Proc. Natl. Acad. Sci. USA Vol. 89, pp. 2703-2707, April 1992 Biochemistry
Gene expression in Leishmania: Analysis of essential 5' DNA sequences (protozoa/Kinetoplastida/trans-splicing/transcription)
MARIA A. CUROTTO DE LAFAILLE, AVRAHAM LABAN, AND DYANN F. WIRTH* Department of Tropical Public Health, Harvard School of Public Health, 665 Huntington Avenue, Boston, MA 02115
Communicated by Phillips W. Robbins, December 18, 1991
ABSTRACT A major unanswered question in Kinetoplastida parasites is the mechanism of regulating gene expression. Using a transfection system, we have previously shown that the intergenic region of the a-tubulin gene of Leishmania enrieti contained sequences required for gene expression. The goal of the work reported here was to determine whether the Leishmania-derived sequences were providing transcriptional control signals or functioning at a post-transcriptional level, most likely in trans-splicing. The chloramphenicol acetyltransferase (cat) gene was used as the reporter gene and was stably introduced into L. enrketti as part of an extrachromosomal element by transfection. We show here that the production of cat mRNA was dramatically dependent on the presence of the intergenic region 5' to the cat gene. The intergenic region could be substituted by a smaller fragment (222 base pairs) that contained the trans-splice acceptor site and an adjacent polypyrimidine tract. This native fragment could be replaced by a synthetic polypyrimidine tract containing an AG site. The native and the synthetic fragments had unidirectional activity. No effect on transcription of the cat gene by the wild-type fragment or the synthetic polypyrimidine was detected. The results indicate that both regions contain signals that affect RNA stability, probably sequences involved in trans-splicing.
In this work we have studied the role of the intergenic region ofLeishmania enriettii a-tubulin in the control of gene expression. Our main purpose was to determine if the activity of the intergenic region was at the transcriptional or posttranscriptional level and to identify sequences essential for gene expression. The chloramphenicol acetyltransferase (cat) gene (19) was used as the reporter gene and was stably introduced into L. enriettii in an extrachromosomal element by transfection (18). Expression of the cat gene was dependent on the presence of either the native intergenic region or a synthetic polypyrimidine tract and splice acceptor site. The native and synthetic fragments had unidirectional activity, and neither had transcriptional activity. The results indicate that both regions contain signals that affect RNA stability, probably sequences involved in trans-splicing.
MATERIALS AND METHODS Plasmid Construction. Standard cloning techniques were used (20). The structure of the plasmids was determined by restriction analysis and DNA sequence analysis. All plasmids were derivatives of p50. p50 was constructed using plasmids p50-neo and pLCLC. p50-neo contained a 909-base-pair (bp) BstBI fragment from pALT-neo (18) end filled and cloned into the Sma I site of pBluescript KS' (Jim Tobin, personal communication). The insert in pSO-neo contained 50 bp from the 3' end of the a-tubulin intergenic region of L. enriettii (12) and the neomycin-resistance (neor) gene (21). pLCLC contained two copies of the intergenic region of a-tubulin (LT1) and two copies of the cat gene in tandem (5'-LT1-cat-LT1cat-3'). A 1.6-kilobase (kb) BstBI fragment from pLCLC was cloned into the Cla I site of pSO-neo. The resultant plasmid, p5O, contained, in 5' -- 3' order, a 50-bp fragment from the intergenic region of a-tubulin, the cat gene, the intergenic region of a-tubulin, the neor gene, and pBluescript KS' vector. p2-3 was derived by the deletion of the Sma I/HincII fragment from p50. pLCLN was obtained by replacing the Sal I/Sma I fragment from p50 by the intergenic region of a-tubulin (Xho I/Sma I fragment from pALT1.1, ref. 17). pR-S and pS-R were obtained by cloning the Rsa I/Sma I fragment from pALT1.1 into HincII/Sma I-digested p50. The plasmids containing the synthetic polypyrimidine tracts were obtained by insertion of the double-stranded oligonucleotide OPy43 (5 '-CCTCGAGCTCTCTCTCT-
Leishmania are flagellated protozoan parasites of the order Kinetoplastida. Many of the aspects of gene expression and gene regulation in these organisms are still poorly understood. For example, little is known about the relative contributions of transcriptional and post-transcriptional processes to the control of gene expression. A general feature of gene expression in Kinetoplastida organisms is the processing of mRNAs by trans-splicing (refs. 1 and 2; reviewed in ref. 3). Trans-splicing is similar to cis-splicing in its requirement for U2, U4, and U6 (4) and is related to self-splicing of group II introns by its independence of U1 (5). A possible function of trans-splicing in Kinetoplastida organisms is the processing of polycistronic transcripts to create a capped 5' end in the mRNAs (6, 7). Many highly expressed genes in Leishmania and other Kinetoplastida organisms are present in multiple copies organized in tandem repeats-for example, the tubulin genes (8-10). The intergenic regions are short and contain the sites for polyadenylylation of the upstream gene and trans-splicing of the downstream gene (11, 12). Promoters have not yet been identified in Leishmania but because of the hypothesized polycistronic transcription it is likely that the promoters will be located upstream of the tandem arrays (13-16). The development of transfection vectors for Leishmania in which bacterial genes were expressed under the control of intergenic regions from the parasite raised the possibility that these regions could contain signals for transcription (17, 18).
CTTCTTCCCCTCTCCTCTCTCTCTCTCTTCTCCAGACGCGTT-3') upstream from the cat gene. The doublestranded OPy43 fragment was digested with Xho I and cloned into the Sal I/Sma I sites of p50. Alternatively, blunt doublestranded OPy43 was cloned into the HincII/Sma I sites of p5O. Cell Cultures and Transfection. Promastigotes of L. enriettii were grown and transfected as described (18). Trans-
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.
Abbreviations: neor, neomycin-resistance; CAT, chloramphenicol acetyltransferase; SL, spliced leader. *To whom reprint requests should be addressed.
2703
2704
Biochemistry: Curotto de Lafaille et al.
