G Model
ARTICLE IN PRESS
CIMID-1004; No. of Pages 9
Comparative Immunology, Microbiology and Infectious Diseases xxx (2015) xxx–xxx
Contents lists available at ScienceDirect
Comparative Immunology, Microbiology and Infectious Diseases journal homepage: www.elsevier.com/locate/cimid
Gene expression in Listeria monocytogenes exposed to sublethal concentration of benzalkonium chloride Manuela Tamburro a , Giancarlo Ripabelli a,∗ , Monia Vitullo a , Timothy James Dallman b , Mirella Pontello c , Corinne Francoise Laurence Amar b , Michela Lucia Sammarco a a b c
Department of Medicine and Health Sciences, University of Molise, Campobasso, Italy Gastrointestinal Bacteria Reference Unit, Public Health England, London, UK Department of Health Sciences, University of Milan, Milan, Italy
a r t i c l e
i n f o
Article history: Received 18 November 2014 Received in revised form 11 February 2015 Accepted 26 March 2015 Keywords: Listeria monocytogenes Benzalkonium chloride Gene expression Efflux systems Cross-response
a b s t r a c t In this study, tolerance at sublethal concentration of benzalkonium chloride and transcription levels of mdrL, ladR, lde, sigB and bcrABC genes in Listeria monocytogenes strains were evaluated. Viable cells reduction occurred in 45% of strains and clinical isolates showed lower sensitivity than isolates from foods. An increased transcription of an efflux system encoding gene was found in 60% of strains, and simultaneous mdrL overexpression and ladR underexpression occurred in 30% of isolates. A significant association between reduced benzalkonium chloride activity and both mdrL and sigB overexpression was observed; sigB expression also correlated with both mdrL and ladR genes. The bcrABC gene was only found in six strains, all isolated from foods and sensitive to benzalkonium chloride, and in four strains an underexpression was observed. Disinfection at sublethal concentration was less effective in clinical isolates, and mdrL and sigB expression was significantly affected by disinfection. Further insights are needed to understand the adaptation to benzalkonium chloride and to evaluate whether changes in gene expression could affect the L. monocytogenes virulence traits and persistence in the environment. © 2015 Elsevier Ltd. All rights reserved.
1. Introduction Listeria monocytogenes is an opportunistic intracellular pathogen responsible of serious infections, usually by ingestion of contaminated foods [1]. The majority of
∗ Corresponding author at: Department of Medicine and Health Sciences, University of Molise, Via De Sanctis, 86100 Campobasso, Italy. Tel.: +39 0874 404961; fax: +39 0874 404778. E-mail addresses: [email protected] (M. Tamburro), [email protected] (G. Ripabelli), [email protected] (M. Vitullo), [email protected] (T.J. Dallman), [email protected] (M. Pontello), [email protected] (C.F.L. Amar), [email protected] (M.L. Sammarco).
human cases are caused by three (4b, 1/2a, and 1/2b) out of 13 known serovars [2]. Clinical signs can vary from selflimiting gastroenteritis among healthy people to invasive infections with high fatality rates in vulnerable population groups (neonates, pregnant women, elderly, AIDS patients and individuals under immunosuppressive treatment) [3,4]. L. monocytogenes can survive under adverse environmental conditions and during human gastrointestinal passage [5]. Infection of ventriculoperitoneal shunt, prosthetic joints and heart valves [6,7] further confirmed L. monocytogenes ability to form and survive within biofilms on indwelling medical devices. This food-borne pathogen is also a common contaminant of food processing plants where it may persist over extended periods of time [8], and
http://dx.doi.org/10.1016/j.cimid.2015.03.004 0147-9571/© 2015 Elsevier Ltd. All rights reserved.
Please cite this article in press as: Tamburro M, et al. Gene expression in Listeria monocytogenes exposed to sublethal concentration of benzalkonium chloride. Comp Immunol Microbiol Infect Dis (2015), http://dx.doi.org/10.1016/j.cimid.2015.03.004
G Model CIMID-1004; No. of Pages 9
2
ARTICLE IN PRESS
M. Tamburro et al. / Comparative Immunology, Microbiology and Infectious Diseases xxx (2015) xxx–xxx
the application of biocides such as quaternary ammonium compounds (QACs) represents a useful approach for the control of L. monocytogenes in the processing environment. Hence, widespread distribution, natural resistance to stress conditions, and biofilm formation are of serious concerns for food industry [3,9] and healthcare settings, particularly if routine cleaning and disinfection procedures are not properly performed [10,11]. Moreover, an increased resistance to antimicrobials by Gram-positive and negative pathogens has been described [1,12], due to selective pressure for the extensive use of disinfecting agents and antibiotics. Benzalkonium chloride (BAC), belonging to QACs, is widely used for surfaces sanitization or as antiseptic, and it is responsible for the dissociation of cell membrane lipid bilayers by altering cellular permeability and inducing leakage of cellular contents [13]. The bactericidal activity begins when a critical minimum concentration is surpassed below which such activity is too slow or absent; thus, the effective concentration of QAC compounds could not be lower than certain thresholds, even if time application is significantly extended. In industry, concentrations of about 1000 ppm are commonly used when applying QACs to machinery for disinfection [14]. Although high concentration of QACs ensures complete eradication of any pathogenic bacteria from the surface of industrial equipment, L. monocytogenes has been shown to survive and adapt when exposed to sublethal concentrations of these disinfectants [15]. Hence, BAC adaptation in L. monocytogenes strains is a significant public health emerging issue for the selection and persistence of resistant mutants [16]. The mechanisms involved in the intrinsic or acquired QACs resistance are not completely elucidated; however, previous studies provided evidences for both chromosomal determinants and plasmid-mediated BAC resistance. A putative BAC resistance cassette, known as bcrABC, was previously identified on a large plasmid (pLM80) of L. monocytogenes H7550 strain involved in the 1998–1999 United States listeriosis outbreak [17], as well as in other Listeria sequenced genomes. BAC-associated resistance cassette is composed by TetR family transcriptional regulator (bcrA) and two SMR (small multidrug resistance) genes (bcrB and bcrC), all essential for imparting BAC resistance. Dutta et al. [18] reported that transcription of bcrABC in L. monocytogenes strains is induced by BAC sublethal concentration (10 g/ml), and the analysis has shown that the majority of BAC-resistant strains had either the pLM80type of organization of bcrABC region or appeared to harbor bcrABC on the chromosome, adjacent to novel sequences. Furthermore, Tn6188, an integrated chromosomally transposon, has been described to provide an increased tolerance of L. monocytogenes strains to BAC [19]. Tn6188 consists of three transposase genes (tnpABC), genes encoding a putative transcriptional regulator and QacH, a small multidrug resistance protein family (SMR) transporter associated with export of BAC. The induction of multidrug resistance efflux pump (MdrL) after BAC exposure has also been reported [20], and a putative protein, encoded by orfA gene, renamed as ladR [21], is considered as the mdrL transcriptional repressor
[22]. The Listeria drug efflux transporter, encoded by lde chromosomal gene, belongs to the major facilitator superfamily of secondary transporters, and is involved in the excretion of toxic compounds from bacterial cells, including some antibiotics. Moreover, several studies confirmed the role of the alternative sigma factor B (B ), encoded by sigB gene, in the response to environmental stress conditions (i.e., low pH, high bile and ethanol exposure, osmotic stress, etc.), and in BAC and peracetic acid resistance [23,24]. The induction of B -dependent genes under environmental stress conditions may support the hypothesis that resistant isolates should be more pathogenic, with higher resistance to antimicrobials. The aim of this study was to evaluate the antimicrobial activity of BAC, defined as the reduction of viable plate counts, at sublethal concentration, in L. monocytogenes isolated from foods and clinical cases in Italy, in order to evaluate the tolerance phenotype of the strains according to the isolation source. Changes in the relative expression of efflux systems encoding genes (mdrL and lde) and their regulators (ladR and sigB), as well as of bcrABC cassette, in the same isolates upon exposure to BAC sublethal concentration, were also assessed in order to evaluate the extent of the disinfecting treatment on the transcription, and the interaction in the tolerance development.
2. Materials and methods 2.1. Bacterial strains and bio-molecular subtyping Twenty L. monocytogenes strains from the Laboratory of Hygiene culture collection (University of Molise) and isolated by the Lombardia Regional Surveillance Network (North-Italy) were analyzed. The isolates were collected from both clinical cases (n = 10) and foods (n = 10) (Table 1). The serotypes were assigned by slide agglutination [25] and multiplex-PCR, developed by Doumith et al. [26], with some modifications [27]. The genomic division or lineage was identified, by PCR, according to Ward et al. [28] and some modifications [27]. Molecular subtyping of L. monocytogenes strains was performed by pulsed-field gel electrophoresis (PFGE), according to PulseNet USA protocol [29]. Briefly, the strains were grown overnight on Brain Heart Infusion (BHI; Biolife, Milan, Italy) agar, and cell suspension with optical density (OD620 ) of 1.6–1.8 in Tris-EDTA (TE, pH 8.0) buffer was prepared. Cells were lysed with lysozyme at 37 ◦ C for 10 min, and embedded in 1.2% Seakem® Gold agarose (Lonza, Milan, Italy). The cell plugs were washed and digested with both AscI (10 U/l) and ApaI (50 U/l) at 37 ◦ C for 4 h. Electrophoresis was carried out in 1% agarose gel (Seakem® Gold Agarose) with 0.5× Tris-borate-EDTA buffer in CHEFDR II instrument (Bio-Rad, Milan, Italy) at 6 V/cm for 21 h at switch time of 4–40 s. Gel was stained with ethidium bromide solution, and visualized by UV transilluminator Fire-Reader (UVITEC Cambridge, Eppendorf, Milan, Italy). PFGE profiles were analyzed by using BioNumerics software (Applied Maths, Kortrijk, Belgium) version 6.0. Dendrograms were generated by the unweighted pair group method algorithm (UPGMA) [30] including all the
Please cite this article in press as: Tamburro M, et al. Gene expression in Listeria monocytogenes exposed to sublethal concentration of benzalkonium chloride. Comp Immunol Microbiol Infect Dis (2015), http://dx.doi.org/10.1016/j.cimid.2015.03.004
G Model
ARTICLE IN PRESS
CIMID-1004; No. of Pages 9
M. Tamburro et al. / Comparative Immunology, Microbiology and Infectious Diseases xxx (2015) xxx–xxx
3
Table 1 Characteristics, molecular subtyping and logarithmic viable plate counts reduction (log R) of L. monocytogenes strains. Code
Source
Patients data
Strains analysis
Gender
Age
Risk factors
Serotype
Lineage
Pulsotype ApaI
Pulsotype AscI
Log R
PCR bcrABC
Hyperpyrexia in labor None Congenital immune deficiency
4b
I
8
VIII
4.3
−
1/2a 4b
II I
3 7
XI IX
NR NR
− −
1/2a 1/2a 4b 1/2a 4b 1/2a
II II I II I II
3 4 6 3 6 2
III VI XII VII V II
NR 4.8 NR 5.1 NR NR
− − − − − −
1/2a 1/2b 1/2c 1/2c 1/2b 1/2c 3a 1/2a 1/2a 1/2a 1/2a
II I II II I II II II II II II
4 5 2 2 5 2 1 1 1 1 1
VI X III IV X I XIII XIII XIII XIII XIII
5.2 NG 5.6 NR NR NG NG 4.9 6.5 5.9 6.2
− − − − − + + + + + +
H05
BC
F
45
H21 H41
BC CSF
M F
41 28
H45 H111 H133 H141 H150 H153
CSF BC BC Placenta Rectal swab at birth
F M F F M
76 64 74 36 0
H159 F5 F7 F36 F44 F46 F78 F86 F115 F116 F127
BC Ground sausage Ground sausage Salami Salami Salami Gorgonzola cheese Gorgonzola cheese Taleggio cheese Taleggio cheese Taleggio cheese
F n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a.
68 n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a.
