Inflamm. Res. DOI 10.1007/s00011-015-0845-6
Inflammation Research
ORIGINAL RESEARCH PAPER
Gene delivery with IFN-c-expression plasmids enhances the therapeutic effects of MSCs on DSS-induced mouse colitis Yueqiu Chen1 • Yuxian Song1 • Huishuang Miao1 • Yujun Xu1 • Mingming Lv1 Tingting Wang1,2 • Yayi Hou1,2
•
Received: 30 August 2014 / Revised: 13 February 2015 / Accepted: 18 June 2015 Springer Basel 2015
Abstract Objective Interferon-c (IFN-c) is known to enhance the immunosuppressive properties of mesenchymal stem cells (MSCs). The aim of this study was to determine whether gene modification with IFN-c-expression plasmids could boost the therapeutic effects of MSCs on DSS-induced colitis. Methods We first reconstructed pcDNA3.1-IFNc plasmids, transfected them to human umbilical cord derived MSCs, and detected the basic characters of MSCs including immune phenotype, cell vitality, proliferation, apoptosis and cell cycle progression after transfection. Subsequently, we analyzed the inhibition effect of IFN-cMSCs on T cell proliferation in vitro. Finally, we induced colitis in female C57BL/6 mice by 3 % DSS treatment and evaluated the therapeutic efficacy of IFN-c-MSCs on colitis. Results Transfection with pcDNA3.1-IFNc did not change the basic characters of MSCs. Interestingly, IFN-cMSCs showed more potent immunosuppressive effects on the proliferation of T cells compared to normal MSCs. Furthermore, systemic infusion with IFN-c-MSCs more efficiently ameliorated DSS-induced mouse colitis Responsible Editor: Liwu Li. & Yuxian Song [email protected] & Yayi Hou [email protected] 1
The State Key Laboratory of Pharmaceutical Biotechnology, Division of Immunology, Medical School, Nanjing University, Nanjing 210093, People’s Republic of China
2
Jiangsu Key Laboratory of Molecular Medicine, Nanjing 210093, People’s Republic of China
including colitis-related ease of body weight, increase of colon length, decrease of disease activity index, and improvement of small intestine tissues structure. In addition, IFN-c-MSCs increased the populations of Foxp3? Tregs and Th2 cells both in mesenteric lymph node and spleen, upregulated indoleamine 2, 3-dioxygenase expression, and suppressed inflammatory cytokine production in mouse colon. Conclusions Gene delivery with IFN-c-expression plasmids enhanced the therapeutic effects of MSCs on DSSinduced mouse colitis. This study provides an effective therapeutic strategy of MSCs for inflammatory diseases. Keywords MSC IFN-c Immunosuppressive DSS-induced colitis Treg
Introduction Ulcerative colitis (UC) is generally accepted to be a combination of genetic susceptibility, environmental factors, bacterial and immune imbalance, which characterized by dysfunction of the innate and adaptive immunity, resulting in colonic mucosal injuries to intestine [1, 2]. Dextran sulfate sodium (DSS)-induced colitis is one of the well-established murine models that provide useful tools for preclinical studies of therapeutic strategies, particularly stem cell-based therapies [3–5]. Mesenchymal stem cells (MSCs) have great potential for treating various diseases including immune-mediated and inflammatory disorders [6, 7]. MSCs can home to damaged, inflamed, and malignant tissues and display immune modulatory properties [8]. Some studies show that MSCs accumulate in inflamed tissues and ameliorate DSSinduced colitis through their local anti-inflammatory