fected cells were grown in medium containing 150 ug of G418 per ml. The presence of the plasmid DNA as a circular extrachromosomal element (episome) in the transfected cell lines was determined by Southern analysis of chromosome gels and standard Southern analysis of restricted DNA (data not shown). No evidence of chromosomal integration was observed. The copy number of plasmid DNA in the transfected cell lines was calculated by comparison of the hybridization signals in Southern blots of the Pst I fragment of the intergenic region of a-tubulin derived from the plasmid with those derived from the chromosomal tandem repeat (p2-3, 93 copies; pLCLN, 62 copies; pR-S, 50 copies; pS-R, 62 copies; p114, 39 copies; pl2n, 56 copies; pl-5, 56 copies; pl-2, 86 copies). The copy number of plasmid DNA has been stable in these transfected cells. CAT Activity. CAT activity was assayed in supernatants of cell lysates (17) using the two-phase fluor-diffusion method (22). The results presented correspond to the CAT activity in lysates containing 3 pg of soluble protein. Analysis of Steady-State RNA. Total RNA and poly(A)+ RNA were obtained as described (12). Northern analysis (20) was performed using either total RNA (8 ,g in Fig. 2 or 1 ,ug in Fig. 3) or poly(A)+ RNA (0.1 ,ug in Fig. 3). cat RNA was detected by hybridization with a 32P-labeled antisense RNA. To detect neor RNA a pool of the following 32P-labeled antisense oligonucleotides was used: NEO 1 (5'-GGGCACCGGACAGGTCGGTCTTGAC-3'), NEO 3 (5'-ACCATGATATTCGGCAAGCAGGCA-3'), NEO 4 (5'-CCGGAGAACCTGCGTGCAATC-3'). A 3-tubulin probe was obtained by random primer labeling of the 800-bp Sal I fragment from pLEB3 (12). Hybridization intensities were quantified in a bio-imaging analyzer, Fujix BAS 2000. Primer extension reactions were performed as described (23). The primers used were CAT 20 (5'-CAACGGTGGTATATCCAGTG-3') and NEO 4 (sequence as above). For the polymerase chain reaction (PCR) analysis of the 5' end of the cat mRNAs 1 ,ug of total RNA was annealed to oligo(dT)12.18 and incubated with avian myeloblastosis virus reverse transcriptase under standard conditions. Onehundredth of the reaction was then used for amplification through the PCR (24) using a primer homologous to the spliced leader (SL) sequence (ME, 5'-AAGCTTAGTATCAGTTTCTGTACT-3'; sequence from ref. 23) and the CAT 20 primer (sequence above). Southern blots of the PCR samples were hybridized to a 32P-labeled internal oligonucleotide (SCAT 61, 5'-ATTTTAGCTTCCTTAGCTCCTG-3'). Direct sequencing of PCR products was performed as described (25). Run-On Transcription Analysis. Nuclei were obtained by lysis of promastigotes in hypotonic buffer (26) with 0.8% Nonidet P-40. Nascent RNA was elongated in vitro as described (26, 27). Incubations of nuclei for RNA elongation were done at 27°C for 5 min. Hybridizations were performed at 42°C as described (26). Radioactivity in the slots was quantified in a Fujix BAS 2000 analyzer. DNA fragments homologous to the coding regions of plasmid or chromosomal genes were obtained by PCR and gel purified. Equimolar amounts of DNA for each fragment were denatured and applied to a nylon filter using a slot blot apparatus (cat and neor, 0.35-kb fragment, 200 ng per slot; a-tubulin, 1-kb fragment, 570 ng per slot; Pro-gl, ref. 28, 0.5-kb fragment, 290 ng per slot; Plasmodium falciparum mdr, ref. 19, 1-kb fragment, 570 ng per slot). Single-stranded sense DNA and antisense DNA were obtained by PCR amplification of specific DNA fragments, followed by A exonuclease treatment (25) and gel purification. The following oligonucleotides were used to generate DNA fragments homologous to the coding regions of cat (19), neor (21), L. enriettii a-tubulin (unpublished sequence, D.F.W.), Pro-gl (28), and mdr from P. falciparum (P.f.) (29): CAT 2, sense
Proc. Natl. Acad. Sci. USA 89 (1992)
(5'-ACCGTTCAGCTGGATATTACGGCCTTT-3'); CAT 3, antisense (5'-CACCCAGGGATTGGCTGAGACGAAAAAC-3'); NEO 2, sense (5'-GCTGTGCTCGACGTTGTCACTGAAG-3'); NEO 3, antisense (as above); ALPHA 3.1, sense (5'-ACAAGTGCATCGGTGTCGAGGATGAC-3'); ALPHA 3.3, antisense (5'-TGTGGTGTTGCTCAGCATACACAC-3');PRO61, sense (5'-GACGGAGACCAGAAGGTGATGG-3'); PRO 71, antisense (5'-ACAGCAGAATGCCGGTGATGG-3'); P.f. mdr 2484, sense (5'-AAAATTAATAATGAGGGT-3'); P.f. mdr 3038, antisense (5'AGTGTTTCTGAAATGAACATAGCAATAGCA-3'); P.f. mdr 510, sense (5'-AGAGAAAAAAGATGGTAACCTCAG3'); P.f. mdr 1487R, antisense (5'-TGGTAAGATAATTGTTAACAT-3'). RESULTS To analyze 5' DNA sequences required for the expression of a foreign gene in Leishmania, we constructed the vector pLCLN. pLCLN contained the neor gene as a selectable marker and the cat gene as the reporter gene. Both genes were flanked at their 5' ends by the intergenic region of a-tubulin (Fig. 1A). pLCLN and the derivative plasmids (Fig. 1) were stably transfected into L. enriettii using conditions that resulted in the extrachromosomal amplification of multimers of the transfected plasmid (18). The number of plasmid copies was determined for each cell line, and expression of neor and cat mRNA in all subsequent experiments was normalized to plasmid copy number in each cell line. We have previously shown that cells transfected with a plasmid that carried the neor gene flanked by a-tubulin intergenic regions produced neor mRNA trans-spliced at the a-tubulin AG acceptor site and polyadenylylated within the a-tubulin intergenic region 3' to the neor gene (18). Plasmid pLCLN does not contain Leishmania sequences immediately 3' to the neor gene. In cells transfected with pLCLN, polyadenylylation of the neor mRNA occurs in a cryptic site within pBluescript, at -600 bp from the polylinker, generating a 1.6-kb mRNA (data not shown). Expression of the neor gene was analyzed for each cell line and compared to the expression of f8-tubulin, a chromosomal gene. (The ratios were as follows: p2-3, 0.82; pLCLN, 1.03; pR-S, 0.84; pS-R, 0.75; p114, 1.39; pl2n, 0.89; pl-5, 1.24; pl-2, 1.00.) The expression of neor mRNA was similar in all cell lines examined. Parasites transfected with pLCLN expressed high levels of CAT activity and 1.5-kb cat mRNA (Fig. 2 A and B). The presence of the a-tubulin intergenic region 5' to the cat gene was essential for expression, since only minimal CAT activity was detected in cells transfected with a plasmid lacking the intergenic region 5' to the cat gene (p2-3, Fig. 2A). CAT activity in cells transfected with pLCLN was -1000-fold higher than in cells transfected with p2-3. Cells transfected with plasmid p2-3 did not express detectable levels of the 1.5-kb cat mRNA (Fig. 2B), whereas the levels of neor mRNA were similar to those observed in cells transfected with pLCLN. Polypyrimidine Fragments Can Substitute for the Intergenic Region 5' to the cat Gene. To determine more precisely what sequences were required for cat expression, plasmids containing insertions of either native or synthetic sequences 5' to the cat gene were transfected into L. enriettii and cat expression was analyzed in the transfected cell lines. Fig. 2 shows that the 222-bp Rsa I-Sma I fragment from the intergenic region (pR-S, Fig. 1A) could replace the complete intergenic region 5' to cat. CAT activity and cat mRNA in parasites transfected with pR-S were expressed at similar levels as those in cells transfected with pLCLN. The effect of the Rsa I-Sma I fragment was unidirectional, since no CAT activity or 1.5-kb cat mRNA was detected in cells
Proc. Natl. Acad. Sci. USA 89 (1992)
Biochemistry: Curotto de Lafaille et al.
2705
B ACat
A
p 1-2
I.
.
I
i
PLCLN -
.
14
cat G AG _p_
p 2n
p2-3
t
IN
p1-5
pR-S 1.--
pS-P
C pLCLN
v .. /TCCCTCTCCCCTCTCCCCGCACACACACGCAGT . /cgggccccccctcgaggTCGAGGGAGG/ CCTTCGCTTTCACTCTTCGAACAAACACCTCAAACCATCTTATCACCTTTCTCTCTTCCTTGTCggggGA
/.
.
mTCCCCCGGGAGCTTGGCGAGATTTTCAGGAGCTAAGGAAGCCTATG/ p2-3 p114
pl2n
...
/
/... /cgggccccccctcgaggtcGGGAGCTTGGCC-AGATTTTCAGGAGCTAAGGAAGCTAAAATG/.
. . /
/... /cgggqcccCcctcgaggTCGAGCTCTCTCTCTCTTCTTCCCCTCTCCTCTCTCTCTCTCTTCTCC AGAACGCGTTCCTCTCCTCTCTCTCTCTCTTCTCCAGACGCGTTGGGAGCTTGGCGAGATTTTCAGGAGC TAAGGAAGCTA AATG/... / /...
/cgggccccccctcgaggtcAACGCGTCTGC-AGAAGAGAGAGAGAGAGGAGAGGGAAGAAGAGAGA
GAGAGCTCGAAACGCGCTCGGAGAAGAGAGAGAGAGAGGAGAGGGGAAGAAGAGAGAGAGAGCTCGAGGG
GAGCTTGGCGAGATTTTCAGG-AGC-iAGGAAGCTA*G ATG/
...