Immunosuppression Neoplasia None None Consumption of contaminated food Renal failure n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a.
H, clinical strains; F, food isolates; BC, blood culture; CSF, cerebrospinal fluid; F, female; M, male; n.a., not applicable; NR, no reduction; NG, no growth.
strains, and Simpson’s index [31] for both enzymes was calculated. 2.2. Antimicrobial activity of benzalkonium chloride The BAC (Sigma Aldrich, Milan, Italy) activity was assessed according to UNI EN ISO 1276/2009 protocol by using the membrane filtration method, and counting colonies grown on plates [32]. All the assays were performed with 0.3% (w/v) bovine serum albumin (BSA; Sigma–Aldrich) at 5 min contact time, choosing 10 ppm as sublethal concentration based on our previous results (data not shown), and according to previous observations [17]. L. monocytogenes isolates were cultured on selective Listeria ACC. to Ottaviani & Agosti (ALOA; Biolife) agar at 37 ◦ C overnight. Bacterial suspensions were prepared with pure grown colony into 1 ml saline solution (0.90%, w/v) in order to reach 0.1 optical density (OD600 ), and by adding BSA (1 ml) and BAC solution (8 ml) for treated sample [32]. In parallel, an untreated control sample was prepared by adding BSA and sterile water to bacterial suspension at same proportions. After 5 min contact time at 20 ± 1 ◦ C [32], 100 l of the solution were transferred into filtration system, and bacterial cells were retained on Whatman filter paper (0.45 m, ALBET Lab-science, Barcelona, Spain) surface. Each filter was placed onto a Trypticase Soy Agar (TSA, Biolife) plates, and incubated at 37 ◦ C for 48 h. This procedure was carried out in duplicate, and the mean number of grown colonies was calculated for both treated and untreated samples. Bactericidal activity was determined as the viable cells reduction (R), calculated as the ratio of [(Ni × 10−1 )/Nf ], where Ni are the unit forming colonies (UFC)/ml in the initial bacterial suspension
without disinfectant, Nf the UFC/ml in the suspension with benzalkonium chloride, and 10−1 is dilution factor. The disinfecting treatment was considered effective when the viable cells reduction upon contact was at least or higher than 5 logarithmic cycles (log R ≥ 5), according to the reference standard cut-off for the assay [32]. 2.3. PCR screening for bcrABC resistance cassette A positive control strain harboring bcrABC gene cassette was in silico demonstrated by analyzing the genome sequences of 87 L. monocytogenes strains from Food Safety Microbiology Laboratory (Public Health England, Colindale, London, UK). All the sequences were aligned against L. monocytogenes J2446 (GenBank accession number JX023277.1; http://www.ncbi.nlm.nih.gov/ genbank/) cassette sequence gene using BWASW (Burrows–Wheeler short reads of Aligner, Smith–Waterman) alignment [33,34]. Spades version 2.5.1 [35] was used to produce de novo assemblies to confirm whether the bcr cassette could be assembled. PCR assay for bcrABC detection in the selected strains (Table 1) was developed and performed including a positive control strain, using forward and reverse primers ex novo designed by using Primer3 software [36] (Table 2) based on L. monocytogenes J2446 bcrABC sequence, amplifying a 197 bp product. DNA extraction was performed in the automated Maxwell® 16 Instrument (Promega, Milan, Italy) using Maxwell® 16 Cell DNA Purification Kit (Promega), according to manufacturers’ instructions. PCRs were performed at 25 l final volume containing 2 l of DNA template, 12.5 l of Master Mix 2× (Promega) and 1.5 mol l−1 of each primer. Samples were amplified as follows: 95 ◦ C for 3 min, followed by 35 cycles of 95 ◦ C for
Please cite this article in press as: Tamburro M, et al. Gene expression in Listeria monocytogenes exposed to sublethal concentration of benzalkonium chloride. Comp Immunol Microbiol Infect Dis (2015), http://dx.doi.org/10.1016/j.cimid.2015.03.004
G Model CIMID-1004; No. of Pages 9
ARTICLE IN PRESS
M. Tamburro et al. / Comparative Immunology, Microbiology and Infectious Diseases xxx (2015) xxx–xxx
4
Table 2 Primers used in qRT-PCR assays.
following the manufacturer’s instructions. A reaction without the enzyme was carried out for each RNA sample in order to obtain the no-reverse transcription control (NoRT), necessary to check for residual DNA in the relative quantification assays.
Genes
Oligonucleotide sequences (5 –3 )
References
tufA
Fwd: GCTGAAGCTGGCGACAACA Rev: CTTGACCACGTTGGATATCTTCAC
[38]
lde
Fwd: GGCACTATCAACGGCAGCGGT Rev: TGTGTCCGACAACGCTCCACC
This study
2.5. Relative gene expression
mdrL
Fwd: CCTCGGTACACTGCAACTCGGC Rev: CCGCCATCGCACCACCAATCA
This study
orfA
Fwd: TTTGCATAATTCGAAGCCGGTTTGC Rev: TGATTGCTCGTGAAGCTTCTAGTGG
This study
bcrABC
Fwd: TGGACTCGCGCCTTAATACA Rev: TCGAGGGTAAGCCGAATTGT
This study
sigB
Fwd: AAAGAAACGGGTGAACTACTCGAT Rev: CAACGCCTCTCGAAGTTTTTTAA
[38]
Quantitative reverse-transcription PCR (qRT-PCR) was used to evaluate in L. monocytogenes strains (Table 1) the effects of BAC sublethal concentration on the relative expression of mdrL, ladR, lde, sigB and bcrABC genes, normalized to tufA housekeeping gene, according to Werbrouck et al. [37,38]. Oligonucleotides targeting mdrL, ladR, lde and bcrABC genes were ex novo designed (Table 2) using Primer3 software [36], based on L. monocytogenes EGD-e reference strain genome sequence (NCBI Reference Sequence: NC 003210.1; http://www.ncbi.nlm.nih.gov/genbank/) for the first three target genes and on L. monocytogenes J2446 (NCBI Reference Sequence: JX023277.1; http://www.ncbi. nlm.nih.gov/genbank/) for bcrABC gene. Primers specificity was in silico evaluated through the Basic Local Alignment Search Tool (BLAST; http://blast.ncbi.nlm. nih.gov/Blast.cgi). Oligonucleotides previously published [38] were used for tufA and sigB genes amplification. Each qRT-PCR assay was performed in 25 l reactions, containing 2 l of cDNA template in 1× SYBR® Premix Ex TaqTM (Takara, Diatech Labline, Milan, Italy), and 1× ROX Reference Dye II (Takara). Primers (Eurogentec, Biosense s.r.l., Milan, Italy) targeting tufA and sigB genes were used at 0.3 mol l−1 final concentration, whereas those targeting mdrL, ladR, and lde genes at 0.6 mol l−1 (Table 2). The assays were performed in Mastercycler® ep realplex 4S (Eppendorf, Milan, Italy) instrument, following 40 cycles protocol, consisting of denaturation at 95 ◦ C for 5 s and annealing/extension at 65 ◦ C for 30 s. Melting-curve analysis was performed in order to verify the specificity of amplified products. Negative controls (NTCs) to exclude any contamination, as well as positive controls to evaluate the assay reliability, were included in all reactions, which were performed in triplicate for each strain. Analysis of qRT-PCR data was carried out according to the comparative CT method [39], in order to calculate the relative expression of target genes after the exposure to BAC sublethal concentration, normalized to tufA housekeeping gene. Results were expressed as nFold (2−C T ); values >1 and 10. Amplification efficiency (ε = 10−1/slope − 1) was calculated for both housekeeping and target gene from the slope of the log-linear portion of the calibration curve [40] with five serial dilutions of L. monocytogenes EGD-e strain cDNA.
1 min, 50 ◦ C for 2 min, 72 ◦ C for 1 min, with final extension at 72 ◦ C for 5 min. Amplification products were resolved on 1% agarose gel (Eppendorf), and visualized on UV transilluminator Fire-Reader (UVITEC Cambridge, Eppendorf) after ethidium bromide staining. PCR products were also verified by PCR-restriction fragment length polymorphism (RFLP) by using HinfI (Promega) and TaqI (Promega). 2.4. RNA isolation and cDNA synthesis Bacterial colonies grown on ALOA (Biolife) agar were resuspended in BHI broth (Biolife) at 37 ◦ C to reach an OD600 of 0.8–0.9 corresponding to mid-late logarithmic growth phase. Bacterial culture (1 ml) was then harvested for total RNA isolation, according to Werbrouck et al. [37] protocol, with some modifications. Briefly, BAC solution (8 ml) and 0.3% BSA (1 ml) were added to cultures (1 ml). The mixture was incubated for 5 min, and centrifuged at 4000 rpm for 10 min. The supernatant (9.5 ml) was discarded, and RNA was stabilized by adding 1 ml of RNA Protect Bacteria reagent (Qiagen, Valencia, CA). The bacterial pellet was collected as recommended by manufacturer’s instructions. For each strain, an untreated control (calibrator) was obtained following the same protocol but replacing the disinfectant solution with sterile Milli-Q water. Total RNA was extracted from each pellet after thawing using RNeasy mini kit (Qiagen), according to manufacturer’s instructions. Cell lysis was achieved by adding 100 l solution containing 5 mg/ml of lysozyme (Promega) to each pellet and 13 mg/ml of proteinase K (Promega) in TE buffer, incubating at 37 ◦ C for 30 min. DNase treatment was performed during RNA purification with an on-column digestion by RNase-Free DNase set (Qiagen), according to the manufacturer’s protocol. RNA concentration, quality and purity were assessed by agarose gel electrophoresis, A260 /A280 (>1.8) ratio with NanoDrop2000 spectrophotometer (Thermo Scientific, Wilmington, USA), and by microfluidic analysis with ExperionTM RNA Standard Sense kit (Bio-Rad). Reverse transcription reaction from total RNA of both treated (10 ppm BAC) and untreated strains was in vitro performed by iScriptTM cDNA synthesis kit (Bio-Rad),
2.6. Statistical analysis Data analysis was performed by SPSS software v.17.0 (SPSS Inc., Chicago, IL, USA) using one-way analysis of
Please cite this article in press as: Tamburro M, et al. Gene expression in Listeria monocytogenes exposed to sublethal concentration of benzalkonium chloride. Comp Immunol Microbiol Infect Dis (2015), http://dx.doi.org/10.1016/j.cimid.2015.03.004
G Model
ARTICLE IN PRESS
CIMID-1004; No. of Pages 9
M. Tamburro et al. / Comparative Immunology, Microbiology and Infectious Diseases xxx (2015) xxx–xxx
92.9 85.2 100
83.1
64.9 91.7 89.3 95.7
58.2
96.3 80.7 68.7 82.4
52.6
83.9 77.8 69.3 60.1
92.9
F78 F86 F115 F116 F127 F7 H153 F36 F46 H21 H45 H141 H111 H159 F44 F5 H133 H150 H41 H05
100
95
90
85
80
75
70
65
60
55
50
100
95
85
80
90
AscI dendrograms 75
70
65
60
55
ApaI dendrograms
5
70 68.9
85.7 73.1
62.8
50.6 83.3 73.3 48.7
66.7 58.4 55.4
100 66.7
45.5
100 85
F46 H153 F7 H45 F36 H150 H111 H159 H141 H05 H41 F44 F5 H21 H133 F115 F116 F127 F86 F78
Fig. 1. PFGE dendrograms of 20 L. monocytogenes strains by using Dice coefficient and 1% band position tolerance. H, clinical strains; F, food strains.
variance (ANOVA) to test for significant differences in relative gene expression among BAC resistant and sensitive strains (log R < 5 and log R ≥ 5, respectively). p-Values 0.05). Among BAC-resistant strains isolated from food (F36, F44, and F86), a simultaneous overexpression of mdrL, lde and sigB was found, whereas in BAC-resistant clinical strains (n = 8), five isolates showed mdrL overexpression and four strains an increased expression of both lde and sigB genes.