123
Y. Chen et al.
effects [6, 9]. Recent data suggest that resting MSCs have little immunosuppressive properties, but the administration of MSCs by cytokines such as interferon-c (IFN-c) or interleukin-1b (IL-1b) can obviously improve the immunosuppressive activities [10–12]. Our previous studies had demonstrated that IL-1b signaling elicited the immunosuppressive properties of MSCs, and the IL-1btreated MSCs had improved efficacy in treating DSS-induced colitis [13]. Moreover, IFN-c is known to enhance the immunosuppressive properties of MSCs [14]. IFN-c pre-activated MSCs can directly or indirectly modulate T cell response by enhancing or inducing MSC inhibitory factors. IFN-c enhances MSCs to express chemokine receptors, intercellular adhesions [15], and indoleamine-2, 3 dioxygenase (IDO), a primary mediator of MSC immunomodulatory function [16]. IFN-c also influences MSCs on the differentiation of monocytes [17], activity of NK killing [18], and antagonism of transplant to hosts [19]. Accumulating evidence suggests that modification of MSCs with genes or microparticles can improve the immunosuppressive ability of MSCs [20, 21]. Accordingly, we supposed that delivery of IFN-c gene to MSCs could augment the therapeutic efficacy of MSCs in colitis and provide continuous activation. Therefore, in the present study, we delivered IFN-c gene to MSCs by transfecting pcDNA3.1-IFN-c plasmids. The effects of the modified MSCs on immune cells and therapeutic efficacies for DSSinduced colitis were analyzed and evaluated. Our results suggest that IFN-c-overexpressed MSCs may ameliorate DSS-induced colitis by balancing immunity, up-regulating IDO expression, and suppressing inflammatory cytokine production in the intestinal mucosa. This study provides an effective therapeutic strategy of MSCs for inflammatory diseases.
Materials and methods Isolation and culture of MSCs Human umbilical cord-derived MSCs were harvested and cultured according to our previous report [22]. Briefly, umbilical cord-derived MSCs were collected through removing of umbilical arteries and vein, and the remaining tissue was transferred to a settle container of DMED/F12 (Gibco) and was diced to 1–2 mm3 fragments. The tissue was incubated in mixed enzymes ((hyaluronidase 5 U/ml, collagenase 125 U/ml and dispose 50 U/ml; Sigma) for about 60 min with gentle agitation at 37 C. The cells were then centrifugated (1300 rpm for 5 min), suspended in fresh medium, and transferred to culture dish containing the DMEM/F12 along with 20 % fetal bovine serum (FBS) for 2 days before changing to DMEM/F12 with 10 % FBS
123
(Gibco, Australia). MSCs were trypsinized and plated into a new flask 9–10 days later. Generation of recombinant plasmids The IFN-c gene extracted from human PBMCs which were activated by CD3 and CD28 (1 lg/ml) were cloned into the pcDNA3.1 vector (Promega, China) using the EcoR I and Hind III restriction sites, respectively. The reaction was conducted according to the Takara plasmid construction manufacturer’s instructions. The recombinant plasmids were transformed to E.coli and extracted by plasmid extraction kit (Biomiga, USA). The reconstructed plasmids were then detected by agarose gel electrophoresis and sequence. Transfection of MSCs MSCs (8 9 104) were seeded into 12-well plate and incubated overnight at 37 C pcDNA3.1-IFN-c or pcDNA3.1 plasmids were transfected using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions. The mRNA level of IFN-c was determined by RT-PCR. The released IFN-c in culture media was detected by using human IFN-c ELISA kit (Dakewe, China). Quantitative RT-PCR assay Total RNA was isolated from cultured cells and colons using Trizol reagent (Invitrogen) according to the manufacturer’s instructions. RNAs were reverse transcribed to cDNA with AMV reverse transcriptase (Takara, Japan). Q-PCR was performed to detect the expression of human b-actin, human IFN-c, mouse IL-1b, mouse IL-6, mouse TNF-a, and human cell cycle relative genes. The primers used in this study are listed in Table 1. Q-PCR reactions were carried out using SYBR green PCR Mix (Bio-Rad) by ABI Step one Plus Detection System (Applied Biosystems, USA). The PCR conditions were conducted according to the manufacturer’s instructions. Relative gene expression quantifications were calculated according to the comparative Ct method using b-actin as an internal standard. Gene expression was analyzed with the Step One software and quantified by the formula 2DDCt . Each sample was assayed in triplicates. Viability and proliferation assays MSCs in 96-well plates were transfected with pcDNA3.1IFNc or pcDNA3.1 plasmids and cultured at 37 C, 5 % CO2 condition. Forty-eight hours later, culture supernatants were changed to fresh medium with 10 % CCK8 (Dojindo Laboratories, Japan). The absorption data at 450 nm were