/
FIG. 1. (A) Structure of the plasmids used to transfect L. enriettii. pBluescript sequences are represented by a line; inserts are boxes. Arrows below the DNA fragments indicate the orientation of the cloning. T3 and T7 promoters are shown. The AG splice acceptor site of a-tubulin is shown in plasmid pR-S. S1, Sal I; X, Xho I; R, Rsa I; S, Sma I; E, EcoRI; Sc, Sac I; M, Mlu I; P, Pst I. Restriction sites that were destroyed during the cloning are shown in parentheses. (B) Plasmids containing the synthetic polypyrimidine tract OPy43 (striped box). Restriction sites as in A. The AG site at the 3' end of OPy43 is shown. (C) Sequences upstream of the cat gene in pLCLN and derivative plasmids. The junctions of the 5' end of the
cat gene
and immediate upstream sequences
are
shown. The sequences
are
shown from left to
right in 5'
-.
3' direction.
Sequences derived from pBluescript are shown in lowercase letters, inserts are in uppercase letters, and cat sequences (19) are shaded. Polypyrimidine tracts are in bold type. AG sites that have been identified as trans-splice acceptor sites in this work are underlined. The AG splice acceptor site that is normally used in the a-tubulin gene is indicated by an arrowhead. Gaps in the presented sequence are indicated by /I*
*'/
transfected with a plasmid containing the inverted fragment (pS-R, Figs. 1A and 2). One feature of the 222-bp fragment is the presence of polypyrimidine tracts adjacent to the AG splice acceptor site (ref. 12; see Fig. 1C). We decided to test directly the effect of polypyrimidines on cat expression. A synthetic oligonucleotide containing a run of pyrimidines (OPy43) was cloned 5' to the cat gene. The oligonucleotide also contained an AG dinucleotide at its 3' end. Parasites transfected with plasmids containing a single copy or multiple copies of the synthetic polypyrimidine were found to express CAT activity. Parasites transfected with p114, which contains two polyprimidine tracts of 43 and 26 nucleotides (Fig. 1 A and C), expressed high levels of CAT activity and cat mRNA (Fig. 2 A and B). The effect of the polypyrimidine on cat expression was unidirectional, since parasites transfected with a plasmid containing two inverted copies of the polypyrimidine (pl2n, Fig. 1 B and C) had CAT activity at background levels and no detectable 1.5-kb cat mRNA (Fig. 2 A and B). CAT activity and cat mRNA were compared in cells transfected with plasmids containing one (pl-2), two (p114), or three (pl-5) polypyrimidine tracts (Fig. 1B). The increase in the number of polypyrimidine tracts resulted in an increase in CAT activity and increased expression of cat mRNA in the transfected cell lines (Fig. 3). It is interesting to note that the level of CAT activity was lower in cells transfected with pl-5 than would be predicted based on the amount of mRNA detected. This may indicate a down-regulation of CAT activity when high levels of mRNA are present. The Effect of the Wild-Type 222-bp DNA Fragment and the Polypyrimidine Region on cat Expression Is Post-Transcriptional. Transcriptional elements have not yet been identified
in plasmids containing the intergenic region of a-tubulin. To determine whether the dramatic effect of the 222-bp fragment or the polypyrimidine tract on steady-state cat mRNA levels had a transcriptional component, we analyzed transcription of plasmid DNA in run-on experiments. Labeled nascent RNA from transfected cell lines and control untransfected L. enriettii was hybridized to slot blots containing DNA fragments from the coding regions of plasmid genes (cat and neor), L. enriettii chromosomal genes (a-tubulin and Pro-gl), and a negative control DNA from another organism (P. falciparum mdr). These results (Table 1) demonstrate that total transcription across the cat and the neor genes was similar in transfected cell lines regardless of the presence or the orientation of the active signals 5' to the cat gene. Northern analysis demonstrated the presence of antisense transcripts derived from the transfected DNA (data not shown). Therefore, we decided to analyze transcription from each DNA strand in a subset of the transfected cells. The coding region of the a-tubulin gene was used as a chromosomal control and the P. falciparum mdr gene was used as a negative control. Blots containing single-stranded sense and antisense DNA for the coding regions of plasmid genes cat and neor, L. enriettii chromosomal a-tubulin and P. falciparum mdr, were hybridized to labeled nascent RNA. The results (Table 2) demonstrate that both DNA strands were transcribed in the episomal DNA, whereas transcription was strand specific in the a-tubulin chromosomal gene. The results presented here demonstrate that neither the 222-bp native fragment nor the synthetic polypyrimidine modulates transcription of the cat gene in the episomal elements. Gene Expression Is Associated with the Production of TransSpliced mRNA. The presence and site of addition of the SL
2706
Biochemistry: Curotto de Lafaille et al.
Proc. Natl. Acad. Sci. USA 89 (1992)
A c 4
;s
U El
o0 M X uE
1
2
3
4
5
6
7
Cell lines
..mmmr7---TLLa.
B FIG. 3. CAT activity and cat mRNA in cells transfected with plasmids containing synthetic polypyrimidine tracts 5' to the cat gene. The names of the plasmids used for transfection are indicated. L.e., untransfected L. enriettii. CAT activity shown is normalized to 100 copies of plasmid per cell and represents the mean and standard deviation of three samples. The upper box shows the corresponding 1.5-kb cat RNA band from an autoradiogram of a Northern blot of RNA extracted from the same transfected cell lines. (In a longer exposure, the mRNA band from cells transfected with plasmid pl-2 is visible.) Two sets of the same samples of RNA from transfected cell lines were gel fractionated, transferred to nitrocellulose, and hybridized with probes specific for cat or ,3-tubulin. The 1.5-kb cat mRNA and the 2.2-kb 3-tubulin mRNA bands were quantified. Values for cat mRNA were normalized to 100 copies of plasmid per cell. The ratio of cat mRNA to /-tubulin is shown.
sets
of AG sites alone was not a sufficient signal for trans-splicing. Two sites of SL addition were identified in cat mRNA isolated from cells transfected with plasmid pll4, the major site being the AG located between the two copies of the polypyrimidine fragment and the second one corresponding to the first site downstream of the two polypyrimidine fragments (Fig. 1C). A third downstream splice site was also identified (Fig. 1C). The results demonstrate that trans-spliced cat mRNAs are present in cells expressing high CAT activity and absent in those cell lines with background activity.
presence
FIG. 2. (A) CAT activity in stably transfected L. enriettii. The results shown represent the mean and standard deviation of three samples. Numbers 1-7 indicate the plasmids used for transfection: 1, untransfected L. enriettii (L.e.); 2, p2-3; 3, pLCLN; 4, pR-S; 5, pS-R; 6, p114; 7, pl2n. CAT activity (cpm/min, primary data) determined in supernatants from cell lysates was as follows: 0 (no. 1), 41 ± 3 (no. 2), 39,500 600 (no. 3), 39,600 ± 1800 (no. 4), 0 (no. 5), 25,400 500 (no. 6), 5 1 (no. 7). (B) Northern analysis of cat RNA in transfected cell lines. An autoradiogram of a filter hybridized with a cat-specific antisense riboprobe is shown. Size standards (RNA ladder, Bethesda Research Laboratories) are shown on the left. The number on the right indicates the calculated size of the main cat RNA. Cell lines are as in A. ±
±
±
sequence on cat mRNA were determined by a combination of primer extension and cDNA PCR analysis, which was followed by isolation and sequencing of the PCR products (Fig. 1C and data not shown). cat mRNA was spliced at the native AG acceptor site (Fig. 1C) in cell lines transfected with pLCLN or pR-S or at two downstream alternative AG sites (shown in Fig. 1C). No evidence for trans-spliced cat mRNA was detected in transfected cells that expressed background levels of CAT activity (p2-3, pS-R, and pl2n), despite the presence ofthe alternative AG sites described above. Thus the
DISCUSSION In this work we have studied the role of the intergenic region of the a-tubulin gene of L. enriettii in the control of gene expression. Our goal was to determine whether the activity of the intergenic region was transcriptional or posttranscriptional and to identify sequences essential for gene expression. We showed here that the expression of the bacterial gene cat in stably transfected L. enriettii is dependent on the presence of Leishmania DNA sequences 5' to the gene. Those DNA sequences can be provided either by the full-length intergenic region of a-tubulin, a truncated 222-bp
Table 1. Comparison of transcription in transfected cell lines L.e. p114 pl2n p2-3 pR-S pS-R Blotted DNA 11 ± 8 340 ± 90 520 ± 60 1230 ± 410 890 ± 410 cat 740 200 280 ± 30 16 ± 3 590 ± 30 430 ± 70 420 20 310 ± 50 neor 170 ± 30 85 ± 6 150 ± 10 129 ± 9 130 10 160 ± 20 a-Tubulin 54 ± 7 73 ± 6 34 ± 8 62 ± 9 59 ± 2 40 10 Pro-gl 6 ± 5 0 0 0 1 ± 1 7 ± 6 P.f. mdr Labeled nascent RNA was hybridized to slot blots containing double-stranded DNA fragments homologous to the coding regions of the genes indicated in the first column. Expression of cat and neor genes was normalized to 100 copies of plasmid per cell. No correction was made for a-tubulin, Pro-gl, or P. falciparum (P.f.) mdr values. The numbers shown are photo luminescence units in a 34-mm2 area per 350 bp of blotted DNA. Values are expressed as mean ± SD of three filters. L.e., untransfected cells.