Please cite this article in press as: Tamburro M, et al. Gene expression in Listeria monocytogenes exposed to sublethal concentration of benzalkonium chloride. Comp Immunol Microbiol Infect Dis (2015), http://dx.doi.org/10.1016/j.cimid.2015.03.004
G Model
ARTICLE IN PRESS
CIMID-1004; No. of Pages 9
M. Tamburro et al. / Comparative Immunology, Microbiology and Infectious Diseases xxx (2015) xxx–xxx
A
10
Log 10 nFold mdrL
F116*
F127*
F86
F115*
F78*
F44
F46*
F7*
F36
F5*
H153
H159*
H150
H141*
H111
H133
H45
H41
0,1
H21
1
H05
6
100
B
10 1
F127*
F116*
F115*
F86
F78*
F46*
F44
F36
F7*
F5*
H159*
H153
H150
H141*
H133
H111
H45
H41
H21
0,1
H05
Log10 nFold lde
Strains
Strains
C
F127*
F116*
F115*
F86
F78*
F44
F46*
F36
F7*
F5*
H159*
H153
H150
H141*
H133
H111
H45
H21
H41
1
HO5
Log10nFold ladR
10
0,1
10
D
F127*
F116*
F115*
F86
F78*
F46*
F44
F36
F7*
F5*
H159*
H153
H150
H141*
H133
H111
H45
H41
0,1
H21
1
H05
Log 10 nFold sigB
Strains
Strains
1
F127*
F116*
F115*
F86
F78*
0,1
F46*
Log10 nFold bcrABC
E
0,01 Strains
Fig. 2. Gene expression profiles (Log10 nFold) of mdrL (A), lde (B), ladR (C), sigB (D) and bcrABC (E) genes in L. monocytogenes strains isolated from clinical cases (H) and food (F). *BAC-sensitive strains; no expression level was detectable for F46 and F86 strains.
Please cite this article in press as: Tamburro M, et al. Gene expression in Listeria monocytogenes exposed to sublethal concentration of benzalkonium chloride. Comp Immunol Microbiol Infect Dis (2015), http://dx.doi.org/10.1016/j.cimid.2015.03.004
G Model CIMID-1004; No. of Pages 9
ARTICLE IN PRESS
M. Tamburro et al. / Comparative Immunology, Microbiology and Infectious Diseases xxx (2015) xxx–xxx
Overall, mdrL gene showed higher expression levels than other target genes (Fig. 2 A), with a median nFold of 1.09. A high variability within strains for lde and ladR (Fig. 2B and C) was found, with mean expression levels of 2.42 ± 3.08 (median 1.02), and 1.04 ± 0.53 (median 0.86), respectively. The higher mean overexpression levels were of 4.20 ± 3.59 for lde gene, followed by mdrL (1.66 ± 0.54), sigB (1.58 ± 0.54), and ladR (1.52 ± 0.54). The highest nFold values of mdrL, sigB, and ladR genes were 2.85, 2.69, and 2.51, respectively, while the maximum transcription levels were found for lde gene in F44 (11.31-fold), H41 (8.28-fold), and H133 (7.67-fold) strains (Fig. 2). The increased expression of at least one efflux system (MdrL and Lde) encoding genes was observed in 60% of strains, while the simultaneous increase only in 30% of isolates (Fig. 2A and B). Statistical analysis confirmed a significant correlation (p < 0.05) between reduced BAC activity and mdrL overexpression, while transcription levels of both lde and ladR genes were not associated to any effect of disinfectant. Among food isolates, overexpression of both mdrL and lde occurred only in BAC-resistant (log R < 5) strains. Conversely, within clinical isolates, the increased transcriptional levels were also observed in BAC-sensitive strains, and often associated with serotype 4b. The ladR gene was underexpressed in 60% of strains, including both clinical and food isolates (Fig. 2C); ladR overexpression and mdrL underexpression (or vice versa) were found in 30% of isolates, particularly in clinical strains. Changes in sigB gene expression after disinfectant treatment was significantly associated (p < 0.05) with BAC activity; in fact, increased transcription levels were observed in 45% (n = 9) of strains (Fig. 2 D) which resulted tolerant to BAC, and also 30% (n = 6) of BAC-sensitive isolates showed sigB underexpression. Particularly, sigB gene was 2.69, 2.43, and 1.74-fold more expressed in F36, F44, and F86 isolates from foods, which were all BAC-resistant (log R < 5). A strong correlation (p < 0.01) of sigB with mdrL (Pearson’s coefficient 0.665) and ladR (0.662) expression profiles was found, as well as between mdrL and ladR (0.549; p < 0.05). The analysis in silico for bcrABC detection within 87 sequenced genomes revealed that only five strains of 1/2b serotype harbored the intergenic cassette, with 100% sequence similarity each other and also from L. monocytogenes J2446 reference strain. Among the analyzed strains (Table 1), bcrABC cassette encoding gene was identified only in six (30%) out of twenty strains, all isolated from foods (F46, F78, F86, F115, F116, F127) and belonging to lineage II. Interestingly, bcr gene was detected in BAC-sensitive strains (log R > 5; Fisher’s exact p = 0.011). An underexpression of bcrABC gene was observed in four (F78, F115, F116, F127) out of six strains harboring the cassette gene (Fig. 2E). The decreased transcription levels were related to a simultaneous mdrL underexpression, and only for F115 and F116 an underexpression of both mdrL and lde genes was observed. However, no significant correlation was found between the expression levels of both efflux pumps encoding genes and bcrABC gene. In the two remaining strains (F46 and F86) containing bcrABC, gene expression was not detectable.
7
4. Discussion Our results showed that the increased tolerance to sublethal disinfection occurred in 45% of isolates, in agreement with previous studies, where BAC tolerance has shown between 10% [16] and 42–46% [41–43]. The reduction of viable cells upon disinfectant exposure was more common in food isolates, whereas BAC activity was less effective against clinical isolates, suggesting that such adaptation mechanisms and the development of tolerance phenotype could be involved in human listeriosis [44]. Previous studies also described a lower prevalence of BAC tolerance among 4b serotype, and a higher sensitivity in 1/2a and 1/2b strains [42,43]. However, because of the limited number of analyzed strains, no correlation between increased tolerance to disinfectant and serotypes was found. Changes in the relative expression of stressresponse and resistance-associated genes after sublethal disinfectant exposure were also evaluated. Our results showed a significant association between disinfectant exposure and mdrL overexpression, conversely no correlation with lde gene was found, in agreement with Romanova et al. [20], who reported that BAC adaptation among L. monocytogenes isolates could result in a significantly increased expression of mdrL gene. Among food isolates, the overexpression of both mdrL and lde genes occurred only in BAC-resistant strains, probably associated to an intrinsic resistance [20]. The efflux systems could play a critical role in cross-resistance to antimicrobial drugs. Particularly, MdrL is implicated in resistance to macrolides and cefotaxime [20], and previous studies reported that ciprofloxacin and BAC-resistant isolates produced derivatives more resistant also to gentamicin, ethidium bromide, and chemotherapeutic drug tetraphenylphosphonium [21,22,45]. Furthermore, the enhanced lde gene transcription in clinical fluoroquinolone-resistant isolates has been reported [46], as well as Lde activation in reducing ciprofloxacin activity toward L. monocytogenes. Studies on transcriptional analysis of both mdrL and ladR genes showed that ladR expression is abolished when mdrL transcription is activated [21]. Furthermore, Crimmins et al. [44] observed that mdrL gene was highly induced in ladR mutants, confirming the role of ladR as mdrL transcriptional repressor. However, our results could not support this hypothesis because ladR overexpression vs mdrL underexpression (or vice versa) occurred only in few isolates. The general stress response in many Gram-positive bacteria, including Listeria spp., is associated to B dependent genes expression. The role of the alternative sigma factor in BAC tolerance of both planktonic cells and biofilms has been previously reported [24], as well as in virulence mechanisms, such as tolerance to cell envelopeacting antimicrobials (i.e., nisin, ampicillin, penicillin G, and vancomycin) and survival in the human gastrointestinal tract [24]. In our study, the significant association between BAC exposure and B expression confirmed its essential function for the increase tolerance to stress factors [23]. The sigB overexpression mainly occurred in BAC-resistant
Please cite this article in press as: Tamburro M, et al. Gene expression in Listeria monocytogenes exposed to sublethal concentration of benzalkonium chloride. Comp Immunol Microbiol Infect Dis (2015), http://dx.doi.org/10.1016/j.cimid.2015.03.004
G Model CIMID-1004; No. of Pages 9
ARTICLE IN PRESS
M. Tamburro et al. / Comparative Immunology, Microbiology and Infectious Diseases xxx (2015) xxx–xxx
8
strains isolated from food, and with highest transcription levels of both MdrL and Lde efflux systems encoding genes. A significant correlation between mdrL and sigB, whose consensus binding sites are reported in mdrL gene [47], could indicate that sigma B is a necessary factor for coordination of bacterial adaptive responses to adverse environmental conditions. Hence, B induction after BAC sublethal concentrations exposure may activate non-specific extrusion mechanisms for toxic compounds from bacterial cells. As reported in previous studies, sigB activation after BAC exposure may also generate positive cross-responses to other stress factors, and the increased virulence in surviving cells, affecting food safety and representing a serious public health risk [11,48]. Recently, Casey et al. [15] have investigated the global response and adaption of L. monocytogenes 6179 persistent strain (serotype 1/2a) isolated from cheese processing environment on the exposure to sublethal concentrations of benzethonium chloride (BZT), a QAC industrial detergent. Gene expression levels were quantified, using transcriptome sequencing and RNA-Seq analysis, following growth of the strain in BZT presence (4 ppm) or absence (0 ppm). The analysis identified about 600 genes with 4-fold or greater change in the relative expression in BZT-treated sample compared to the control, and a differential regulation of 7.5-fold or greater factor over 141 genes. According to previous results [8] a widespread up-regulation in the expression of genes involved in peptidoglycan and teichoic acid biosynthesis and fatty acids metabolism were observed. In addition, Casey et al. [15] demonstrated a considerable up-regulation in genes involved in cell wall biosynthesis, chemotaxis and motility cascade. Many genes involved in maintenance of cell membrane fluidity and in carbohydrates uptake were also up-regulated. Moreover, when exposed to BZT, L. monocytogenes increased expression of genes encoding multi-drug resistance transporters and involved in stress response. Expression of genes encoding virulence factors, such as listeriolysin O and the internalins, remained relatively unchanged following the exposure to BZT. The exposure of L. monocytogenes to low level of disinfectants in the food processing environment would only occur as a result of improper cleaning practices, considering the high concentrations generally used and applied to equipment and surfaces. However, despite the effectiveness of disinfection ensuring lower risk of microbial contamination and pathogen elimination, several factors (such as organic debris, dosage failure, etc.) could inactivate the disinfection agents, leading to the exposure to sublethal concentration [49]; moreover, the L. monocytogenes ability to adapt to stress conditions and to produce biofilm enables it to withstand stresses imposed by disinfectants. 5. Conclusions Our study underlines and confirms that BAC sublethal concentration significantly affect L. monocytogenes gene expression, especially of mdrL and sigB, both contributing to an increased tolerance to disinfectant. In addition, the
study does not show any correlation between BAC resistance and strain serotype, and suggests that ladR might not repress mdrL expression. Sigma B, involved in the transcriptional response to several stressors, might also be responsible for mdrL activation in response to BAC. A greater number of strains and further experiments are needed to better evaluate how the potential increase of L. monocytogenes tolerance upon exposure at sublethal concentrations could affect the sensitivity to both disinfectants and antibiotics of clinical significance. Hence, an improved understanding of L. monocytogenes response to different stress factors is necessary to evaluate the extent of changes in virulence or other biological properties as a response to stress and resistance-associated gene expression, and how to control and reduce these events. Conflict of interest The authors do not have competing interest. Acknowledgements We acknowledge the helpful comments from Dr. Jim McLauchlin, Public Health England, London, UK, and the technical support of Dr. Incoronata Fanelli, University of Molise, Campobasso, Italy. References [1] Sammarco ML, Ripabelli G, Fanelli I, Grasso GM. Prevalence of Listeria spp. in dairy farm and evaluation of antibiotic-resistance of isolates. Ann Ig 2005;17(3):175–83. [2] Vitullo M, Grant KA, Sammarco ML, Tamburro M, Ripabelli G, Amar CF. Real-time PCRs assay for serogrouping Listeria monocytogenes and differentiation from other Listeria spp. Mol Cell Probes 2013;27(1):68–70. [3] Carpentier B, Cerf O. Persistence of Listeria monocytogenes in food industry equipment and premises. Int J Food Microbiol 2011;145(1):1–8. [4] Goulet V, Hebert M, Hedberg C, Laurent E, Vaillant V, De Valk H, et al. Incidence of listeriosis and related mortality among groups at risk of acquiring listeriosis. Clin Infect Dis 2012;54(5):652–60. [5] Deng X, Phillippy AM, Li Z, Salzberg SL, Zhang W. Probing the pan-genome of Listeria monocytogenes: new insights into intraspecific niche expansion and genomic diversification. BMC Genomics 2010;11:500. [6] Charlier C, Leclercq A, Cazenave B, Desplaces N, Travier L, Cantinelli T, et al. Listeria monocytogenes-associated joint and bone infections: a study of 43 consecutive cases. Clin Infect Dis 2012;54(2):240–8. [7] Le Monnier A, Blanot S, Abachin E, Beretti JL, Berche P, Kayal S. Listeria monocytogenes: a rare complication of ventriculoperitoneal shunt in children. J Clin Microbiol 2011;49(11):3924–7. [8] Fox EM, Leonard N, Jordan K. Physiological and transcriptional characterization of persistent and nonpersistent Listeria monocytogenes isolates. Appl Environ Microbiol 2011;77(18): 6559–69. [9] Saá Ibusquiza P, Herrera JJ, Cabo ML. Resistance to benzalkonium chloride, peracetic acid and nisin during formation of mature biofilms by Listeria monocytogenes. Food Microbiol 2011;28(3): 418–25. [10] da Silva EP, De Martinis EC. Current knowledge and perspectives on biofilm formation: the case of Listeria monocytogenes. Appl Microbiol Biotechnol 2013;97(3):957–68. [11] Kastbjerg VG, Larsen MH, Gram L, Ingmer H. Influence of sublethal concentrations of common disinfectants on expression of virulence genes in Listeria monocytogenes. Appl Environ Microbiol 2010;76(1):303–9. [12] Buffet-Bataillon S, Tattevin P, Bonnaure-Mallet M, Jolivet-Gougeon A. Emergence of resistance to antibacterial agents: the role of quaternary ammonium compounds – a critical review. Int J Antimicrob Agents 2012;39(5):381–9.
