT~TTAGTGCATT

-287

7NE'-1

-250

CTATGTGTGTTTTTCTGTGBTTEEGTTACTTCACTCAGGA NF-Y

-200

AGATTTGAGTGATCATAGTATCAG~T~TATTTATAGACA HNF3 A

-150

TCCTACAAAAATGAAAAATTCTTATCATC~~,TTTGAAG HNF4 /AF- 1

-100 T

-

50

G T T BTTGATTCTGATGATGCAT-TTTCTCGAGTCCCTCATCACAGTG

+

1

GTGTCCATMGAAGGGTCTCC

*

FIGURE 3: Nucleotide sequence of the 5'-flanking region of the CYP2CI 3 gene. The sequence of the (-g) gene that differs from the (+g) gene is shown on the upper line. The transcription initiation site determined by primer extension is designated as + I and is indicated by an asterisk. The sequences of putative binding sites for transcription factors are thickly underlined, with the corresponding name shown. A dyad symmetry motif is indicated by arrows. The TATA box is underlined and the translation initiation codon ATG is boxed.

5LFlanking Region of CYPZC13 Gene. The 5'-flanking regions of both the (+g) and the (-g) CYP2C13 genes up to 308 bp from the translation initiation codon were sequenced (Figure 3). Two nucleotide differences between the 5'411translated region of the P450IIC13(+g) cDNA as reported by McClellan-Green et al. (1989a) and that of the CYP2C13 gene were identified. The nucleotides 13 and 12 bp upstream from the translation initation codon were AA in both the (+g) and the (-8) gene while TG in the P45OIIC13(+g) cDNA. Several independent clones containing this region from both the (+g) and the (-g) gene were sequenced, and they always revealed the same AA dinucleotides, therefore confirming the

Biochemistry, Vol. 30, No. 45, 1991

10847

FIGURE 4: Determination of the transcription initiation site of CYP2CI 3. An oligonucleotide complementary to part of the first exon was hybridized with poly(A)+ RNAs from a 7-week-old (+g) or (-g) male rat and extended with AMV reverse transcriptase. The elongation products were analyzed on a sequencing gel as described under Materials and Methods and shown by arrows on the 7wd mRNA lanes. As a negative control, tRNA was used under the same conditions. The same primer was used to generate a sequencing ladder, TGCA, as size markers.

a canonical TATA box at -31 from the transcription initiation site (Figure 3). Several putative binding sites for liver-specific or liver-enriched factors were present in the 5'-flank of CYP2C13 (Figure 3). A binding site for the liver-specific factor HNFl/LF-Bl/APF, which is known to play a critical role in expression of a number of liver-specific genes was located at -97 (Courtois et al., 1988; Frain et al., 1989; Baumhueter et al., 1990). A region having significant similarity with the albumin D site (seven out of eight identical residues) was found in the reverse orientation at -60. At this D site, at least three different liver-enriched transcription factors, DBP, LAP, and C/EBP are reported to be bound (Landschulz et al., 1988; Mueller et al., 1990; Descombes et al., 1990). An HNF3 binding site was located at -172. This factor is required for maximal expression of several liverspecific genes (Costa et al., 1989; Lai et al., 1990). A binding site for the liver-enriched transcription factor HNF4/AF- 1 (Leff et al., 1989; Costa et al., 1989; Sladek et al., 1990) was located at -1 21. Interestingly, all of the cytochrome P450 genes of the IIC subfamily thus far characterized, the rabbit 2C1,2C2,2C3, and 2C4 and the rat 2C7,2C 1 1, and 2C12 possess putative binding sites for HNF4/AF-l (Chan & Kemper, 1990; Zhao et al., 1990; Westin et al., 1990; Morishima et al., 1987; Zaphiropoulos et al., 1990b). Moreover, a binding site for the hepatocyte-specific factor eH-TF/TGT3 (Zaret et al., 1990; Shaul et al., 1987; Ben-Levy et al., 1989) which appears to be involved in many cases of liver-specific gene expression was found at -73. In addition to these liver-specificand liver-enriched factors, putative binding sites for ubiquitous transcription factors were also observed in the 5'-flank of CYP2C13. A sequence with seven out of eight identical residues with that of the octamer binding protein OTF-I (Sturm et al., 1988) was present at -66 and overlapped the D site. A minimal recognition sequence for the CAAT box binding protein CTF/NF-I, the AGCCAA motif (Jones et al., 1987), was found in the reverse orientation at -8 1, adjacent to the eH-TF/TGT3 site. A sequence motif with dyad symmetry was observed at -280. In addition, the half-site of this motif shows similarity to the NF-I binding site. Another CAAT box binding site, the one for factor NF-Y, was present at -231 (Raymondjean et al., 1988). Interestingly, none of these transcription factor binding sites were affected by the five nucleotide substitutions present within the 287 bp of the 5'-flanks of the (+g) and the (-g) genes.