Biochemistry: Curotto de Lafaille et A Table 2. Bidirectional transcription of plasmid DNA in transfected cells Blotted DNA Strand pR-S pl-5 p2-3 L.e. + cat 254 1063 156 85 213 405 114 38 + neor 219 675 154 34 195 494 287 27 + a-Tubulin 121 425 123 446 2 3 55 0 + P.f. mdr 0 0 0 16 0 0 0 13 Labeled nascent RNA was hybridized to slot blots containing single-stranded DNA homologous to the coding regions of the genes indicated in the first column. P.f., P. falciparum. The hybridization signals were quantified. Expression of cat and neor genes was normalized to 100 copies ofplasmid per cell. No correction was made for a-tubulin. L.e., untransfected cells. Units as in Table 1.
fragment from the same region containing the AG trans-splice acceptor site, or a synthetic polypyrimidine tract. The native 222-bp fragment and the synthetic polypyrimidine behaved similarly in that they led to the expression of high levels of cat mRNA, their activity was unidirectional, and neither affected transcription of the cat gene. From these results we conclude that these regions contain signals that modulate RNA stability. Because of the 5' location of the signals, their proximity to the AG acceptor site, and the association of the signals with the production of trans-spliced mRNA, it seems that the most probable function of these sequences is to participate in trans-splicing. These results also imply that trans-splicing efficiency may play a major role in controlling mRNA levels. Our results suggest that unspliced pre-mRNA is unstable, in agreement with a previous report (4) of unstable pre-mRNA in experiments in which trans-splicing was inhibited. We have shown here that a polypyrimidine tract and adjacent AG site 5' to the cat gene were sufficient to produce trans-spliced mRNA. Our results do not preclude the participation of other signals but indicate that other sequences are probably not essential for trans-splicing. Polypyrimidine tracts are essential elements of the splice acceptor site of mammalian introns, in which they participate in the formation of the presplicing complex and the binding of U2 (reviewed in refs. 30 and 31). Our results point to a possible similarity between cis- and trans-splicing in the determination of the splice acceptor site. The demonstration of a post-transcriptional effect of the DNA signals described here still leaves open the question of the existence and location of transcriptional elements in these extrachromosomal elements. Transcription of the plasmid DNA is bidirectional, in contrast to the unidirectional transcription observed in the chromosomal a-tubulin gene. The results indicate that different elements control transcription in both cases. Since no difference in transcription was observed between plasmids containing or lacking sequences of the intergenic region 5' to the cat gene, it seems unlikely that the intergenic region of a-tubulin contains transcriptional signals. However, the presence of a weak promoter in the intergenic region cannot be ruled out. In this report, we have identified DNA sequences that are essential for gene expression in the protozoan parasite L. enriettii and we have determined that those sequences participate in trans-splicing. The knowledge of the factors that
Proc. Natl. Acad. Sci. USA 89 (1992)
2707
control gene expression in these organisms is necessary for the development of molecular tools to study the genetic basis of infectivity and pathogenesis. We thank Dr. Susumu Tonegawa for the use of the Fujix bioimaging analyzer, Sarah Volkman for materials, and Ramona Gonski for help in the preparation of this manuscript. This work has been supported by a grant from John D. and Catherine T. MacArthur Foundation and National Institutes of Health Grant A121365-05 (to D.F.W.). D.F.W. is a Burroughs Wellcome Scholar in molecular parasitology. 1. Sutton, R. E. & Boothroyd, J. C. (1986) Cell 47, 527-535. 2. Murphy, W. J., Watkins, K. P. & Agabian, N. (1986) Cell 47, 517-525. 3. Agabian, N. (1990) Cell 61, 1157-1160. 4. Tschudi, C. & Ullu, E. (1990) Cell 61, 459-466. 5. Bruzic, J. P. & Steitz, J. (1990) Cell 62, 889-899. 6. Borst, P. (1986) Annu. Rev. Biochem. 55, 701-732. 7. Laird, P. W. (1989) Trends Genet. 5, 204-208. 8. Landfear, S. M., McMahan-Pratt, D. & Wirth, D. F. (1983) Mol. Cell. Biol. 3, 1070-1076. 9. Seebeck, T., Whittaker, P. A., Imboden, M., Hardman, N. & Brown, R. (1983) Proc. Natd. Acad. Sci. USA 80, 4634-4638. 10. Tomashow, L. S., Milhausen, M., Rutter, W. J. & Agabian, N. (1983) Cell 32, 35-43. 11. Sather, S. & Agabian, N. (1985) Proc. Natl. Acad. Sci. USA 82, 5695-5699. 12. Landfear, S. M., Miller, S. I. & Wirth, D. F. (1986) Mol. Biochem. Parasitol. 21, 235-245. 13. Gonzalez, A., Lerner, T. J., Huecas, M., Sosa-Pineda, B., Nogueira, N. & Lizardi, P. (1985) Nucleic Acids Res. 13, 5789-5804. 14. Johnson, P. J., Kooter, J. M. & Borst, P. (1987) Cell 51, 273-281. 15. Imboden, M. A., Laird, P. W., Affolter, M. & Seebeck, T. (1987) Nucleic Acids Res. 15, 7357-7368. 16. Muhich, M. L. & Boothroyd, J. C. (1988) Mol. Cell. Biol. 8, 3837-3846. 17. Laban, A. & Wirth, D. F. (1989) Proc. Natl. Acad. Sci. USA 86, 9119-9123. 18. Laban, A., Tobin, J. F., Curotto de Lafaille, M. A. & Wirth, D. F. (1990) Nature (London) 343, 572-574. 19. Hadfiel, C., Cashmore, A. M. & Meacock, P. A. (1987) Gene 52, 59-70. 20. Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Lab., Cold Spring Harbor, NY), 2nd Ed. 21. Beck, E., Ludwig, G., Auerswald, E. A., Reiss, B. & Schaller, H. (1982) Gene 19, 327-336. 22. Neuman, J. R., Morency, C. A. & Russian, K. 0. (1987) BioTechnics 5, 444-447. 23. Miller, S. I., Landfear, S. M. & Wirth, D. F. (1986) Nucleic Acids Res. 14, 7341-7360. 24. Saiki, R. K., Bugawan, T. L., Horn, G. T., Mullis, K. B. & Erlich, H. A. (1986) Nature (London) 324, 163-166. 25. Higuchi, R. G. & Ochman, H. (1989) Nucleic Acids Res. 17, 5865. 26. Kooter, J. M., van der Spek, H. J., Wagter, R., d'Oliveira, C. E., van der Hoeven, F., Johnson, P. J. & Borst, P. (1987) Cell 51, 261-272. 27. Grondal, E. G. M., Evers, R., Kosubek, K. & Cornelissen, A. W. C. A. (1989) EMBO J. 8, 3383-3389. 28. Cairns, B. R., Collard, M. W. & Landfear, S. M. (1989) Proc. Natl. Acad. Sci. USA 86, 7682-7686. 29. Foote, S. J., Thompson, J. K., Cowman, A. F. & Kemp, D. J. (1991) Cell 57, 921-930. 30. Padgett, R. A., Grabowski, P., Konarska, M. M., Seiler, S. & Sharp, P. (1986) Annu. Rev. Biochem. 55, 1119-1150. 31. Green, M. R. (1986) Annu. Rev. Genet. 20, 671-708.