Gene delivery with IFN-c-expression plasmids enhances the therapeutic effects of MSCs on DSS… Table 1 Primer sequences used in real-time PCR of cultured cells Primer
Sense primer (50 –30 )
Antisense primer (50 –30 )
Human IFN-c
ATGAAATATACAAGTTATATCTTGG
TTACTGGGATGCTCTTCGAC
Human b-actin
CCACGAAACTACCTTCAACTC
TCATACTCCTGCTGCTTGCTGATCC
Human CCND1
GCTGCGAAGTGGAAACCATC
CCTCCTTCTGCACACATTTGAA
Human CDK4
CATGTAGACCAGGACCTAAGG
AACTGGCGCATCAGATCCTAG
Human CDK2
CCAGGAGTTACTTCTATGCCTA
TTCATCCAGGGGAGGTACAAC
Human CDK6
GCCTTGCCCGCATCTATAGT
AGCCAACACTCCAGAGATCC
Mouse IDO
TTATGCAGACTGTGTCCTGGCAAA
TTTCCAGCCAGACAGATATATGCG
Mouse IL-1b
TGGCTAAGGACCAAGACCATCCAA
TGCAGTTGTCTAATGGGAACGT
Mouse IL-6
TGGCTAAGGACCAAGACCATCCAA
AACGCACTAGGTTTGCCGAGTAGA
Mouse TNFa
CGAGTGACAAGCCTGTAGCCC
GTCTTTGAGATCCA-TGCCGTTG
Mouse b-actin
GTATGCCTCGGTCGTACCA
CTTCTGCATCCTGTCAGCAA
detected using microplate reader. The proliferation of MSCs was assessed with carboxyfluorescein diacetate succinimide ester (CFSE) (Invitrogen). MSCs were stained with CFSE at a final concentration of 10 lmol/lat RT for 8 min. Labeled cells were washed three times with PBS and placed to 12-well plates, and 12 h later those cells were transfected with pcDNA3.1-IFNc or pcDNA3.1 and cultures at 37 C, 5 % CO2. Forty-eight hours later, 10,000 cells were collected and analyzed by flow cytometry (BD, USA). Data were analyzed by FlowJo software. Flow cytometry To determine the phenotype, cell cycle, and apoptosis of MSCs, MSCs at passage 5 were placed in 12-well plates at 80 % confluence. Cells were transfected with 1.6 lg/well of either pcDNA3.1-IFNc or pcDNA3.1. Forty-eight hours later, cells were collected and washed with PBS and then stained with anti-human CD90, CD73, CD105, CD44, CD45, CD31, and CD34 (eBioscience, for phenotype detection), or propidium iodide (Sigma, for cell cycle analysis), or Annexin-V (eBioscience) and propidium iodide (for apoptosis analysis) for 30 min. The cells were detected by flow cytometry, and data were analyzed by ModFit or FlowJo software. Mixed lymphocyte reaction (MLR) Peripheral blood mononuclear cells (PBMCs) were obtained using FICOLL Lymphocytes Separation Medium (Hao ocean creatures, China) according to the instructions. The different handled MSCs were stimulated with phytohemagglutinin (2.5 lg/ml) and were seeded in 96-well flatbottom plates with RPMI-1640 supplemented with 10 % FBS and 20 U/ml IL-2. MSCs which were differently handled and treated with mitomycin C were added into coculture wells with the concentration of 1:10 (1 9 104
MSCs) or 1:50 (2 9 103 MSCs), respectively. Cell proliferation was measured by 3H-thymidine incorporation after the co-culture of three days. Each experiment was repeated five times. Mice Four to six week-old female C57BL/6 mice (18– 20 g/mouse) with isogenic background were purchased from the Laboratory Animal Center of Nanjing University (Nanjing, China). Mice were maintained under specific pathogenfree conditions, and the experiments were conducted according to institutional animal ethics guidelines. Induction of experimental colitis and treatment Colitis was induced by administration of dextran sulfate sodium (DSS) (3 % w/v) (molecular weight 40 kD, Sigma) in drinking water to C57BL/6 mice for 7 consecutive days as reported [23]. Mice (n = 60) were randomly and averaged divided into six groups: control group (CON), mice with sterile water, and phosphate buffered saline (PBS) treatment; model group (DSS ? PBS), mice with DSS in drinking water and PBS treatment; treatment group I (DSS ? MSC), mice with DSS and normal MSC treatment; treatment group II (DSS ? Vector-MSC), mice with DSS and MSCs which were transfected with pcDNA3.1 treatment; Treatment group III (DSS ? IFN-c-MSC), mice with DSS and MSCs transfected with pcDNA3.1-IFNc treatment; Treatment group IV (DSS ? rhIFN-c-MSC), mice with DSS and MSCs stimulated with rhIFN-c (Table 2). Different handled MSCs (1 9 106) were resuspended in 200 ll of phosphate buffer saline (PBS) and were injected trough tail vein 2 days after initiation of DSS treatment. The behavior of mice was observed daily. Mice were sacrificed at day 11, and the colons were excised for macroscopic observation, histopathological analysis, qRT-
123
Y. Chen et al. Table 2 Grouping of mice used in vivo experiment
Group (mice)
DSS treatment
MSC treatment
CON
–
–
DSS ? PBS
?