Please cite this article in press as: Tamburro M, et al. Gene expression in Listeria monocytogenes exposed to sublethal concentration of benzalkonium chloride. Comp Immunol Microbiol Infect Dis (2015), http://dx.doi.org/10.1016/j.cimid.2015.03.004
G Model CIMID-1004; No. of Pages 9
ARTICLE IN PRESS
M. Tamburro et al. / Comparative Immunology, Microbiology and Infectious Diseases xxx (2015) xxx–xxx [13] McDonnell G, Russell AD. Antiseptics and disinfectants: activity, action, and resistance. Clin Microbiol Rev 1999;12:147–79. [14] Meyer B. Does microbial resistance to biocides create a hazard to food hygiene? Int J Food Microbiol 2006;112(3):275–9. [15] Casey A, Fox EM, Schmitz-Esser S, Coffey A, McAuliffe O, Jordan K. Transcriptome analysis of Listeria monocytogenes exposed to biocide stress reveals a multi-system response involving cell wall synthesis, sugar uptake, and motility. Front Microbiol 2014;5:68. [16] Aase B, Sundheim G, Langsrud S, Rørvik LM. Occurrence of and a possible mechanism for resistance to a quaternary ammonium compound in Listeria monocytogenes. Int J Food Microbiol 2000;62(1–2):57–63. [17] Elhanafi D, Dutta V, Kathariou S. Genetic characterization of plasmidassociated benzalkonium chloride resistance determinants in a Listeria monocytogenes strain from the 1998–1999 outbreak. Appl Environ Microbiol 2010;76(24):8231–8. [18] Dutta V, Elhanafi D, Kathariou S. Conservation and distribution of the benzalkonium chloride resistance cassette bcrABC in Listeria monocytogenes. Appl Environ Microbiol 2013;79(19):6067–74. [19] Müller A, Rychli K, Muhterem-Uyar M, Zaiser A, Stessl B, Guinane CM, et al. Tn6188 – a novel transposon in Listeria monocytogenes responsible for tolerance to benzalkonium chloride. PLoS One 2013;8(10):e76835. [20] Romanova NA, Wolffs PF, Brovko LY, Griffiths MW. Role of efflux pumps in adaptation and resistance of Listeria monocytogenes to benzalkonium chloride. Appl Environ Microbiol 2006;72(5): 3498–503. [21] Huillet E, Velge P, Vallaeys T, Pardon P. LadR, a new PadR-related transcriptional regulator from Listeria monocytogenes, negatively regulates the expression of the multidrug efflux pump MdrL. FEMS Microbiol Lett 2006;254(1):87–94. [22] Rakic-Martinez M, Drevets DA, Dutta V, Katic V, Kathariou S. Listeria monocytogenes strains selected on ciprofloxacin or the disinfectant benzalkonium chloride exhibit reduced susceptibility to ciprofloxacin, gentamicin, benzalkonium chloride, and other toxic compounds. Appl Environ Microbiol 2011;77(24):8714–21. [23] Ryan EM, Gahan CG, Hill C. A significant role for Sigma B in the detergent stress response of Listeria monocytogenes. Lett Appl Microbiol 2008;46(2):148–54. [24] van der Veen S, Abee T. Importance of SigB for Listeria monocytogenes static and continuous-flow biofilm formation and disinfectant resistance. Appl Environ Microbiol 2010;76(23):7854–60. [25] Seeliger HP, Höhne K. Serotyping of Listeria monocytogenes and related species. Methods Microbiol 1979;13:31–49. [26] Doumith M, Buchrieser C, Glaser P, Jacquet C, Martin P. Differentiation of the major Listeria monocytogenes serovars by multiplex PCR. J Clin Microbiol 2004;42(8):3819–22. [27] Tamburro M, Ripabelli G, Fanelli I, Grasso GM, Sammarco ML. Typing of Listeria monocytogenes strains isolated in Italy by inlA gene characterization and evaluation of a new cost-effective approach to antisera selection for serotyping. J Appl Microbiol 2010;108(5):1602–11. [28] Ward TJ, Gorski L, Borucki MK, Mandrell RE, Hutchins J, Pupedis K. Intraspecific phylogeny and lineage group identification based on the prfA virulence gene cluster of Listeria monocytogenes. J Bacteriol 2004;186(15):4994–5002. [29] Graves LM, Swaminathan B. PulseNet standardized protocol for subtyping Listeria monocytogenes by macrorestriction and pulsed-field gel electrophoresis. Int J Food Microbiol 2001;65(1–2):55–62. [30] Sammarco ML, Ripabelli G, Tamburro M. Molecular epidemiology of infectious diseases: analytical methods and results interpretation. Ann Ig 2014;26(1):10–45. [31] Hunter PR, Gaston MA. Numerical index of the discriminatory ability of typing systems: an application of Simpson’s index of diversity. J Clin Microbiol 1988;26(11):2465–6.
9
[32] UNI EN 1276/2009. Chemical disinfectants and antiseptics. Quantitative suspension test for the evaluation of bactericidal activity of chemical disinfectants and antiseptics used in food, industrial, domestic and institutional areas. Test method and requirements. [33] Li H, Durbin R. Fast and accurate long-read alignment with Burrows–Wheeler transform. Bioinformatics 2010;26(5):589–95. [34] Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N, et al. The sequence alignment/map format and SAMtools. Bioinformatics 2009;25(16):2078–9. [35] Bankevich A, Nurk S, Antipov D, Gurevich AA, Dvorkin M, Kulikov AS, et al. SPAdes: a new genome assembly algorithm and its applications to single-cell sequencing. J Comput Biol 2012;19(5):455–77. [36] Rozen S, Skaletsky HJ. Primer3 on the WWW for general users and for biologist programmers. In: Krawetz S, Misener S, editors. Bioinformatics methods and protocols: methods in molecular biology. Totowa, NJ: Humana Press; 2000. p. 365–86. [37] Werbrouck H, Grijspeerdt K, Botteldoorn N, Van Pamel E, Rijpens N, Van Damme J, et al. Differential inlA and inlB expression and interaction with human intestinal and liver cells by Listeria monocytogenes strains of different origins. Appl Environ Microbiol 2006;72(6):3862–71. [38] Werbrouck H, Vermeulen A, Van Coillie E, Messens W, Herman L, Devlieghere F, et al. Influence of acid stress on survival, expression of virulence genes and invasion capacity into Caco-2 cells of Listeria monocytogenes strains of different origins. Int J Food Microbiol 2009;134(1–2):140–6. [39] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta DeltaC(T)) method. Methods 2001;25(4):402–8. [40] Bustin SA, Benes V, Garson JA, Hellemans J, Huggett J, Kubista M, et al. The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clin Chem 2009;55(4):611–22. [41] Mereghetti L, Quentin R, Marquet-Van Der Mee N, Audurier A. Low sensitivity of Listeria monocytogenes to quaternary ammonium compounds. Appl Environ Microbiol 2000;66(11):5083–6. [42] Mullapudi S, Siletzky RM, Kathariou S. Heavy-metal and benzalkonium chloride resistance of Listeria monocytogenes isolates from the environment of turkey-processing plants. Appl Environ Microbiol 2008;74(5):1464–8. [43] Soumet C, Ragimbeau C, Maris P. Screening of benzalkonium chloride resistance in Listeria monocytogenes strains isolated during cold smoked fish production. Lett Appl Microbiol 2005;41(3): 291–6. [44] Crimmins GT, Herskovits AA, Rehder K, Sivick KE, Lauer P, Dubensky Jr TW, et al. Listeria monocytogenes multidrug resistance transporters activate a cytosolic surveillance pathway of innate immunity. Proc Natl Acad Sci U S A 2008;105(29):10191–6. [45] Mata MT, Baquero F, Pérez-Diaz JC. A multidrug efflux transporter in Listeria monocytogenes. FEMS Microbiol Lett 2000;187(2):185–8. [46] Godreuil S, Galimand M, Gerbaud G, Jacquet C, Courvalin P. Efflux pump Lde is associated with fluoroquinolone resistance in Listeria monocytogenes. Antimicrob Agents Chemother 2003;47(2):704–8. [47] Begley M, Hill C, Ross RP. Tolerance of Listeria monocytogenes to cell envelope-acting antimicrobial agents is dependent on SigB. Appl Environ Microbiol 2006;72(3):2231–4. [48] Bergholz TM, Bowen B, Wiedmann M, Boor KJ. Listeria monocytogenes shows temperature dependent and independent responses to salt stress, including responses that induce crossprotection to other stresses. Appl Environ Microbiol 2012;78(8): 2602–12. [49] Renier S, Hébraud M, Desvaux M. Molecular biology of surface colonization by Listeria monocytogenes: an additional facet of an opportunistic Gram-positive foodborne pathogen. Environ Microbiol 2011;13(4):835–50.