Gene expression in Leishmania: Analysis of essential 5' DNA sequences (protozoa/Kinetoplastida/trans-splicing/transcription)
MARIA A. CUROTTO DE LAFAILLE, AVRAHAM LABAN, AND DYANN F. WIRTH* Department of Tropical Public Health, Harvard School of Public Health, 665 Huntington Avenue, Boston, MA 02115
Communicated by Phillips W. Robbins, December 18, 1991
ABSTRACT A major unanswered question in Kinetoplastida parasites is the mechanism of regulating gene expression. Using a transfection system, we have previously shown that the intergenic region of the a-tubulin gene of Leishmania enrieti contained sequences required for gene expression. The goal of the work reported here was to determine whether the Leishmania-derived sequences were providing transcriptional control signals or functioning at a post-transcriptional level, most likely in trans-splicing. The chloramphenicol acetyltransferase (cat) gene was used as the reporter gene and was stably introduced into L. enrketti as part of an extrachromosomal element by transfection. We show here that the production of cat mRNA was dramatically dependent on the presence of the intergenic region 5' to the cat gene. The intergenic region could be substituted by a smaller fragment (222 base pairs) that contained the trans-splice acceptor site and an adjacent polypyrimidine tract. This native fragment could be replaced by a synthetic polypyrimidine tract containing an AG site. The native and the synthetic fragments had unidirectional activity. No effect on transcription of the cat gene by the wild-type fragment or the synthetic polypyrimidine was detected. The results indicate that both regions contain signals that affect RNA stability, probably sequences involved in trans-splicing.
In this work we have studied the role of the intergenic region ofLeishmania enriettii a-tubulin in the control of gene expression. Our main purpose was to determine if the activity of the intergenic region was at the transcriptional or posttranscriptional level and to identify sequences essential for gene expression. The chloramphenicol acetyltransferase (cat) gene (19) was used as the reporter gene and was stably introduced into L. enriettii in an extrachromosomal element by transfection (18). Expression of the cat gene was dependent on the presence of either the native intergenic region or a synthetic polypyrimidine tract and splice acceptor site. The native and synthetic fragments had unidirectional activity, and neither had transcriptional activity. The results indicate that both regions contain signals that affect RNA stability, probably sequences involved in trans-splicing.
MATERIALS AND METHODS Plasmid Construction. Standard cloning techniques were used (20). The structure of the plasmids was determined by restriction analysis and DNA sequence analysis. All plasmids were derivatives of p50. p50 was constructed using plasmids p50-neo and pLCLC. p50-neo contained a 909-base-pair (bp) BstBI fragment from pALT-neo (18) end filled and cloned into the Sma I site of pBluescript KS' (Jim Tobin, personal communication). The insert in pSO-neo contained 50 bp from the 3' end of the a-tubulin intergenic region of L. enriettii (12) and the neomycin-resistance (neor) gene (21). pLCLC contained two copies of the intergenic region of a-tubulin (LT1) and two copies of the cat gene in tandem (5'-LT1-cat-LT1cat-3'). A 1.6-kilobase (kb) BstBI fragment from pLCLC was cloned into the Cla I site of pSO-neo. The resultant plasmid, p5O, contained, in 5' -- 3' order, a 50-bp fragment from the intergenic region of a-tubulin, the cat gene, the intergenic region of a-tubulin, the neor gene, and pBluescript KS' vector. p2-3 was derived by the deletion of the Sma I/HincII fragment from p50. pLCLN was obtained by replacing the Sal I/Sma I fragment from p50 by the intergenic region of a-tubulin (Xho I/Sma I fragment from pALT1.1, ref. 17). pR-S and pS-R were obtained by cloning the Rsa I/Sma I fragment from pALT1.1 into HincII/Sma I-digested p50. The plasmids containing the synthetic polypyrimidine tracts were obtained by insertion of the double-stranded oligonucleotide OPy43 (5 '-CCTCGAGCTCTCTCTCT-
Leishmania are flagellated protozoan parasites of the order Kinetoplastida. Many of the aspects of gene expression and gene regulation in these organisms are still poorly understood. For example, little is known about the relative contributions of transcriptional and post-transcriptional processes to the control of gene expression. A general feature of gene expression in Kinetoplastida organisms is the processing of mRNAs by trans-splicing (refs. 1 and 2; reviewed in ref. 3). Trans-splicing is similar to cis-splicing in its requirement for U2, U4, and U6 (4) and is related to self-splicing of group II introns by its independence of U1 (5). A possible function of trans-splicing in Kinetoplastida organisms is the processing of polycistronic transcripts to create a capped 5' end in the mRNAs (6, 7). Many highly expressed genes in Leishmania and other Kinetoplastida organisms are present in multiple copies organized in tandem repeats-for example, the tubulin genes (8-10). The intergenic regions are short and contain the sites for polyadenylylation of the upstream gene and trans-splicing of the downstream gene (11, 12). Promoters have not yet been identified in Leishmania but because of the hypothesized polycistronic transcription it is likely that the promoters will be located upstream of the tandem arrays (13-16). The development of transfection vectors for Leishmania in which bacterial genes were expressed under the control of intergenic regions from the parasite raised the possibility that these regions could contain signals for transcription (17, 18).
CTTCTTCCCCTCTCCTCTCTCTCTCTCTTCTCCAGACGCGTT-3') upstream from the cat gene. The doublestranded OPy43 fragment was digested with Xho I and cloned into the Sal I/Sma I sites of p50. Alternatively, blunt doublestranded OPy43 was cloned into the HincII/Sma I sites of p5O. Cell Cultures and Transfection. Promastigotes of L. enriettii were grown and transfected as described (18). Trans-
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.
Abbreviations: neor, neomycin-resistance; CAT, chloramphenicol acetyltransferase; SL, spliced leader. *To whom reprint requests should be addressed.
2703
2704
Biochemistry: Curotto de Lafaille et al.