accuracy of the gene sequence. On the other hand, five nucleotide substitutions between the 5'-flanking regions of the (+g) and the (-8) CYP2C13 gene were identified (Figure 3). Absence of Allele-Specific Transcription Initiation Sites. Since nucleotide substitutions have been observed in the 5'flanking region of CYP2CI 3, we investigated whether these nucleotide changes could result in different transcription initiation sites between the (+g) and the (-g) P450 genes. Primer-extension experiments were performed with poly(A)+ RNA prepared from type 1 (+g) and type 2 (-g) rats (Figure 4). I t appeared that in both type 1 and type 2 rats, transcription starts at a G residue located 21 bp upstream of the translation initiation codon. 5'- Flanking Region-Putative Binding Sites for Known Transcription Factors. It is known that sequences within 100-300 bp from the transcription initiation site of many liver-specific genes (e.g., albumin, a 1 -antitrypsin, a-fetoprotein) are generally sufficient for liver-specific expression. Therefore, we searched for binding sites for known transcription factors within the corresponding region of the CY P2C 13 gene. The CY P2C 13 promoter region contained

DISCUSSION The complete gene for cytochrome P4501ICI3, with the exception of a portion of introns 5 and 8, has been cloned. The gene spans more than 50 kb and is composed of nine exons. Both the size and the number of exons are similar to the ones reported for other genes of the P450IIC subfamily (Morishima et al., 1987; Zaphiropoulos et al., 1990b; Chan & Kemper, 1990). All of the exon/intron boundaries were well conserved relative to other P45011C subfamily members and always subject to the GT-AG rule. Introns 5 and 8 may be enormously large, or difficult to clone, since numerous attempts to isolate the missing sequences were unsuccessful. The same difficulty was encountered in cloning intron 5 of CY P2C 12, the gene coding for the P450 with the highest structure similarity to P450IIC13 (Zaphiropoulos et al., 1990b). The CYP2C 13 gene shows a polymorphism which corresponds to the two types of P450IIC13 mRNAs. Genomic Southern and Northern blot analysis of 17 individual rats confirmed that the two types of the CYP2C13 gene are alleles, which is in accordance with former observations (Rampersaud et al., 1987; Yeowell et ai., 1990). Three different genotypes,

++k ,d$+P

4-

Eguchi et al.