Please cite this article in press as: Tamburro M, et al. Gene expression in Listeria monocytogenes exposed to sublethal concentration of benzalkonium chloride. Comp Immunol Microbiol Infect Dis (2015), http://dx.doi.org/10.1016/j.cimid.2015.03.004
ARTICLE IN PRESS
CIMID-1004; No. of Pages 9
Comparative Immunology, Microbiology and Infectious Diseases xxx (2015) xxx–xxx
Contents lists available at ScienceDirect
Comparative Immunology, Microbiology and Infectious Diseases journal homepage: www.elsevier.com/locate/cimid
Gene expression in Listeria monocytogenes exposed to sublethal concentration of benzalkonium chloride Manuela Tamburro a , Giancarlo Ripabelli a,∗ , Monia Vitullo a , Timothy James Dallman b , Mirella Pontello c , Corinne Francoise Laurence Amar b , Michela Lucia Sammarco a a b c
Department of Medicine and Health Sciences, University of Molise, Campobasso, Italy Gastrointestinal Bacteria Reference Unit, Public Health England, London, UK Department of Health Sciences, University of Milan, Milan, Italy
a r t i c l e
i n f o
Article history: Received 18 November 2014 Received in revised form 11 February 2015 Accepted 26 March 2015 Keywords: Listeria monocytogenes Benzalkonium chloride Gene expression Efflux systems Cross-response
a b s t r a c t In this study, tolerance at sublethal concentration of benzalkonium chloride and transcription levels of mdrL, ladR, lde, sigB and bcrABC genes in Listeria monocytogenes strains were evaluated. Viable cells reduction occurred in 45% of strains and clinical isolates showed lower sensitivity than isolates from foods. An increased transcription of an efflux system encoding gene was found in 60% of strains, and simultaneous mdrL overexpression and ladR underexpression occurred in 30% of isolates. A significant association between reduced benzalkonium chloride activity and both mdrL and sigB overexpression was observed; sigB expression also correlated with both mdrL and ladR genes. The bcrABC gene was only found in six strains, all isolated from foods and sensitive to benzalkonium chloride, and in four strains an underexpression was observed. Disinfection at sublethal concentration was less effective in clinical isolates, and mdrL and sigB expression was significantly affected by disinfection. Further insights are needed to understand the adaptation to benzalkonium chloride and to evaluate whether changes in gene expression could affect the L. monocytogenes virulence traits and persistence in the environment. © 2015 Elsevier Ltd. All rights reserved.
1. Introduction Listeria monocytogenes is an opportunistic intracellular pathogen responsible of serious infections, usually by ingestion of contaminated foods [1]. The majority of
∗ Corresponding author at: Department of Medicine and Health Sciences, University of Molise, Via De Sanctis, 86100 Campobasso, Italy. Tel.: +39 0874 404961; fax: +39 0874 404778. E-mail addresses: [email protected] (M. Tamburro), [email protected] (G. Ripabelli), [email protected] (M. Vitullo), [email protected] (T.J. Dallman), [email protected] (M. Pontello), [email protected] (C.F.L. Amar), [email protected] (M.L. Sammarco).
human cases are caused by three (4b, 1/2a, and 1/2b) out of 13 known serovars [2]. Clinical signs can vary from selflimiting gastroenteritis among healthy people to invasive infections with high fatality rates in vulnerable population groups (neonates, pregnant women, elderly, AIDS patients and individuals under immunosuppressive treatment) [3,4]. L. monocytogenes can survive under adverse environmental conditions and during human gastrointestinal passage [5]. Infection of ventriculoperitoneal shunt, prosthetic joints and heart valves [6,7] further confirmed L. monocytogenes ability to form and survive within biofilms on indwelling medical devices. This food-borne pathogen is also a common contaminant of food processing plants where it may persist over extended periods of time [8], and
http://dx.doi.org/10.1016/j.cimid.2015.03.004 0147-9571/© 2015 Elsevier Ltd. All rights reserved.
Please cite this article in press as: Tamburro M, et al. Gene expression in Listeria monocytogenes exposed to sublethal concentration of benzalkonium chloride. Comp Immunol Microbiol Infect Dis (2015), http://dx.doi.org/10.1016/j.cimid.2015.03.004
G Model CIMID-1004; No. of Pages 9
2
ARTICLE IN PRESS
M. Tamburro et al. / Comparative Immunology, Microbiology and Infectious Diseases xxx (2015) xxx–xxx
the application of biocides such as quaternary ammonium compounds (QACs) represents a useful approach for the control of L. monocytogenes in the processing environment. Hence, widespread distribution, natural resistance to stress conditions, and biofilm formation are of serious concerns for food industry [3,9] and healthcare settings, particularly if routine cleaning and disinfection procedures are not properly performed [10,11]. Moreover, an increased resistance to antimicrobials by Gram-positive and negative pathogens has been described [1,12], due to selective pressure for the extensive use of disinfecting agents and antibiotics. Benzalkonium chloride (BAC), belonging to QACs, is widely used for surfaces sanitization or as antiseptic, and it is responsible for the dissociation of cell membrane lipid bilayers by altering cellular permeability and inducing leakage of cellular contents [13]. The bactericidal activity begins when a critical minimum concentration is surpassed below which such activity is too slow or absent; thus, the effective concentration of QAC compounds could not be lower than certain thresholds, even if time application is significantly extended. In industry, concentrations of about 1000 ppm are commonly used when applying QACs to machinery for disinfection [14]. Although high concentration of QACs ensures complete eradication of any pathogenic bacteria from the surface of industrial equipment, L. monocytogenes has been shown to survive and adapt when exposed to sublethal concentrations of these disinfectants [15]. Hence, BAC adaptation in L. monocytogenes strains is a significant public health emerging issue for the selection and persistence of resistant mutants [16]. The mechanisms involved in the intrinsic or acquired QACs resistance are not completely elucidated; however, previous studies provided evidences for both chromosomal determinants and plasmid-mediated BAC resistance. A putative BAC resistance cassette, known as bcrABC, was previously identified on a large plasmid (pLM80) of L. monocytogenes H7550 strain involved in the 1998–1999 United States listeriosis outbreak [17], as well as in other Listeria sequenced genomes. BAC-associated resistance cassette is composed by TetR family transcriptional regulator (bcrA) and two SMR (small multidrug resistance) genes (bcrB and bcrC), all essential for imparting BAC resistance. Dutta et al. [18] reported that transcription of bcrABC in L. monocytogenes strains is induced by BAC sublethal concentration (10 g/ml), and the analysis has shown that the majority of BAC-resistant strains had either the pLM80type of organization of bcrABC region or appeared to harbor bcrABC on the chromosome, adjacent to novel sequences. Furthermore, Tn6188, an integrated chromosomally transposon, has been described to provide an increased tolerance of L. monocytogenes strains to BAC [19]. Tn6188 consists of three transposase genes (tnpABC), genes encoding a putative transcriptional regulator and QacH, a small multidrug resistance protein family (SMR) transporter associated with export of BAC. The induction of multidrug resistance efflux pump (MdrL) after BAC exposure has also been reported [20], and a putative protein, encoded by orfA gene, renamed as ladR [21], is considered as the mdrL transcriptional repressor
[22]. The Listeria drug efflux transporter, encoded by lde chromosomal gene, belongs to the major facilitator superfamily of secondary transporters, and is involved in the excretion of toxic compounds from bacterial cells, including some antibiotics. Moreover, several studies confirmed the role of the alternative sigma factor B (B ), encoded by sigB gene, in the response to environmental stress conditions (i.e., low pH, high bile and ethanol exposure, osmotic stress, etc.), and in BAC and peracetic acid resistance [23,24]. The induction of B -dependent genes under environmental stress conditions may support the hypothesis that resistant isolates should be more pathogenic, with higher resistance to antimicrobials. The aim of this study was to evaluate the antimicrobial activity of BAC, defined as the reduction of viable plate counts, at sublethal concentration, in L. monocytogenes isolated from foods and clinical cases in Italy, in order to evaluate the tolerance phenotype of the strains according to the isolation source. Changes in the relative expression of efflux systems encoding genes (mdrL and lde) and their regulators (ladR and sigB), as well as of bcrABC cassette, in the same isolates upon exposure to BAC sublethal concentration, were also assessed in order to evaluate the extent of the disinfecting treatment on the transcription, and the interaction in the tolerance development.
2. Materials and methods 2.1. Bacterial strains and bio-molecular subtyping Twenty L. monocytogenes strains from the Laboratory of Hygiene culture collection (University of Molise) and isolated by the Lombardia Regional Surveillance Network (North-Italy) were analyzed. The isolates were collected from both clinical cases (n = 10) and foods (n = 10) (Table 1). The serotypes were assigned by slide agglutination [25] and multiplex-PCR, developed by Doumith et al. [26], with some modifications [27]. The genomic division or lineage was identified, by PCR, according to Ward et al. [28] and some modifications [27]. Molecular subtyping of L. monocytogenes strains was performed by pulsed-field gel electrophoresis (PFGE), according to PulseNet USA protocol [29]. Briefly, the strains were grown overnight on Brain Heart Infusion (BHI; Biolife, Milan, Italy) agar, and cell suspension with optical density (OD620 ) of 1.6–1.8 in Tris-EDTA (TE, pH 8.0) buffer was prepared. Cells were lysed with lysozyme at 37 ◦ C for 10 min, and embedded in 1.2% Seakem® Gold agarose (Lonza, Milan, Italy). The cell plugs were washed and digested with both AscI (10 U/l) and ApaI (50 U/l) at 37 ◦ C for 4 h. Electrophoresis was carried out in 1% agarose gel (Seakem® Gold Agarose) with 0.5× Tris-borate-EDTA buffer in CHEFDR II instrument (Bio-Rad, Milan, Italy) at 6 V/cm for 21 h at switch time of 4–40 s. Gel was stained with ethidium bromide solution, and visualized by UV transilluminator Fire-Reader (UVITEC Cambridge, Eppendorf, Milan, Italy). PFGE profiles were analyzed by using BioNumerics software (Applied Maths, Kortrijk, Belgium) version 6.0. Dendrograms were generated by the unweighted pair group method algorithm (UPGMA) [30] including all the
Please cite this article in press as: Tamburro M, et al. Gene expression in Listeria monocytogenes exposed to sublethal concentration of benzalkonium chloride. Comp Immunol Microbiol Infect Dis (2015), http://dx.doi.org/10.1016/j.cimid.2015.03.004
G Model
ARTICLE IN PRESS
CIMID-1004; No. of Pages 9
M. Tamburro et al. / Comparative Immunology, Microbiology and Infectious Diseases xxx (2015) xxx–xxx
3
Table 1 Characteristics, molecular subtyping and logarithmic viable plate counts reduction (log R) of L. monocytogenes strains. Code
Source
Patients data
Strains analysis
Gender
Age
Risk factors
Serotype
Lineage
Pulsotype ApaI
Pulsotype AscI
Log R
PCR bcrABC
Hyperpyrexia in labor None Congenital immune deficiency
4b
I
8
VIII
4.3
−
1/2a 4b
II I
3 7
XI IX
NR NR
− −
1/2a 1/2a 4b 1/2a 4b 1/2a
II II I II I II
3 4 6 3 6 2
III VI XII VII V II
NR 4.8 NR 5.1 NR NR
− − − − − −
1/2a 1/2b 1/2c 1/2c 1/2b 1/2c 3a 1/2a 1/2a 1/2a 1/2a
II I II II I II II II II II II
4 5 2 2 5 2 1 1 1 1 1
VI X III IV X I XIII XIII XIII XIII XIII
5.2 NG 5.6 NR NR NG NG 4.9 6.5 5.9 6.2
− − − − − + + + + + +
H05
BC
F
45
H21 H41
BC CSF
M F
41 28
H45 H111 H133 H141 H150 H153
CSF BC BC Placenta Rectal swab at birth
F M F F M
76 64 74 36 0
H159 F5 F7 F36 F44 F46 F78 F86 F115 F116 F127
BC Ground sausage Ground sausage Salami Salami Salami Gorgonzola cheese Gorgonzola cheese Taleggio cheese Taleggio cheese Taleggio cheese
F n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a.
68 n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a.