–
DSS ? MSC
?
Normal MSCs
DSS ? Vector-MSC
?
MSCs transfected with pcDNA3.1
DSS ? IFN-c-MSC
?
MSCs transfected with pcDNA3.1-IFNc
DSS ? rhIFN-c-MSC
?
MSCs stimulated with rhIFN-c
DSS dextran sulfate sodium, MSC, mesenchymal stem cell, rhIFN-c human recombinant interferon-c
PCR, and cytokine analysis. The disease activity index (DAI) was used to evaluate the grade of inflammatory bowel disease induced by DSS including weight loss, stool consistency, and presence of fecal blood. As to histopathological examination, histological score of H&E staining sections was graded from 0 to 4 according to report [24].
more groups. Values of P \ 0.05 were considered to be statistically significant. Statistical analysis was done using GraphPad Prism software (San Diego, CA, USA, version 5.01).
Immune cells assay
IFN-c-transfected MSCs successfully overexpress IFN-c
For the collection of splenic cells and mesenteric lymph nodes cells (MLN), single-cell suspension was dissociated by gently pressing the organ through a fine, 50 lm-nylon mesh, and cells were collected by centrifugation at 1300 rpm for 5 min. Erythrocytes in splenic cells were removed by treating the splenic cells with red blood cell lysis buffer (0.15 M NH4Cl, 1.0 mmol/l KHCO3, 0.1 mmol/l ethylene diamine tetraacetie acid (EDTA), pH 7.2) for 2 min and washing twice with cold PBS. For immune cells detection, 1 9 106 cells were suspended in PBS and incubated with related anti-mouse antibodies CD4 for 30 min at 4 C, and then washed twice with fluorescence activating cell sorter washing buffer. For intracellular cytokines (IFN-c,IL-4 and IL-17), phorbol esters (PMA)(25 lg/ml), ionomycin (1 lg/ml), and monensin (2 lmol/l) were used to active the expression of them. The cells were fixed with 4 % PFA, permeabilized with 0.2 % saponin (Fluka) in FACS buffer for 10 min at RT and incubated with either anti-mouse IFN-c-PE, antimouse IL-4-PE, or anti-mouse IL-17-PE for 30 min at 4 C, washed, and then fixed in 1 % PFA. The following antibodies were used for Treg cell analysis: anti-CD4FITC, anti-CD25-PE, anti-Foxp3-APC, and isotype control antibodies were purchased from eBioscience (San Diego, CA). Cells were collected and analyzed with Cell Quest software (Cell Quest Pro, Becton–Dickinson). Statistical analysis Data were expressed as mean ± SEM. Difference between two groups was evaluated by the student t test. ANOVA analysis of variance was used to compare among three or
123
Results
The reconstructed plasmids inserted with IFN-c gene were detected by agarose gel electrophoresis and sequence. Results showed that the reconstructed plasmids expressed high level of IFN-c (Fig. 1a), and the sequencing results showed that there was no difference with the reported sequence in Gene bank (data were not shown).We then transfected the MSCs with pcDNA3.1 or pcDNA3.1-IFNc plasmids for different days. The transfection efficiency was around 40 % (Fig. 1b). Expression level of IFN-c was detected the by RT-PCR and ELISA. Results showed that only pcDNA3.1-IFNc-transfected cells express high level of IFN-c. This IFN-c level significantly increased at day 2, reached the peak at day 3, and still detectable at day 7 (Fig. 1c, d). Moreover, we detected the surface markers of MSCs 48 h after transfection. Results showed that after transfection, Vector-MSCs and IFN-c-MSCs shared the similar phenotype. They were positive for CD105, CD44, CD90, and CD73, and negative for CD14, CD45, CD31, and CD34 (Fig. 1e), which were in accordance with the previous reports [22, 25]. These data together proved that we successfully modified MSCs with IFN-c gene. IFN-c gene delivery does not change the ability of proliferation and apoptosis of MSCs To detect the influence of transfection on basic characters of MSCs, cell vitality, proliferation, cell cycle, and apoptosis were detected using flow cytometry. MSCs were placed into 12-well plates at 80 % confluence. Each well was transfected with 1.6 lg of either pcDNA3.1-IFNc or pcDNA3.1.