fected cells were grown in medium containing 150 ug of G418 per ml. The presence of the plasmid DNA as a circular extrachromosomal element (episome) in the transfected cell lines was determined by Southern analysis of chromosome gels and standard Southern analysis of restricted DNA (data not shown). No evidence of chromosomal integration was observed. The copy number of plasmid DNA in the transfected cell lines was calculated by comparison of the hybridization signals in Southern blots of the Pst I fragment of the intergenic region of a-tubulin derived from the plasmid with those derived from the chromosomal tandem repeat (p2-3, 93 copies; pLCLN, 62 copies; pR-S, 50 copies; pS-R, 62 copies; p114, 39 copies; pl2n, 56 copies; pl-5, 56 copies; pl-2, 86 copies). The copy number of plasmid DNA has been stable in these transfected cells. CAT Activity. CAT activity was assayed in supernatants of cell lysates (17) using the two-phase fluor-diffusion method (22). The results presented correspond to the CAT activity in lysates containing 3 pg of soluble protein. Analysis of Steady-State RNA. Total RNA and poly(A)+ RNA were obtained as described (12). Northern analysis (20) was performed using either total RNA (8 ,g in Fig. 2 or 1 ,ug in Fig. 3) or poly(A)+ RNA (0.1 ,ug in Fig. 3). cat RNA was detected by hybridization with a 32P-labeled antisense RNA. To detect neor RNA a pool of the following 32P-labeled antisense oligonucleotides was used: NEO 1 (5'-GGGCACCGGACAGGTCGGTCTTGAC-3'), NEO 3 (5'-ACCATGATATTCGGCAAGCAGGCA-3'), NEO 4 (5'-CCGGAGAACCTGCGTGCAATC-3'). A 3-tubulin probe was obtained by random primer labeling of the 800-bp Sal I fragment from pLEB3 (12). Hybridization intensities were quantified in a bio-imaging analyzer, Fujix BAS 2000. Primer extension reactions were performed as described (23). The primers used were CAT 20 (5'-CAACGGTGGTATATCCAGTG-3') and NEO 4 (sequence as above). For the polymerase chain reaction (PCR) analysis of the 5' end of the cat mRNAs 1 ,ug of total RNA was annealed to oligo(dT)12.18 and incubated with avian myeloblastosis virus reverse transcriptase under standard conditions. Onehundredth of the reaction was then used for amplification through the PCR (24) using a primer homologous to the spliced leader (SL) sequence (ME, 5'-AAGCTTAGTATCAGTTTCTGTACT-3'; sequence from ref. 23) and the CAT 20 primer (sequence above). Southern blots of the PCR samples were hybridized to a 32P-labeled internal oligonucleotide (SCAT 61, 5'-ATTTTAGCTTCCTTAGCTCCTG-3'). Direct sequencing of PCR products was performed as described (25). Run-On Transcription Analysis. Nuclei were obtained by lysis of promastigotes in hypotonic buffer (26) with 0.8% Nonidet P-40. Nascent RNA was elongated in vitro as described (26, 27). Incubations of nuclei for RNA elongation were done at 27°C for 5 min. Hybridizations were performed at 42°C as described (26). Radioactivity in the slots was quantified in a Fujix BAS 2000 analyzer. DNA fragments homologous to the coding regions of plasmid or chromosomal genes were obtained by PCR and gel purified. Equimolar amounts of DNA for each fragment were denatured and applied to a nylon filter using a slot blot apparatus (cat and neor, 0.35-kb fragment, 200 ng per slot; a-tubulin, 1-kb fragment, 570 ng per slot; Pro-gl, ref. 28, 0.5-kb fragment, 290 ng per slot; Plasmodium falciparum mdr, ref. 19, 1-kb fragment, 570 ng per slot). Single-stranded sense DNA and antisense DNA were obtained by PCR amplification of specific DNA fragments, followed by A exonuclease treatment (25) and gel purification. The following oligonucleotides were used to generate DNA fragments homologous to the coding regions of cat (19), neor (21), L. enriettii a-tubulin (unpublished sequence, D.F.W.), Pro-gl (28), and mdr from P. falciparum (P.f.) (29): CAT 2, sense
Proc. Natl. Acad. Sci. USA 89 (1992)
(5'-ACCGTTCAGCTGGATATTACGGCCTTT-3'); CAT 3, antisense (5'-CACCCAGGGATTGGCTGAGACGAAAAAC-3'); NEO 2, sense (5'-GCTGTGCTCGACGTTGTCACTGAAG-3'); NEO 3, antisense (as above); ALPHA 3.1, sense (5'-ACAAGTGCATCGGTGTCGAGGATGAC-3'); ALPHA 3.3, antisense (5'-TGTGGTGTTGCTCAGCATACACAC-3');PRO61, sense (5'-GACGGAGACCAGAAGGTGATGG-3'); PRO 71, antisense (5'-ACAGCAGAATGCCGGTGATGG-3'); P.f. mdr 2484, sense (5'-AAAATTAATAATGAGGGT-3'); P.f. mdr 3038, antisense (5'AGTGTTTCTGAAATGAACATAGCAATAGCA-3'); P.f. mdr 510, sense (5'-AGAGAAAAAAGATGGTAACCTCAG3'); P.f. mdr 1487R, antisense (5'-TGGTAAGATAATTGTTAACAT-3'). RESULTS To analyze 5' DNA sequences required for the expression of a foreign gene in Leishmania, we constructed the vector pLCLN. pLCLN contained the neor gene as a selectable marker and the cat gene as the reporter gene. Both genes were flanked at their 5' ends by the intergenic region of a-tubulin (Fig. 1A). pLCLN and the derivative plasmids (Fig. 1) were stably transfected into L. enriettii using conditions that resulted in the extrachromosomal amplification of multimers of the transfected plasmid (18). The number of plasmid copies was determined for each cell line, and expression of neor and cat mRNA in all subsequent experiments was normalized to plasmid copy number in each cell line. We have previously shown that cells transfected with a plasmid that carried the neor gene flanked by a-tubulin intergenic regions produced neor mRNA trans-spliced at the a-tubulin AG acceptor site and polyadenylylated within the a-tubulin intergenic region 3' to the neor gene (18). Plasmid pLCLN does not contain Leishmania sequences immediately 3' to the neor gene. In cells transfected with pLCLN, polyadenylylation of the neor mRNA occurs in a cryptic site within pBluescript, at -600 bp from the polylinker, generating a 1.6-kb mRNA (data not shown). Expression of the neor gene was analyzed for each cell line and compared to the expression of f8-tubulin, a chromosomal gene. (The ratios were as follows: p2-3, 0.82; pLCLN, 1.03; pR-S, 0.84; pS-R, 0.75; p114, 1.39; pl2n, 0.89; pl-5, 1.24; pl-2, 1.00.) The expression of neor mRNA was similar in all cell lines examined. Parasites transfected with pLCLN expressed high levels of CAT activity and 1.5-kb cat mRNA (Fig. 2 A and B). The presence of the a-tubulin intergenic region 5' to the cat gene was essential for expression, since only minimal CAT activity was detected in cells transfected with a plasmid lacking the intergenic region 5' to the cat gene (p2-3, Fig. 2A). CAT activity in cells transfected with pLCLN was -1000-fold higher than in cells transfected with p2-3. Cells transfected with plasmid p2-3 did not express detectable levels of the 1.5-kb cat mRNA (Fig. 2B), whereas the levels of neor mRNA were similar to those observed in cells transfected with pLCLN. Polypyrimidine Fragments Can Substitute for the Intergenic Region 5' to the cat Gene. To determine more precisely what sequences were required for cat expression, plasmids containing insertions of either native or synthetic sequences 5' to the cat gene were transfected into L. enriettii and cat expression was analyzed in the transfected cell lines. Fig. 2 shows that the 222-bp Rsa I-Sma I fragment from the intergenic region (pR-S, Fig. 1A) could replace the complete intergenic region 5' to cat. CAT activity and cat mRNA in parasites transfected with pR-S were expressed at similar levels as those in cells transfected with pLCLN. The effect of the Rsa I-Sma I fragment was unidirectional, since no CAT activity or 1.5-kb cat mRNA was detected in cells
Proc. Natl. Acad. Sci. USA 89 (1992)
Biochemistry: Curotto de Lafaille et al.
2705
B ACat
A
p 1-2
I.
.
I
i
PLCLN -
.
14
cat G AG _p_
p 2n
p2-3
t
IN
p1-5
pR-S 1.--
pS-P
C pLCLN
v .. /TCCCTCTCCCCTCTCCCCGCACACACACGCAGT . /cgggccccccctcgaggTCGAGGGAGG/ CCTTCGCTTTCACTCTTCGAACAAACACCTCAAACCATCTTATCACCTTTCTCTCTTCCTTGTCggggGA
/.
.
mTCCCCCGGGAGCTTGGCGAGATTTTCAGGAGCTAAGGAAGCCTATG/ p2-3 p114
pl2n
...
/
/... /cgggccccccctcgaggtcGGGAGCTTGGCC-AGATTTTCAGGAGCTAAGGAAGCTAAAATG/.
. . /
/... /cgggqcccCcctcgaggTCGAGCTCTCTCTCTCTTCTTCCCCTCTCCTCTCTCTCTCTCTTCTCC AGAACGCGTTCCTCTCCTCTCTCTCTCTCTTCTCCAGACGCGTTGGGAGCTTGGCGAGATTTTCAGGAGC TAAGGAAGCTA AATG/... / /...
/cgggccccccctcgaggtcAACGCGTCTGC-AGAAGAGAGAGAGAGAGGAGAGGGAAGAAGAGAGA
GAGAGCTCGAAACGCGCTCGGAGAAGAGAGAGAGAGAGGAGAGGGGAAGAAGAGAGAGAGAGCTCGAGGG
GAGCTTGGCGAGATTTTCAGG-AGC-iAGGAAGCTA*G ATG/
...
/
FIG. 1. (A) Structure of the plasmids used to transfect L. enriettii. pBluescript sequences are represented by a line; inserts are boxes. Arrows below the DNA fragments indicate the orientation of the cloning. T3 and T7 promoters are shown. The AG splice acceptor site of a-tubulin is shown in plasmid pR-S. S1, Sal I; X, Xho I; R, Rsa I; S, Sma I; E, EcoRI; Sc, Sac I; M, Mlu I; P, Pst I. Restriction sites that were destroyed during the cloning are shown in parentheses. (B) Plasmids containing the synthetic polypyrimidine tract OPy43 (striped box). Restriction sites as in A. The AG site at the 3' end of OPy43 is shown. (C) Sequences upstream of the cat gene in pLCLN and derivative plasmids. The junctions of the 5' end of the
cat gene
and immediate upstream sequences
are
shown. The sequences
are
shown from left to
right in 5'
-.