Immunosuppression Neoplasia None None Consumption of contaminated food Renal failure n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a.
H, clinical strains; F, food isolates; BC, blood culture; CSF, cerebrospinal fluid; F, female; M, male; n.a., not applicable; NR, no reduction; NG, no growth.
strains, and Simpson’s index [31] for both enzymes was calculated. 2.2. Antimicrobial activity of benzalkonium chloride The BAC (Sigma Aldrich, Milan, Italy) activity was assessed according to UNI EN ISO 1276/2009 protocol by using the membrane filtration method, and counting colonies grown on plates [32]. All the assays were performed with 0.3% (w/v) bovine serum albumin (BSA; Sigma–Aldrich) at 5 min contact time, choosing 10 ppm as sublethal concentration based on our previous results (data not shown), and according to previous observations [17]. L. monocytogenes isolates were cultured on selective Listeria ACC. to Ottaviani & Agosti (ALOA; Biolife) agar at 37 ◦ C overnight. Bacterial suspensions were prepared with pure grown colony into 1 ml saline solution (0.90%, w/v) in order to reach 0.1 optical density (OD600 ), and by adding BSA (1 ml) and BAC solution (8 ml) for treated sample [32]. In parallel, an untreated control sample was prepared by adding BSA and sterile water to bacterial suspension at same proportions. After 5 min contact time at 20 ± 1 ◦ C [32], 100 l of the solution were transferred into filtration system, and bacterial cells were retained on Whatman filter paper (0.45 m, ALBET Lab-science, Barcelona, Spain) surface. Each filter was placed onto a Trypticase Soy Agar (TSA, Biolife) plates, and incubated at 37 ◦ C for 48 h. This procedure was carried out in duplicate, and the mean number of grown colonies was calculated for both treated and untreated samples. Bactericidal activity was determined as the viable cells reduction (R), calculated as the ratio of [(Ni × 10−1 )/Nf ], where Ni are the unit forming colonies (UFC)/ml in the initial bacterial suspension
without disinfectant, Nf the UFC/ml in the suspension with benzalkonium chloride, and 10−1 is dilution factor. The disinfecting treatment was considered effective when the viable cells reduction upon contact was at least or higher than 5 logarithmic cycles (log R ≥ 5), according to the reference standard cut-off for the assay [32]. 2.3. PCR screening for bcrABC resistance cassette A positive control strain harboring bcrABC gene cassette was in silico demonstrated by analyzing the genome sequences of 87 L. monocytogenes strains from Food Safety Microbiology Laboratory (Public Health England, Colindale, London, UK). All the sequences were aligned against L. monocytogenes J2446 (GenBank accession number JX023277.1; http://www.ncbi.nlm.nih.gov/ genbank/) cassette sequence gene using BWASW (Burrows–Wheeler short reads of Aligner, Smith–Waterman) alignment [33,34]. Spades version 2.5.1 [35] was used to produce de novo assemblies to confirm whether the bcr cassette could be assembled. PCR assay for bcrABC detection in the selected strains (Table 1) was developed and performed including a positive control strain, using forward and reverse primers ex novo designed by using Primer3 software [36] (Table 2) based on L. monocytogenes J2446 bcrABC sequence, amplifying a 197 bp product. DNA extraction was performed in the automated Maxwell® 16 Instrument (Promega, Milan, Italy) using Maxwell® 16 Cell DNA Purification Kit (Promega), according to manufacturers’ instructions. PCRs were performed at 25 l final volume containing 2 l of DNA template, 12.5 l of Master Mix 2× (Promega) and 1.5 mol l−1 of each primer. Samples were amplified as follows: 95 ◦ C for 3 min, followed by 35 cycles of 95 ◦ C for
Please cite this article in press as: Tamburro M, et al. Gene expression in Listeria monocytogenes exposed to sublethal concentration of benzalkonium chloride. Comp Immunol Microbiol Infect Dis (2015), http://dx.doi.org/10.1016/j.cimid.2015.03.004
G Model CIMID-1004; No. of Pages 9
ARTICLE IN PRESS
M. Tamburro et al. / Comparative Immunology, Microbiology and Infectious Diseases xxx (2015) xxx–xxx
4
Table 2 Primers used in qRT-PCR assays.
following the manufacturer’s instructions. A reaction without the enzyme was carried out for each RNA sample in order to obtain the no-reverse transcription control (NoRT), necessary to check for residual DNA in the relative quantification assays.
Genes
Oligonucleotide sequences (5 –3 )
References
tufA
Fwd: GCTGAAGCTGGCGACAACA Rev: CTTGACCACGTTGGATATCTTCAC
[38]
lde
Fwd: GGCACTATCAACGGCAGCGGT Rev: TGTGTCCGACAACGCTCCACC
This study
2.5. Relative gene expression
mdrL
Fwd: CCTCGGTACACTGCAACTCGGC Rev: CCGCCATCGCACCACCAATCA
This study
orfA
Fwd: TTTGCATAATTCGAAGCCGGTTTGC Rev: TGATTGCTCGTGAAGCTTCTAGTGG
This study
bcrABC
Fwd: TGGACTCGCGCCTTAATACA Rev: TCGAGGGTAAGCCGAATTGT
This study
sigB
Fwd: AAAGAAACGGGTGAACTACTCGAT Rev: CAACGCCTCTCGAAGTTTTTTAA
[38]
Quantitative reverse-transcription PCR (qRT-PCR) was used to evaluate in L. monocytogenes strains (Table 1) the effects of BAC sublethal concentration on the relative expression of mdrL, ladR, lde, sigB and bcrABC genes, normalized to tufA housekeeping gene, according to Werbrouck et al. [37,38]. Oligonucleotides targeting mdrL, ladR, lde and bcrABC genes were ex novo designed (Table 2) using Primer3 software [36], based on L. monocytogenes EGD-e reference strain genome sequence (NCBI Reference Sequence: NC 003210.1; http://www.ncbi.nlm.nih.gov/genbank/) for the first three target genes and on L. monocytogenes J2446 (NCBI Reference Sequence: JX023277.1; http://www.ncbi. nlm.nih.gov/genbank/) for bcrABC gene. Primers specificity was in silico evaluated through the Basic Local Alignment Search Tool (BLAST; http://blast.ncbi.nlm. nih.gov/Blast.cgi). Oligonucleotides previously published [38] were used for tufA and sigB genes amplification. Each qRT-PCR assay was performed in 25 l reactions, containing 2 l of cDNA template in 1× SYBR® Premix Ex TaqTM (Takara, Diatech Labline, Milan, Italy), and 1× ROX Reference Dye II (Takara). Primers (Eurogentec, Biosense s.r.l., Milan, Italy) targeting tufA and sigB genes were used at 0.3 mol l−1 final concentration, whereas those targeting mdrL, ladR, and lde genes at 0.6 mol l−1 (Table 2). The assays were performed in Mastercycler® ep realplex 4S (Eppendorf, Milan, Italy) instrument, following 40 cycles protocol, consisting of denaturation at 95 ◦ C for 5 s and annealing/extension at 65 ◦ C for 30 s. Melting-curve analysis was performed in order to verify the specificity of amplified products. Negative controls (NTCs) to exclude any contamination, as well as positive controls to evaluate the assay reliability, were included in all reactions, which were performed in triplicate for each strain. Analysis of qRT-PCR data was carried out according to the comparative CT method [39], in order to calculate the relative expression of target genes after the exposure to BAC sublethal concentration, normalized to tufA housekeeping gene. Results were expressed as nFold (2−C T ); values >1 and 10. Amplification efficiency (ε = 10−1/slope − 1) was calculated for both housekeeping and target gene from the slope of the log-linear portion of the calibration curve [40] with five serial dilutions of L. monocytogenes EGD-e strain cDNA.
1 min, 50 ◦ C for 2 min, 72 ◦ C for 1 min, with final extension at 72 ◦ C for 5 min. Amplification products were resolved on 1% agarose gel (Eppendorf), and visualized on UV transilluminator Fire-Reader (UVITEC Cambridge, Eppendorf) after ethidium bromide staining. PCR products were also verified by PCR-restriction fragment length polymorphism (RFLP) by using HinfI (Promega) and TaqI (Promega). 2.4. RNA isolation and cDNA synthesis Bacterial colonies grown on ALOA (Biolife) agar were resuspended in BHI broth (Biolife) at 37 ◦ C to reach an OD600 of 0.8–0.9 corresponding to mid-late logarithmic growth phase. Bacterial culture (1 ml) was then harvested for total RNA isolation, according to Werbrouck et al. [37] protocol, with some modifications. Briefly, BAC solution (8 ml) and 0.3% BSA (1 ml) were added to cultures (1 ml). The mixture was incubated for 5 min, and centrifuged at 4000 rpm for 10 min. The supernatant (9.5 ml) was discarded, and RNA was stabilized by adding 1 ml of RNA Protect Bacteria reagent (Qiagen, Valencia, CA). The bacterial pellet was collected as recommended by manufacturer’s instructions. For each strain, an untreated control (calibrator) was obtained following the same protocol but replacing the disinfectant solution with sterile Milli-Q water. Total RNA was extracted from each pellet after thawing using RNeasy mini kit (Qiagen), according to manufacturer’s instructions. Cell lysis was achieved by adding 100 l solution containing 5 mg/ml of lysozyme (Promega) to each pellet and 13 mg/ml of proteinase K (Promega) in TE buffer, incubating at 37 ◦ C for 30 min. DNase treatment was performed during RNA purification with an on-column digestion by RNase-Free DNase set (Qiagen), according to the manufacturer’s protocol. RNA concentration, quality and purity were assessed by agarose gel electrophoresis, A260 /A280 (>1.8) ratio with NanoDrop2000 spectrophotometer (Thermo Scientific, Wilmington, USA), and by microfluidic analysis with ExperionTM RNA Standard Sense kit (Bio-Rad). Reverse transcription reaction from total RNA of both treated (10 ppm BAC) and untreated strains was in vitro performed by iScriptTM cDNA synthesis kit (Bio-Rad),
2.6. Statistical analysis Data analysis was performed by SPSS software v.17.0 (SPSS Inc., Chicago, IL, USA) using one-way analysis of
Please cite this article in press as: Tamburro M, et al. Gene expression in Listeria monocytogenes exposed to sublethal concentration of benzalkonium chloride. Comp Immunol Microbiol Infect Dis (2015), http://dx.doi.org/10.1016/j.cimid.2015.03.004
G Model
ARTICLE IN PRESS
CIMID-1004; No. of Pages 9
M. Tamburro et al. / Comparative Immunology, Microbiology and Infectious Diseases xxx (2015) xxx–xxx
92.9 85.2 100
83.1
64.9 91.7 89.3 95.7
58.2
96.3 80.7 68.7 82.4
52.6
83.9 77.8 69.3 60.1
92.9
F78 F86 F115 F116 F127 F7 H153 F36 F46 H21 H45 H141 H111 H159 F44 F5 H133 H150 H41 H05
100
95
90
85
80
75
70
65
60
55
50
100
95
85
80
90
AscI dendrograms 75
70
65
60
55
ApaI dendrograms
5
70 68.9
85.7 73.1
62.8
50.6 83.3 73.3 48.7
66.7 58.4 55.4
100 66.7
45.5
100 85
F46 H153 F7 H45 F36 H150 H111 H159 H141 H05 H41 F44 F5 H21 H133 F115 F116 F127 F86 F78
Fig. 1. PFGE dendrograms of 20 L. monocytogenes strains by using Dice coefficient and 1% band position tolerance. H, clinical strains; F, food strains.
variance (ANOVA) to test for significant differences in relative gene expression among BAC resistant and sensitive strains (log R < 5 and log R ≥ 5, respectively). p-Values 0.05). Among BAC-resistant strains isolated from food (F36, F44, and F86), a simultaneous overexpression of mdrL, lde and sigB was found, whereas in BAC-resistant clinical strains (n = 8), five isolates showed mdrL overexpression and four strains an increased expression of both lde and sigB genes.