10848 Biochemistry, Vol. 30, No. 45, 1991 homozygous (+g,+g and -g,-g) and heterozygous (+g,-g), correspond to the observed three different phenotypes, high, low, and intermediate P450IIC13 protein levels. The restriction fragment length polymorphism identified within intron 5 of the CYP2C13 gene now allows a simple determination of the rat genotype which correlates to the phenotypic differences of P450IIC13 expression. The sequence determined from the (+g) and the (-g) genes is in agreement with that of the cDNAs except for two nucleotide differences found between the 5’-untranslated region of the P45011C13(+g) cDNA as reported by McClellan-Green et al. (1989a) and the gene sequence. Apart from sequencing errors (and we believe that the gene sequence is accurate since it was determined from a number of independent clones), this could result from either nucleotide misincorporations during the reverse transcriptase reaction or cloning artifacts commonly occuring in the 5’-end of cDNAs. In addition to the nine nucleotide differences within the coding regions of the (+g) and the (-8) genes, several additional differences were observed in the intron regions (Table I) and five were observed within the portion of the 5’-flank that was sequenced. The transcription initiation site as determined by primer extension was identical for both the (+g) and the (-g) genes and was located 21 bp upstream of the translation initiation codon. The transcription start of the male-specific CYP2Cll and the major start site of the female-specific CYP2Cl2 were also localized at a similar position relative to the translation initiation codon. Furthermore, the transcription initiation nucleotide was always a G in these three members of the rat cytochrome P4501IC subfamily (Morishima et al., 1987; Zaphiropoulos et al., 1990b). The CYP2C 13 gene has a canonical TATA box at -3 1. A number of putative binding sites for liver-enriched or liverspecific transcription factors including HNFl /LF-Bl /APF, HNF/3, HNF4/AF-l, and eH-TF/TGT3 as well as a D site were identified within 287 bp of the 5’-flank of the CYP2C13 gene. Furthermore, putative binding sites for the ubiquitous transcription factors OTF-1 and NF-1 were also found in the CYP2Cl3 promoter region. Many liver-specific genes (e.g., albumin, a-fetoprotein, cul-antitrypsin) contain in their promoter regions binding sites for both liver-specific and ubiquitous factors organized in various combinations, which in some cases synergistically interact with each other, resulting in maximal transcriptional activity. The same is likely to be true for the CYP2C13 gene, where binding sites for a number of transcription factors, which in some cases overlap each other, do exist. Functional assays will be required to determine whether these or additional factors regulate the liver-specific and postpubertal expression of the CYP2C13 gene in male rats and ultimately to determine its responsiveness to GH. Anyhow, the binding sites for these characterized transcription factors were not affected by the five nucleotide substitutions observed between the (+g) and the (-8) gene, a fact that might relate to the identical amounts of P450IIC13 mRNA present in rats of the three different phenotypes, high (+g,+g), low (-g,-g), and intermediate (+g,-g). CYP2C6 (P450PB-1), CYP2C7 (P450f), CYP2C11 (P45016a), CYP2C12 (P45015/3), and CYP2C13 (P450g) are the known rat genes of the P450IIC subfamily (Gonzalez, 1988). Two of these genes (CYP2CI 1 and CYP2C13) are tightly linked and might be present on chromosome 7 (Rampersaud & Walz, 1987b). All of the cytochrome P450 subfamily genes reported thus far form a cluster on the same chromosome. For example, the mouse cytochrome P450IIC genes are located in tandem on chromosome 19 (Meehan et

al., 1988). Such a gene organization could result from gene duplications and gene conversions. The unit evolutionary period (UEP) of cytochrome P450s has been estimated between 2.1 and 4.1 (Song et al., 1986), therefore the genes coding for the two most similar rat P45Os of the IIC subfamily, P450IIC12 and P450IIC13 (79% amino acid identity), evolved from a common ancestor about 40-80 millions years ago. Since the speciation of rodents and humans occurred about 80 millions years ago (Wilson et al., 1977), it is likely that CYP2C 12 and CYP2C 13 might represent genes for rodentspecific cytochrome P 450s. In summary, this work, in addition to characterizing an extremely large cytochrome P450 gene, provides a direct correlation between the presence of the (+g) or the (-8) genes and the expression of the corresponding mRNAs and therefore establishes a case of an allelic polymorphism in the cytochrome P450 gene superfamily that is substantiated by the knowledge of the corresponding gene structure. Registry No. P450, 9035-51-2.