3' direction.
Sequences derived from pBluescript are shown in lowercase letters, inserts are in uppercase letters, and cat sequences (19) are shaded. Polypyrimidine tracts are in bold type. AG sites that have been identified as trans-splice acceptor sites in this work are underlined. The AG splice acceptor site that is normally used in the a-tubulin gene is indicated by an arrowhead. Gaps in the presented sequence are indicated by /I*
*'/
transfected with a plasmid containing the inverted fragment (pS-R, Figs. 1A and 2). One feature of the 222-bp fragment is the presence of polypyrimidine tracts adjacent to the AG splice acceptor site (ref. 12; see Fig. 1C). We decided to test directly the effect of polypyrimidines on cat expression. A synthetic oligonucleotide containing a run of pyrimidines (OPy43) was cloned 5' to the cat gene. The oligonucleotide also contained an AG dinucleotide at its 3' end. Parasites transfected with plasmids containing a single copy or multiple copies of the synthetic polypyrimidine were found to express CAT activity. Parasites transfected with p114, which contains two polyprimidine tracts of 43 and 26 nucleotides (Fig. 1 A and C), expressed high levels of CAT activity and cat mRNA (Fig. 2 A and B). The effect of the polypyrimidine on cat expression was unidirectional, since parasites transfected with a plasmid containing two inverted copies of the polypyrimidine (pl2n, Fig. 1 B and C) had CAT activity at background levels and no detectable 1.5-kb cat mRNA (Fig. 2 A and B). CAT activity and cat mRNA were compared in cells transfected with plasmids containing one (pl-2), two (p114), or three (pl-5) polypyrimidine tracts (Fig. 1B). The increase in the number of polypyrimidine tracts resulted in an increase in CAT activity and increased expression of cat mRNA in the transfected cell lines (Fig. 3). It is interesting to note that the level of CAT activity was lower in cells transfected with pl-5 than would be predicted based on the amount of mRNA detected. This may indicate a down-regulation of CAT activity when high levels of mRNA are present. The Effect of the Wild-Type 222-bp DNA Fragment and the Polypyrimidine Region on cat Expression Is Post-Transcriptional. Transcriptional elements have not yet been identified
in plasmids containing the intergenic region of a-tubulin. To determine whether the dramatic effect of the 222-bp fragment or the polypyrimidine tract on steady-state cat mRNA levels had a transcriptional component, we analyzed transcription of plasmid DNA in run-on experiments. Labeled nascent RNA from transfected cell lines and control untransfected L. enriettii was hybridized to slot blots containing DNA fragments from the coding regions of plasmid genes (cat and neor), L. enriettii chromosomal genes (a-tubulin and Pro-gl), and a negative control DNA from another organism (P. falciparum mdr). These results (Table 1) demonstrate that total transcription across the cat and the neor genes was similar in transfected cell lines regardless of the presence or the orientation of the active signals 5' to the cat gene. Northern analysis demonstrated the presence of antisense transcripts derived from the transfected DNA (data not shown). Therefore, we decided to analyze transcription from each DNA strand in a subset of the transfected cells. The coding region of the a-tubulin gene was used as a chromosomal control and the P. falciparum mdr gene was used as a negative control. Blots containing single-stranded sense and antisense DNA for the coding regions of plasmid genes cat and neor, L. enriettii chromosomal a-tubulin and P. falciparum mdr, were hybridized to labeled nascent RNA. The results (Table 2) demonstrate that both DNA strands were transcribed in the episomal DNA, whereas transcription was strand specific in the a-tubulin chromosomal gene. The results presented here demonstrate that neither the 222-bp native fragment nor the synthetic polypyrimidine modulates transcription of the cat gene in the episomal elements. Gene Expression Is Associated with the Production of TransSpliced mRNA. The presence and site of addition of the SL
2706
Biochemistry: Curotto de Lafaille et al.
Proc. Natl. Acad. Sci. USA 89 (1992)
A c 4
;s
U El
o0 M X uE
1
2
3
4
5
6
7
Cell lines
..mmmr7---TLLa.
B FIG. 3. CAT activity and cat mRNA in cells transfected with plasmids containing synthetic polypyrimidine tracts 5' to the cat gene. The names of the plasmids used for transfection are indicated. L.e., untransfected L. enriettii. CAT activity shown is normalized to 100 copies of plasmid per cell and represents the mean and standard deviation of three samples. The upper box shows the corresponding 1.5-kb cat RNA band from an autoradiogram of a Northern blot of RNA extracted from the same transfected cell lines. (In a longer exposure, the mRNA band from cells transfected with plasmid pl-2 is visible.) Two sets of the same samples of RNA from transfected cell lines were gel fractionated, transferred to nitrocellulose, and hybridized with probes specific for cat or ,3-tubulin. The 1.5-kb cat mRNA and the 2.2-kb 3-tubulin mRNA bands were quantified. Values for cat mRNA were normalized to 100 copies of plasmid per cell. The ratio of cat mRNA to /-tubulin is shown.
sets
of AG sites alone was not a sufficient signal for trans-splicing. Two sites of SL addition were identified in cat mRNA isolated from cells transfected with plasmid pll4, the major site being the AG located between the two copies of the polypyrimidine fragment and the second one corresponding to the first site downstream of the two polypyrimidine fragments (Fig. 1C). A third downstream splice site was also identified (Fig. 1C). The results demonstrate that trans-spliced cat mRNAs are present in cells expressing high CAT activity and absent in those cell lines with background activity.
presence
FIG. 2. (A) CAT activity in stably transfected L. enriettii. The results shown represent the mean and standard deviation of three samples. Numbers 1-7 indicate the plasmids used for transfection: 1, untransfected L. enriettii (L.e.); 2, p2-3; 3, pLCLN; 4, pR-S; 5, pS-R; 6, p114; 7, pl2n. CAT activity (cpm/min, primary data) determined in supernatants from cell lysates was as follows: 0 (no. 1), 41 ± 3 (no. 2), 39,500 600 (no. 3), 39,600 ± 1800 (no. 4), 0 (no. 5), 25,400 500 (no. 6), 5 1 (no. 7). (B) Northern analysis of cat RNA in transfected cell lines. An autoradiogram of a filter hybridized with a cat-specific antisense riboprobe is shown. Size standards (RNA ladder, Bethesda Research Laboratories) are shown on the left. The number on the right indicates the calculated size of the main cat RNA. Cell lines are as in A. ±
±
±
sequence on cat mRNA were determined by a combination of primer extension and cDNA PCR analysis, which was followed by isolation and sequencing of the PCR products (Fig. 1C and data not shown). cat mRNA was spliced at the native AG acceptor site (Fig. 1C) in cell lines transfected with pLCLN or pR-S or at two downstream alternative AG sites (shown in Fig. 1C). No evidence for trans-spliced cat mRNA was detected in transfected cells that expressed background levels of CAT activity (p2-3, pS-R, and pl2n), despite the presence ofthe alternative AG sites described above. Thus the
DISCUSSION In this work we have studied the role of the intergenic region of the a-tubulin gene of L. enriettii in the control of gene expression. Our goal was to determine whether the activity of the intergenic region was transcriptional or posttranscriptional and to identify sequences essential for gene expression. We showed here that the expression of the bacterial gene cat in stably transfected L. enriettii is dependent on the presence of Leishmania DNA sequences 5' to the gene. Those DNA sequences can be provided either by the full-length intergenic region of a-tubulin, a truncated 222-bp
Table 1. Comparison of transcription in transfected cell lines L.e. p114 pl2n p2-3 pR-S pS-R Blotted DNA 11 ± 8 340 ± 90 520 ± 60 1230 ± 410 890 ± 410 cat 740 200 280 ± 30 16 ± 3 590 ± 30 430 ± 70 420 20 310 ± 50 neor 170 ± 30 85 ± 6 150 ± 10 129 ± 9 130 10 160 ± 20 a-Tubulin 54 ± 7 73 ± 6 34 ± 8 62 ± 9 59 ± 2 40 10 Pro-gl 6 ± 5 0 0 0 1 ± 1 7 ± 6 P.f. mdr Labeled nascent RNA was hybridized to slot blots containing double-stranded DNA fragments homologous to the coding regions of the genes indicated in the first column. Expression of cat and neor genes was normalized to 100 copies of plasmid per cell. No correction was made for a-tubulin, Pro-gl, or P. falciparum (P.f.) mdr values. The numbers shown are photo luminescence units in a 34-mm2 area per 350 bp of blotted DNA. Values are expressed as mean ± SD of three filters. L.e., untransfected cells.