Please cite this article in press as: Tamburro M, et al. Gene expression in Listeria monocytogenes exposed to sublethal concentration of benzalkonium chloride. Comp Immunol Microbiol Infect Dis (2015), http://dx.doi.org/10.1016/j.cimid.2015.03.004
G Model
ARTICLE IN PRESS
CIMID-1004; No. of Pages 9
M. Tamburro et al. / Comparative Immunology, Microbiology and Infectious Diseases xxx (2015) xxx–xxx
A
10
Log 10 nFold mdrL
F116*
F127*
F86
F115*
F78*
F44
F46*
F7*
F36
F5*
H153
H159*
H150
H141*
H111
H133
H45
H41
0,1
H21
1
H05
6
100
B
10 1
F127*
F116*
F115*
F86
F78*
F46*
F44
F36
F7*
F5*
H159*
H153
H150
H141*
H133
H111
H45
H41
H21
0,1
H05
Log10 nFold lde
Strains
Strains
C
F127*
F116*
F115*
F86
F78*
F44
F46*
F36
F7*
F5*
H159*
H153
H150
H141*
H133
H111
H45
H21
H41
1
HO5
Log10nFold ladR
10
0,1
10
D
F127*
F116*
F115*
F86
F78*
F46*
F44
F36
F7*
F5*
H159*
H153
H150
H141*
H133
H111
H45
H41
0,1
H21
1
H05
Log 10 nFold sigB
Strains
Strains
1
F127*
F116*
F115*
F86
F78*
0,1
F46*
Log10 nFold bcrABC
E
0,01 Strains
Fig. 2. Gene expression profiles (Log10 nFold) of mdrL (A), lde (B), ladR (C), sigB (D) and bcrABC (E) genes in L. monocytogenes strains isolated from clinical cases (H) and food (F). *BAC-sensitive strains; no expression level was detectable for F46 and F86 strains.
Please cite this article in press as: Tamburro M, et al. Gene expression in Listeria monocytogenes exposed to sublethal concentration of benzalkonium chloride. Comp Immunol Microbiol Infect Dis (2015), http://dx.doi.org/10.1016/j.cimid.2015.03.004
G Model CIMID-1004; No. of Pages 9
ARTICLE IN PRESS
M. Tamburro et al. / Comparative Immunology, Microbiology and Infectious Diseases xxx (2015) xxx–xxx
Overall, mdrL gene showed higher expression levels than other target genes (Fig. 2 A), with a median nFold of 1.09. A high variability within strains for lde and ladR (Fig. 2B and C) was found, with mean expression levels of 2.42 ± 3.08 (median 1.02), and 1.04 ± 0.53 (median 0.86), respectively. The higher mean overexpression levels were of 4.20 ± 3.59 for lde gene, followed by mdrL (1.66 ± 0.54), sigB (1.58 ± 0.54), and ladR (1.52 ± 0.54). The highest nFold values of mdrL, sigB, and ladR genes were 2.85, 2.69, and 2.51, respectively, while the maximum transcription levels were found for lde gene in F44 (11.31-fold), H41 (8.28-fold), and H133 (7.67-fold) strains (Fig. 2). The increased expression of at least one efflux system (MdrL and Lde) encoding genes was observed in 60% of strains, while the simultaneous increase only in 30% of isolates (Fig. 2A and B). Statistical analysis confirmed a significant correlation (p < 0.05) between reduced BAC activity and mdrL overexpression, while transcription levels of both lde and ladR genes were not associated to any effect of disinfectant. Among food isolates, overexpression of both mdrL and lde occurred only in BAC-resistant (log R < 5) strains. Conversely, within clinical isolates, the increased transcriptional levels were also observed in BAC-sensitive strains, and often associated with serotype 4b. The ladR gene was underexpressed in 60% of strains, including both clinical and food isolates (Fig. 2C); ladR overexpression and mdrL underexpression (or vice versa) were found in 30% of isolates, particularly in clinical strains. Changes in sigB gene expression after disinfectant treatment was significantly associated (p < 0.05) with BAC activity; in fact, increased transcription levels were observed in 45% (n = 9) of strains (Fig. 2 D) which resulted tolerant to BAC, and also 30% (n = 6) of BAC-sensitive isolates showed sigB underexpression. Particularly, sigB gene was 2.69, 2.43, and 1.74-fold more expressed in F36, F44, and F86 isolates from foods, which were all BAC-resistant (log R < 5). A strong correlation (p < 0.01) of sigB with mdrL (Pearson’s coefficient 0.665) and ladR (0.662) expression profiles was found, as well as between mdrL and ladR (0.549; p < 0.05). The analysis in silico for bcrABC detection within 87 sequenced genomes revealed that only five strains of 1/2b serotype harbored the intergenic cassette, with 100% sequence similarity each other and also from L. monocytogenes J2446 reference strain. Among the analyzed strains (Table 1), bcrABC cassette encoding gene was identified only in six (30%) out of twenty strains, all isolated from foods (F46, F78, F86, F115, F116, F127) and belonging to lineage II. Interestingly, bcr gene was detected in BAC-sensitive strains (log R > 5; Fisher’s exact p = 0.011). An underexpression of bcrABC gene was observed in four (F78, F115, F116, F127) out of six strains harboring the cassette gene (Fig. 2E). The decreased transcription levels were related to a simultaneous mdrL underexpression, and only for F115 and F116 an underexpression of both mdrL and lde genes was observed. However, no significant correlation was found between the expression levels of both efflux pumps encoding genes and bcrABC gene. In the two remaining strains (F46 and F86) containing bcrABC, gene expression was not detectable.
7
4. Discussion Our results showed that the increased tolerance to sublethal disinfection occurred in 45% of isolates, in agreement with previous studies, where BAC tolerance has shown between 10% [16] and 42–46% [41–43]. The reduction of viable cells upon disinfectant exposure was more common in food isolates, whereas BAC activity was less effective against clinical isolates, suggesting that such adaptation mechanisms and the development of tolerance phenotype could be involved in human listeriosis [44]. Previous studies also described a lower prevalence of BAC tolerance among 4b serotype, and a higher sensitivity in 1/2a and 1/2b strains [42,43]. However, because of the limited number of analyzed strains, no correlation between increased tolerance to disinfectant and serotypes was found. Changes in the relative expression of stressresponse and resistance-associated genes after sublethal disinfectant exposure were also evaluated. Our results showed a significant association between disinfectant exposure and mdrL overexpression, conversely no correlation with lde gene was found, in agreement with Romanova et al. [20], who reported that BAC adaptation among L. monocytogenes isolates could result in a significantly increased expression of mdrL gene. Among food isolates, the overexpression of both mdrL and lde genes occurred only in BAC-resistant strains, probably associated to an intrinsic resistance [20]. The efflux systems could play a critical role in cross-resistance to antimicrobial drugs. Particularly, MdrL is implicated in resistance to macrolides and cefotaxime [20], and previous studies reported that ciprofloxacin and BAC-resistant isolates produced derivatives more resistant also to gentamicin, ethidium bromide, and chemotherapeutic drug tetraphenylphosphonium [21,22,45]. Furthermore, the enhanced lde gene transcription in clinical fluoroquinolone-resistant isolates has been reported [46], as well as Lde activation in reducing ciprofloxacin activity toward L. monocytogenes. Studies on transcriptional analysis of both mdrL and ladR genes showed that ladR expression is abolished when mdrL transcription is activated [21]. Furthermore, Crimmins et al. [44] observed that mdrL gene was highly induced in ladR mutants, confirming the role of ladR as mdrL transcriptional repressor. However, our results could not support this hypothesis because ladR overexpression vs mdrL underexpression (or vice versa) occurred only in few isolates. The general stress response in many Gram-positive bacteria, including Listeria spp., is associated to B dependent genes expression. The role of the alternative sigma factor in BAC tolerance of both planktonic cells and biofilms has been previously reported [24], as well as in virulence mechanisms, such as tolerance to cell envelopeacting antimicrobials (i.e., nisin, ampicillin, penicillin G, and vancomycin) and survival in the human gastrointestinal tract [24]. In our study, the significant association between BAC exposure and B expression confirmed its essential function for the increase tolerance to stress factors [23]. The sigB overexpression mainly occurred in BAC-resistant
Please cite this article in press as: Tamburro M, et al. Gene expression in Listeria monocytogenes exposed to sublethal concentration of benzalkonium chloride. Comp Immunol Microbiol Infect Dis (2015), http://dx.doi.org/10.1016/j.cimid.2015.03.004
G Model CIMID-1004; No. of Pages 9
ARTICLE IN PRESS
M. Tamburro et al. / Comparative Immunology, Microbiology and Infectious Diseases xxx (2015) xxx–xxx
8
strains isolated from food, and with highest transcription levels of both MdrL and Lde efflux systems encoding genes. A significant correlation between mdrL and sigB, whose consensus binding sites are reported in mdrL gene [47], could indicate that sigma B is a necessary factor for coordination of bacterial adaptive responses to adverse environmental conditions. Hence, B induction after BAC sublethal concentrations exposure may activate non-specific extrusion mechanisms for toxic compounds from bacterial cells. As reported in previous studies, sigB activation after BAC exposure may also generate positive cross-responses to other stress factors, and the increased virulence in surviving cells, affecting food safety and representing a serious public health risk [11,48]. Recently, Casey et al. [15] have investigated the global response and adaption of L. monocytogenes 6179 persistent strain (serotype 1/2a) isolated from cheese processing environment on the exposure to sublethal concentrations of benzethonium chloride (BZT), a QAC industrial detergent. Gene expression levels were quantified, using transcriptome sequencing and RNA-Seq analysis, following growth of the strain in BZT presence (4 ppm) or absence (0 ppm). The analysis identified about 600 genes with 4-fold or greater change in the relative expression in BZT-treated sample compared to the control, and a differential regulation of 7.5-fold or greater factor over 141 genes. According to previous results [8] a widespread up-regulation in the expression of genes involved in peptidoglycan and teichoic acid biosynthesis and fatty acids metabolism were observed. In addition, Casey et al. [15] demonstrated a considerable up-regulation in genes involved in cell wall biosynthesis, chemotaxis and motility cascade. Many genes involved in maintenance of cell membrane fluidity and in carbohydrates uptake were also up-regulated. Moreover, when exposed to BZT, L. monocytogenes increased expression of genes encoding multi-drug resistance transporters and involved in stress response. Expression of genes encoding virulence factors, such as listeriolysin O and the internalins, remained relatively unchanged following the exposure to BZT. The exposure of L. monocytogenes to low level of disinfectants in the food processing environment would only occur as a result of improper cleaning practices, considering the high concentrations generally used and applied to equipment and surfaces. However, despite the effectiveness of disinfection ensuring lower risk of microbial contamination and pathogen elimination, several factors (such as organic debris, dosage failure, etc.) could inactivate the disinfection agents, leading to the exposure to sublethal concentration [49]; moreover, the L. monocytogenes ability to adapt to stress conditions and to produce biofilm enables it to withstand stresses imposed by disinfectants. 5. Conclusions Our study underlines and confirms that BAC sublethal concentration significantly affect L. monocytogenes gene expression, especially of mdrL and sigB, both contributing to an increased tolerance to disinfectant. In addition, the
study does not show any correlation between BAC resistance and strain serotype, and suggests that ladR might not repress mdrL expression. Sigma B, involved in the transcriptional response to several stressors, might also be responsible for mdrL activation in response to BAC. A greater number of strains and further experiments are needed to better evaluate how the potential increase of L. monocytogenes tolerance upon exposure at sublethal concentrations could affect the sensitivity to both disinfectants and antibiotics of clinical significance. Hence, an improved understanding of L. monocytogenes response to different stress factors is necessary to evaluate the extent of changes in virulence or other biological properties as a response to stress and resistance-associated gene expression, and how to control and reduce these events. Conflict of interest The authors do not have competing interest. Acknowledgements We acknowledge the helpful comments from Dr. Jim McLauchlin, Public Health England, London, UK, and the technical support of Dr. Incoronata Fanelli, University of Molise, Campobasso, Italy. References [1] Sammarco ML, Ripabelli G, Fanelli I, Grasso GM. Prevalence of Listeria spp. in dairy farm and evaluation of antibiotic-resistance of isolates. Ann Ig 2005;17(3):175–83. [2] Vitullo M, Grant KA, Sammarco ML, Tamburro M, Ripabelli G, Amar CF. Real-time PCRs assay for serogrouping Listeria monocytogenes and differentiation from other Listeria spp. Mol Cell Probes 2013;27(1):68–70. [3] Carpentier B, Cerf O. Persistence of Listeria monocytogenes in food industry equipment and premises. Int J Food Microbiol 2011;145(1):1–8. [4] Goulet V, Hebert M, Hedberg C, Laurent E, Vaillant V, De Valk H, et al. Incidence of listeriosis and related mortality among groups at risk of acquiring listeriosis. Clin Infect Dis 2012;54(5):652–60. [5] Deng X, Phillippy AM, Li Z, Salzberg SL, Zhang W. Probing the pan-genome of Listeria monocytogenes: new insights into intraspecific niche expansion and genomic diversification. BMC Genomics 2010;11:500. [6] Charlier C, Leclercq A, Cazenave B, Desplaces N, Travier L, Cantinelli T, et al. Listeria monocytogenes-associated joint and bone infections: a study of 43 consecutive cases. Clin Infect Dis 2012;54(2):240–8. [7] Le Monnier A, Blanot S, Abachin E, Beretti JL, Berche P, Kayal S. Listeria monocytogenes: a rare complication of ventriculoperitoneal shunt in children. J Clin Microbiol 2011;49(11):3924–7. [8] Fox EM, Leonard N, Jordan K. Physiological and transcriptional characterization of persistent and nonpersistent Listeria monocytogenes isolates. Appl Environ Microbiol 2011;77(18): 6559–69. [9] Saá Ibusquiza P, Herrera JJ, Cabo ML. Resistance to benzalkonium chloride, peracetic acid and nisin during formation of mature biofilms by Listeria monocytogenes. Food Microbiol 2011;28(3): 418–25. [10] da Silva EP, De Martinis EC. Current knowledge and perspectives on biofilm formation: the case of Listeria monocytogenes. Appl Microbiol Biotechnol 2013;97(3):957–68. [11] Kastbjerg VG, Larsen MH, Gram L, Ingmer H. Influence of sublethal concentrations of common disinfectants on expression of virulence genes in Listeria monocytogenes. Appl Environ Microbiol 2010;76(1):303–9. [12] Buffet-Bataillon S, Tattevin P, Bonnaure-Mallet M, Jolivet-Gougeon A. Emergence of resistance to antibacterial agents: the role of quaternary ammonium compounds – a critical review. Int J Antimicrob Agents 2012;39(5):381–9.