Gene delivery with IFN-c-expression plasmids enhances the therapeutic effects of MSCs on DSS…
Fig. 1 IFN-c-MSCs successfully express high level of IFN-c. a The fragment electrophoretogram of reconstructed plasmids. b Transfection efficiency was detected by flow cytometry. IFN-c expression level of MSCs transfected with pcDNA3.1 (Vector-MSC) or pcDNA3.1-IFNc (IFN-c-MSC) was detected through RT-PCR
(c) and ELISA (d). Values are present as the mean ± SEM. *p \ 0.05, **p \ 0.01 compared to Vector-MSCs (Two-tailed unpaired t test). e Phenotypic surface antigens of MSCs transfected with pcDNA3.1 or pcDNA3.1-IFNc were analyzed. Data are representative of three independent experiments
Cell viability was detected 48 h later by using CCK8. Results showed that MSCs transfected with different plasmids had the same vitality (Fig. 2a). Proliferation assay showed that most of cells were at generation 3, and there was no significant difference between pcDNA3.1-IFNc and pcDNA3.1 transfected cells (Fig. 2b).
PI staining and cell cycle analysis showed that no obvious differences were shown in populations at G1, G2, and S phase between IFN-c-MSCs and Vector-MSCs (Fig. 2c). Subsequently, qRT-PCR was performed to detect some cell cycle-related genes, such as CCND1, CDK2, CDK4, and CDK6. No significant differences of them were
123
Y. Chen et al.
Fig. 2 Transfection does not change the ability of proliferation and apoptosis of MSCs. MSCs were transfected with different plasmids for 48 h. a Cell viabilities were determined by CCK8 assay (n = 5). b Proliferation Index was detected by CFSE staining and flow cytometry. c Cell cycle was detected by PI staining and flow cytometry, *p \ 0.05 compared to Vector-MSCs (Two-tailed
unpaired t test). d Cell cycle relative genes were analyzed by qRTPCR. e Apoptosis were analyzed by Annexin-V/PI staining and flow cytometry. In the scatter diagram, the proportion in lower right corner presents the early apoptosis cells and the proportion in top right corner presents the late apoptosis cells. ns no significant change
observed between IFN-c-MSCs and Vector-MSCs (Fig. 2d). We also detected the apoptosis of MSCs. Results showed that there was still no obvious difference between IFN-c-MSCs and Vector-MSCs (Fig. 2e).
lower than IFN-c transfected MSCs (IFN-c-MSC); When MSCs:PBMC = 1:50, resting MSCs could not significantly inhibit the proliferation of T cells, but both IFN-cMSC and rhIFN-c-MSC could inhibit the proliferation of T cells obviously (Fig. 3b). These results implicated that IFN-c-MSCs had more potent immunosuppressive effects on the proliferation of T cells than resting MSCs.