REFERENCES Bandiera, S., Ryan, D. E., Levin, W., & Thomas, P. E. (1986) Arch. Biochem. Biophys. 248, 658-676. Baumhueter, S . , Mendel, D. B., Conley, P. B., Kuo, C. J., Turk, C., Graves, M. K., Edwards, C. A., Courtois, G., & Crabtree, G. R. (1990) Genes Deu. 4, 372-379. Ben-Levy, R., Faktor, O., Berger, I., & Shaul, Y. (1989) Mol. Cell. Biol. 9, 1804-1809. Chan, G., & Kemper, B. (1990) Biochemistry 29,3743-3750. Chomczynski, P., & Sacchi, N. (1987) Anal. Biochem. 162, 156-159. Costa, R. H., Grayson, D. R., & Damell, J. E., Jr. (1989) Mol. Cell. Biol. 9, 1415-1425. Courtois, G., Baumhueter, S., & Crabtree, G. R. (1988) Proc. Natl. Acad. Sci. U.S.A. 85, 7937-7941. Descombes, P., Chojkier, M., Lichtsteiner, S., Falvey, E., & Schibler, U. (1990) Genes Deu. 4, 1541-1551. Frain, M., Swart, G., Monaci, P., Nicosia, A., Stampfli, S., Frank, R., & Cortese, R. (1989) Cell 59, 145-157. Gonzalez, F. J. (1988) Pharmacol. Rev. 40, 243-288. Jones, K. A., Kadonaga, J. T., Rosenfeld, P. J., Kelly, T. J., & Tjian, R. (1987) Cell. 48, 79-89. Lai, E., Prezioso, V. R., Smith, E., Litvin, O., Costa, R. H., & Darnell, J. E., Jr. (1990) Genes Deu. 4 , 1427-1436. Landschulz, W. H., Johnson, P. F., Adashi, E. Y., Graves, B. J., & McKnight, S . L. (1988) Genes Deu. 2, 786-800. Leff, T., Reue, K., Melian, A,, Culver, A,, & Breslow, J. L. (1989) J . Biol. Chem. 264, 16132-16137. McClellan-Green, P., Waxman, D. J., Caveness, M., & Goldstein, J. A. (1987) Arch. Biochem. Biophys. 253, 13-25. McClellan-Green, P. D., Negishi, M., & Goldstein, J. A. (1989a) Biochemistry 28, 5832-5839. McClellan-Green, P. D., Linko, P., Yeowell, H. N., & Goldstein, J. A. (1989b) J . Biol. Chem. 264, 18960-18965. Meehan, R. R., Speed, R. M., Gosden, J. R., Rout, D., Hutton, J. J., Taylor, B. A,, Hilkens, J., Kroezen, V., Hilgers, J., Adesnik, M., Friedberg, T., Hastie, N. D., & Wolf, C. R. (1988) Proc. Natl. Acad. Sci. U.S.A.85, 2662-2666. Morishima, N., Yoshioka, H., Higashi, Y., Sogawa, K., & Fujii-Kuriyama, Y. (1987) Biochemistry 26, 8279-8285. Mueller, C. R., Marie, P., & Schibler, U. (1990) Cell 61, 279-291. Rampersaud, A., & Walz, F. G., Jr. (1987a) Biochem. Genet. 25, 527-534.

Biochemistry 1991, 30. 10849-10858

Rampersaud, A., & Walz, F. G., Jr. (1987b) J . Biol. Chem. 262, 5649-5653. Rampersaud, A,, Bandiera, S . , Ryan, D. E., Levin, W., Thomas, P. E., & Walz, F. G., Jr. (1987) Arch. Biochem. Biophys. 252, 145-1 5 1. Raymondjean, M., Cereghini, S . , & Yaniv, M. (1988) Proc. Natl. Acad. Sci. U.S.A. 85, 757-761. Ryan, D. E., Iida, S . , Wood, A. W., Thomas, P. E., Lieber, C. S., & Levin, W. (1984) J . Biol. Chem. 259, 1239-1250. Sambrook, J., Fritsch, E. F., & Maniatis, T. (1989) in Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. Shaul, Y . , & Ben-Levy, R. (1987) E M B O J . 6 , 1913-1920. Sladek, F. M., Zhong, W., Lai, E., & Darnell, J. E., Jr. (1990) Genes Dev. 4, 2535-2365. Song, B.-J., Gelboin, H. V., Park, S.-S., Yang, C. S . , & Gonzalez, F. J. (1986) J . Biol. Chem. 261, 16689-16697. Sturm, R. A., Das, G., & Herr, W. (1988) Genes Dev. 2, 1764-1778. Van het Schip, F. D., Samallo, J., Broos, J., Ophuis, J., Mojet,

10849

M., Gruber, M., & Ab, G. (1987) J . Mol. Biol. 196, 245-260. Westin, S., Strom, A., Gustafsson, J.-A., & Zaphiropoulos, P. G. (1990) Mol. Pharmacol. 38, 192-197. Wilson, A. C., Carlson, S . S . , & White, T. J. (1977) Annu. Rev. Biochem. 46, 573-639. Yeowell, H. N., McClellan-Green, P. D., Negishi, M., & Goldstein, J. A. (1990) Biochemistry 29, 7 13-7 18. Zaphiropoulos, P. G., Mode, A., Strom, A., Moller, C., Fernandez, C., & Gustafsson, J.-A. (1988) Proc. Natl. Acad. Sci. U.S.A. 85, 4214-4217. Zaphiropoulos, P. G., Strom, A., Robertson, J. A., & Gustafsson, J.-A. (1990a) Mol. Endocrinol. 4 , 53-58. Zaphiropoulos, P. G., Westin, S.,Strom, A., Mode, A., & Gustafsson, J.-A. (1990b) DNA Cell Biol. 9 , 49-56. Zaret, K. S . , Liu, J.-K., & DiPersio, M. (1990) Proc. Natl. Acad. Sci. U.S.A. 87, 5469-5473. Zhao, J., Chan, G., Govind, S., Bell, P., & Kemper, B. (1990) DNA Cell Biol. 9. 37-48.