Please cite this article in press as: Tamburro M, et al. Gene expression in Listeria monocytogenes exposed to sublethal concentration of benzalkonium chloride. Comp Immunol Microbiol Infect Dis (2015), http://dx.doi.org/10.1016/j.cimid.2015.03.004
G Model CIMID-1004; No. of Pages 9
ARTICLE IN PRESS
M. Tamburro et al. / Comparative Immunology, Microbiology and Infectious Diseases xxx (2015) xxx–xxx [13] McDonnell G, Russell AD. Antiseptics and disinfectants: activity, action, and resistance. Clin Microbiol Rev 1999;12:147–79. [14] Meyer B. Does microbial resistance to biocides create a hazard to food hygiene? Int J Food Microbiol 2006;112(3):275–9. [15] Casey A, Fox EM, Schmitz-Esser S, Coffey A, McAuliffe O, Jordan K. Transcriptome analysis of Listeria monocytogenes exposed to biocide stress reveals a multi-system response involving cell wall synthesis, sugar uptake, and motility. Front Microbiol 2014;5:68. [16] Aase B, Sundheim G, Langsrud S, Rørvik LM. Occurrence of and a possible mechanism for resistance to a quaternary ammonium compound in Listeria monocytogenes. Int J Food Microbiol 2000;62(1–2):57–63. [17] Elhanafi D, Dutta V, Kathariou S. Genetic characterization of plasmidassociated benzalkonium chloride resistance determinants in a Listeria monocytogenes strain from the 1998–1999 outbreak. Appl Environ Microbiol 2010;76(24):8231–8. [18] Dutta V, Elhanafi D, Kathariou S. Conservation and distribution of the benzalkonium chloride resistance cassette bcrABC in Listeria monocytogenes. Appl Environ Microbiol 2013;79(19):6067–74. [19] Müller A, Rychli K, Muhterem-Uyar M, Zaiser A, Stessl B, Guinane CM, et al. Tn6188 – a novel transposon in Listeria monocytogenes responsible for tolerance to benzalkonium chloride. PLoS One 2013;8(10):e76835. [20] Romanova NA, Wolffs PF, Brovko LY, Griffiths MW. Role of efflux pumps in adaptation and resistance of Listeria monocytogenes to benzalkonium chloride. Appl Environ Microbiol 2006;72(5): 3498–503. [21] Huillet E, Velge P, Vallaeys T, Pardon P. LadR, a new PadR-related transcriptional regulator from Listeria monocytogenes, negatively regulates the expression of the multidrug efflux pump MdrL. FEMS Microbiol Lett 2006;254(1):87–94. [22] Rakic-Martinez M, Drevets DA, Dutta V, Katic V, Kathariou S. Listeria monocytogenes strains selected on ciprofloxacin or the disinfectant benzalkonium chloride exhibit reduced susceptibility to ciprofloxacin, gentamicin, benzalkonium chloride, and other toxic compounds. Appl Environ Microbiol 2011;77(24):8714–21. [23] Ryan EM, Gahan CG, Hill C. A significant role for Sigma B in the detergent stress response of Listeria monocytogenes. Lett Appl Microbiol 2008;46(2):148–54. [24] van der Veen S, Abee T. Importance of SigB for Listeria monocytogenes static and continuous-flow biofilm formation and disinfectant resistance. Appl Environ Microbiol 2010;76(23):7854–60. [25] Seeliger HP, Höhne K. Serotyping of Listeria monocytogenes and related species. Methods Microbiol 1979;13:31–49. [26] Doumith M, Buchrieser C, Glaser P, Jacquet C, Martin P. Differentiation of the major Listeria monocytogenes serovars by multiplex PCR. J Clin Microbiol 2004;42(8):3819–22. [27] Tamburro M, Ripabelli G, Fanelli I, Grasso GM, Sammarco ML. Typing of Listeria monocytogenes strains isolated in Italy by inlA gene characterization and evaluation of a new cost-effective approach to antisera selection for serotyping. J Appl Microbiol 2010;108(5):1602–11. [28] Ward TJ, Gorski L, Borucki MK, Mandrell RE, Hutchins J, Pupedis K. Intraspecific phylogeny and lineage group identification based on the prfA virulence gene cluster of Listeria monocytogenes. J Bacteriol 2004;186(15):4994–5002. [29] Graves LM, Swaminathan B. PulseNet standardized protocol for subtyping Listeria monocytogenes by macrorestriction and pulsed-field gel electrophoresis. Int J Food Microbiol 2001;65(1–2):55–62. [30] Sammarco ML, Ripabelli G, Tamburro M. Molecular epidemiology of infectious diseases: analytical methods and results interpretation. Ann Ig 2014;26(1):10–45. [31] Hunter PR, Gaston MA. Numerical index of the discriminatory ability of typing systems: an application of Simpson’s index of diversity. J Clin Microbiol 1988;26(11):2465–6.
9
[32] UNI EN 1276/2009. Chemical disinfectants and antiseptics. Quantitative suspension test for the evaluation of bactericidal activity of chemical disinfectants and antiseptics used in food, industrial, domestic and institutional areas. Test method and requirements. [33] Li H, Durbin R. Fast and accurate long-read alignment with Burrows–Wheeler transform. Bioinformatics 2010;26(5):589–95. [34] Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N, et al. The sequence alignment/map format and SAMtools. Bioinformatics 2009;25(16):2078–9. [35] Bankevich A, Nurk S, Antipov D, Gurevich AA, Dvorkin M, Kulikov AS, et al. SPAdes: a new genome assembly algorithm and its applications to single-cell sequencing. J Comput Biol 2012;19(5):455–77. [36] Rozen S, Skaletsky HJ. Primer3 on the WWW for general users and for biologist programmers. In: Krawetz S, Misener S, editors. Bioinformatics methods and protocols: methods in molecular biology. Totowa, NJ: Humana Press; 2000. p. 365–86. [37] Werbrouck H, Grijspeerdt K, Botteldoorn N, Van Pamel E, Rijpens N, Van Damme J, et al. Differential inlA and inlB expression and interaction with human intestinal and liver cells by Listeria monocytogenes strains of different origins. Appl Environ Microbiol 2006;72(6):3862–71. [38] Werbrouck H, Vermeulen A, Van Coillie E, Messens W, Herman L, Devlieghere F, et al. Influence of acid stress on survival, expression of virulence genes and invasion capacity into Caco-2 cells of Listeria monocytogenes strains of different origins. Int J Food Microbiol 2009;134(1–2):140–6. [39] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta DeltaC(T)) method. Methods 2001;25(4):402–8. [40] Bustin SA, Benes V, Garson JA, Hellemans J, Huggett J, Kubista M, et al. The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clin Chem 2009;55(4):611–22. [41] Mereghetti L, Quentin R, Marquet-Van Der Mee N, Audurier A. Low sensitivity of Listeria monocytogenes to quaternary ammonium compounds. Appl Environ Microbiol 2000;66(11):5083–6. [42] Mullapudi S, Siletzky RM, Kathariou S. Heavy-metal and benzalkonium chloride resistance of Listeria monocytogenes isolates from the environment of turkey-processing plants. Appl Environ Microbiol 2008;74(5):1464–8. [43] Soumet C, Ragimbeau C, Maris P. Screening of benzalkonium chloride resistance in Listeria monocytogenes strains isolated during cold smoked fish production. Lett Appl Microbiol 2005;41(3): 291–6. [44] Crimmins GT, Herskovits AA, Rehder K, Sivick KE, Lauer P, Dubensky Jr TW, et al. Listeria monocytogenes multidrug resistance transporters activate a cytosolic surveillance pathway of innate immunity. Proc Natl Acad Sci U S A 2008;105(29):10191–6. [45] Mata MT, Baquero F, Pérez-Diaz JC. A multidrug efflux transporter in Listeria monocytogenes. FEMS Microbiol Lett 2000;187(2):185–8. [46] Godreuil S, Galimand M, Gerbaud G, Jacquet C, Courvalin P. Efflux pump Lde is associated with fluoroquinolone resistance in Listeria monocytogenes. Antimicrob Agents Chemother 2003;47(2):704–8. [47] Begley M, Hill C, Ross RP. Tolerance of Listeria monocytogenes to cell envelope-acting antimicrobial agents is dependent on SigB. Appl Environ Microbiol 2006;72(3):2231–4. [48] Bergholz TM, Bowen B, Wiedmann M, Boor KJ. Listeria monocytogenes shows temperature dependent and independent responses to salt stress, including responses that induce crossprotection to other stresses. Appl Environ Microbiol 2012;78(8): 2602–12. [49] Renier S, Hébraud M, Desvaux M. Molecular biology of surface colonization by Listeria monocytogenes: an additional facet of an opportunistic Gram-positive foodborne pathogen. Environ Microbiol 2011;13(4):835–50.
Please cite this article in press as: Tamburro M, et al. Gene expression in Listeria monocytogenes exposed to sublethal concentration of benzalkonium chloride. Comp Immunol Microbiol Infect Dis (2015), http://dx.doi.org/10.1016/j.cimid.2015.03.004