Biochemistry: Curotto de Lafaille et A Table 2. Bidirectional transcription of plasmid DNA in transfected cells Blotted DNA Strand pR-S pl-5 p2-3 L.e. + cat 254 1063 156 85 213 405 114 38 + neor 219 675 154 34 195 494 287 27 + a-Tubulin 121 425 123 446 2 3 55 0 + P.f. mdr 0 0 0 16 0 0 0 13 Labeled nascent RNA was hybridized to slot blots containing single-stranded DNA homologous to the coding regions of the genes indicated in the first column. P.f., P. falciparum. The hybridization signals were quantified. Expression of cat and neor genes was normalized to 100 copies ofplasmid per cell. No correction was made for a-tubulin. L.e., untransfected cells. Units as in Table 1.
fragment from the same region containing the AG trans-splice acceptor site, or a synthetic polypyrimidine tract. The native 222-bp fragment and the synthetic polypyrimidine behaved similarly in that they led to the expression of high levels of cat mRNA, their activity was unidirectional, and neither affected transcription of the cat gene. From these results we conclude that these regions contain signals that modulate RNA stability. Because of the 5' location of the signals, their proximity to the AG acceptor site, and the association of the signals with the production of trans-spliced mRNA, it seems that the most probable function of these sequences is to participate in trans-splicing. These results also imply that trans-splicing efficiency may play a major role in controlling mRNA levels. Our results suggest that unspliced pre-mRNA is unstable, in agreement with a previous report (4) of unstable pre-mRNA in experiments in which trans-splicing was inhibited. We have shown here that a polypyrimidine tract and adjacent AG site 5' to the cat gene were sufficient to produce trans-spliced mRNA. Our results do not preclude the participation of other signals but indicate that other sequences are probably not essential for trans-splicing. Polypyrimidine tracts are essential elements of the splice acceptor site of mammalian introns, in which they participate in the formation of the presplicing complex and the binding of U2 (reviewed in refs. 30 and 31). Our results point to a possible similarity between cis- and trans-splicing in the determination of the splice acceptor site. The demonstration of a post-transcriptional effect of the DNA signals described here still leaves open the question of the existence and location of transcriptional elements in these extrachromosomal elements. Transcription of the plasmid DNA is bidirectional, in contrast to the unidirectional transcription observed in the chromosomal a-tubulin gene. The results indicate that different elements control transcription in both cases. Since no difference in transcription was observed between plasmids containing or lacking sequences of the intergenic region 5' to the cat gene, it seems unlikely that the intergenic region of a-tubulin contains transcriptional signals. However, the presence of a weak promoter in the intergenic region cannot be ruled out. In this report, we have identified DNA sequences that are essential for gene expression in the protozoan parasite L. enriettii and we have determined that those sequences participate in trans-splicing. The knowledge of the factors that
Proc. Natl. Acad. Sci. USA 89 (1992)
2707
control gene expression in these organisms is necessary for the development of molecular tools to study the genetic basis of infectivity and pathogenesis. We thank Dr. Susumu Tonegawa for the use of the Fujix bioimaging analyzer, Sarah Volkman for materials, and Ramona Gonski for help in the preparation of this manuscript. This work has been supported by a grant from John D. and Catherine T. MacArthur Foundation and National Institutes of Health Grant A121365-05 (to D.F.W.). D.F.W. is a Burroughs Wellcome Scholar in molecular parasitology. 1. Sutton, R. E. & Boothroyd, J. C. (1986) Cell 47, 527-535. 2. Murphy, W. J., Watkins, K. P. & Agabian, N. (1986) Cell 47, 517-525. 3. Agabian, N. (1990) Cell 61, 1157-1160. 4. Tschudi, C. & Ullu, E. (1990) Cell 61, 459-466. 5. Bruzic, J. P. & Steitz, J. (1990) Cell 62, 889-899. 6. Borst, P. (1986) Annu. Rev. Biochem. 55, 701-732. 7. Laird, P. W. (1989) Trends Genet. 5, 204-208. 8. Landfear, S. M., McMahan-Pratt, D. & Wirth, D. F. (1983) Mol. Cell. Biol. 3, 1070-1076. 9. Seebeck, T., Whittaker, P. A., Imboden, M., Hardman, N. & Brown, R. (1983) Proc. Natd. Acad. Sci. USA 80, 4634-4638. 10. Tomashow, L. S., Milhausen, M., Rutter, W. J. & Agabian, N. (1983) Cell 32, 35-43. 11. Sather, S. & Agabian, N. (1985) Proc. Natl. Acad. Sci. USA 82, 5695-5699. 12. Landfear, S. M., Miller, S. I. & Wirth, D. F. (1986) Mol. Biochem. Parasitol. 21, 235-245. 13. Gonzalez, A., Lerner, T. J., Huecas, M., Sosa-Pineda, B., Nogueira, N. & Lizardi, P. (1985) Nucleic Acids Res. 13, 5789-5804. 14. Johnson, P. J., Kooter, J. M. & Borst, P. (1987) Cell 51, 273-281. 15. Imboden, M. A., Laird, P. W., Affolter, M. & Seebeck, T. (1987) Nucleic Acids Res. 15, 7357-7368. 16. Muhich, M. L. & Boothroyd, J. C. (1988) Mol. Cell. Biol. 8, 3837-3846. 17. Laban, A. & Wirth, D. F. (1989) Proc. Natl. Acad. Sci. USA 86, 9119-9123. 18. Laban, A., Tobin, J. F., Curotto de Lafaille, M. A. & Wirth, D. F. (1990) Nature (London) 343, 572-574. 19. Hadfiel, C., Cashmore, A. M. & Meacock, P. A. (1987) Gene 52, 59-70. 20. Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Lab., Cold Spring Harbor, NY), 2nd Ed. 21. Beck, E., Ludwig, G., Auerswald, E. A., Reiss, B. & Schaller, H. (1982) Gene 19, 327-336. 22. Neuman, J. R., Morency, C. A. & Russian, K. 0. (1987) BioTechnics 5, 444-447. 23. Miller, S. I., Landfear, S. M. & Wirth, D. F. (1986) Nucleic Acids Res. 14, 7341-7360. 24. Saiki, R. K., Bugawan, T. L., Horn, G. T., Mullis, K. B. & Erlich, H. A. (1986) Nature (London) 324, 163-166. 25. Higuchi, R. G. & Ochman, H. (1989) Nucleic Acids Res. 17, 5865. 26. Kooter, J. M., van der Spek, H. J., Wagter, R., d'Oliveira, C. E., van der Hoeven, F., Johnson, P. J. & Borst, P. (1987) Cell 51, 261-272. 27. Grondal, E. G. M., Evers, R., Kosubek, K. & Cornelissen, A. W. C. A. (1989) EMBO J. 8, 3383-3389. 28. Cairns, B. R., Collard, M. W. & Landfear, S. M. (1989) Proc. Natl. Acad. Sci. USA 86, 7682-7686. 29. Foote, S. J., Thompson, J. K., Cowman, A. F. & Kemp, D. J. (1991) Cell 57, 921-930. 30. Padgett, R. A., Grabowski, P., Konarska, M. M., Seiler, S. & Sharp, P. (1986) Annu. Rev. Biochem. 55, 1119-1150. 31. Green, M. R. (1986) Annu. Rev. Genet. 20, 671-708.