Energetics of 3-Oxo-A5-steroidIsomerase: Source of the Catalytic Power of the Enzyme+ David C. Hawkinson, Teresa C. M. Eames, and Ralph M. Pollack* Laboratory for Chemical Dynamics, Department of Chemistry and Biochemistry, University of Maryland Baltimore County, Baltimore, Maryland 21 228-5398, and Centerfor Advanced Research in Biotechnology, 9600 Gudelsky Drive, Rockville, Maryland 20850 Received June 25, 1991; Revised Manuscript Received August 23, 1991

(2) by steroid isomerase (KSI) (Hawkinson et al. 1991), in conjunction with various steady-state kinetic parameters, allows elucidation of the detailed free energy profile for the KSI-catalyzed conversion of 5-androstene-3,l'I-dione(1) to 4-androstene-3,17-dione (3). This free energy profile shows four kinetically significant energy barriers (substrate binding, the two chemical steps, and dissociation of product) that must be traversed upon conversion of 1 to 3. Thus, no single step of the catalytic cycle is cleanly rate-limiting. The source of the catalytic power of KSI is discussed via comparison of the free energy profile for the KSI-catalyzed isomerization with those for the acetate-catalyzed isomerization and the aqueous reaction at p H 7. Similarities between the energetics of the KSI-catalyzed and triosephosphate isomerase catalyzed reactions are also noted. ABSTRACT: Knowledge of the partitioning of the putative dienol intermediate

A

detailed understanding of the mechanism of action of an enzyme requires a knowledge of the rate and equilibrium constants for the interconversion of all of the bound species on the enzyme surface. In favorable cases, the resulting free energy profile can then be compared with the corresponding free energy profiles for the uncatalyzed reaction and for appropriate model systems to quantitatively assess the enzyme's catalytic ability. Complete (or nearly complete) free energy profiles have been determined for reactions catalyzed by wild-type and mutant triosephosphate isomerases (Albery & Knowles, 1976a; Nickbarg & Knowles, 1988; Raines et al., 1986), Escherichia coli F,-ATPase (AI-Shawi & Senior, 1988), EPSP synthase (Anderson et al., 1988a,b), dihydrofolate reductase (Fierke et al., 1987; Andrews et al., 1989), 'This work was supported by Grant GM 38155 from the National Institute of Gcneral Medical Sciences. U S . Public Health Service. *Address correspondence to this author at the University of Maryland Baltimorc County.

DNA polymerase I (Kuchta et al., 1987), various 0-lactamases (Christensen et al., 1990), and the ATPases of dynein (Johnson, 1985; Holzbaur & Johnson, 1989) and myosin (Johnson, 1985). However, the only system for which the free energy profiles for both the enzymatic and nonenzymatic reactions could be obtained is triosephosphate isomerase (Hall & Knowles, 1975; Richard, 1984). We report here the free energy profile for the isomerization of 5-androstene-3,17-dione (1) to 4-androstene-3,17-dione (3) catalyzed by the enzyme 3-oxo-As-steroid isomerase (steroid A-isomerase; EC 5.3.3.1) of Pseudomonas testosteroni, along with a comparison with the free energy profiles for the corresponding nonenzymatic reactions catalyzed by hydroxide ion at pH 7 (Pollack et al., 1989b) and acetate ion (Zeng & Pollack, 1991). This enzyme (KSI;I also called As-3-ketoAbbreviations: KSI, 3-oxo-A5-steroid isomerase; TIM, triosephosphate isomerase; EDAC, N-ethyl-N'-[3-(dimethylamino)propyl]carbodiimide; EM, effective molarity.

0006-2960/91/0430-10849$02.50/00 1991 American Chemical Society