IFN-c gene delivery enhances immunosuppressive properties of MSCs in vitro
IFN-c-MSCs ameliorate DSS-induced mouse colitis To detect the immunosuppressive effects of IFN-c-MSCs, mixed lymphocytes reaction was performed. As shown in Fig. 3a, when MSCs:PBMC = 1:10, MSCs significantly inhibited the proliferation of T lymphocytes and the inhibition rate of recombinant human IFN pretreated MSCs (rhIFN-c-MSC) was higher than resting MSCs but still
123
Given the augmented immunosuppressive properties of IFN-c-MSCs in vitro, we examined the anti-inflammatory effects of IFN-c-MSCs in vivo using a DSS-induced colitis model (Fig. 4a). Similar to previous reports [5, 26], we confirmed that oral administration of 3 % DSS for 7 days
Gene delivery with IFN-c-expression plasmids enhances the therapeutic effects of MSCs on DSS…
Fig. 3 IFN-c-MSCs enhance immunosuppressive properties in vitro. PBMCs (1 9 105 cells) were stimulated with anti-CD3/CD28 antibody and co-cultured with MSCs which were different handled. The ratio of MSC with PBMC was 1:10 (a) or 1:50 (b). Proliferation was measured by 3H-thymidine uptake in counts per minute and expressed
as a percentage of PBMC proliferation in the absence of MSCs (n = 5). *p \ 0.05, **p \ 0.01, ***p \ 0.001 (One-way ANOVA and nonparametric). Data are representative of three independent experiments
induced acute colitis in C57BL/6 mice characterized by an overall elevation of colitis scores based on the presence of sustained weight loss (Fig. 4b–d). Histological examination showed that DSS-induced colitis affected all layers of the colon, including sub-mucosal edema and leukocyte infiltration and disruption of crypt architecture (Fig. 4e). These same results were also reflected by histology score (Fig. 4f). Importantly, our results showed that systemic infusion with IFN-c-MSCs recovered the loss of body weight (Fig. 4b), reduced the overall disease severity (Fig. 4c, d), and protected mice against colitis-related tissue injuries (Fig. 4e, f). The body weight recovery reflected that IFN-c gene-modified MSCs were more effective than recombinant human IFN-c pretreated MSCs (Fig. 4b).
and shifted to a Th2 type. The increase of Treg and Th2 cells but decrease of Th17 and Th1 cells may contribute to the IFN-c-MSCs induced amelioration of colitis.
IFN-c-MSCs alter the balance of immune cells in vivo To confirm the role of IFN-c-MSCs in DSS-induced colitis, we next analyzed the profiles of T lymphocytes in MLN and spleen. As we all know, CD4? Th cells can be roughly classified into Th1, Th2, Th17, and regulatory T cells (Treg cells). We then evaluate the effect of different handled MSCs on the change of T cells. We observed increased percentage of Treg cells and decreased percentage of Th17 cells both in MLN and spleen of different MSC-treated mice, and the IFN-c-MSC-treated mice showed the most significant changes (Fig. 5a, b). These results suggested that MSCs regulated the differentiation of CD4? T cells. In addition, a percentage of Th1 cells were decreased in MLN and a percentage of Th2 cells were increased both in MLN and spleen of IFN-c-MSC-treated mice (Fig. 5c, d), which suggested that IFN-c-MSCs regulated the Th1/Th2 balance
IFN-c-MSCs increase the expression of IDO and decrease the expression of inflammation factors in colons To detect the inflammation level of colons, we extracted the total RNA and assayed the gene level of IDO and inflammatory factors, such as IL-6, IL-1b, and TNF-a. We observed that the expression level of IDO in IFN-c-MSCtreated mice was higher than other groups (Fig. 6a). This indicated that there might be more MSCs migrated to the inflammatory sites of IFN-c-MSC-treated mice. The increased expression of IL-6, IL-1b, and TNF-a in inflamed clones was confirmed by qRT-PCR. Systemic infusion with IFN-c-MSCs significantly decreased the expression of inflammatory factors, and the inhibition rate was similar or even higher than those infused with rhIFNc-MSCs (Fig. 6b–d). These results proved that the inflammation in IFN-c-MSC-treated group was less than other groups.
Discussion MSCs are pluripotent cells and can be isolated from many tissues including bone marrow, adipose tissue, adult muscle, and corneal stroma [27]. Umbilical cord tissue-derived MSCs have many advantages, such as noninvasive accessibility, lack of ethical controversy, reduced risk of viral contamination, higher proliferation rate, and differentiation
123
Y. Chen et al.
Fig. 4 IFN-c-MSCs ameliorate DSS-induced mouse colitis. Colitis was induced by oral administration of 3 % DSS in drinking water for 7 days. One 9 106 of different treated MSCs in 200 ll of PBS were injected into mice by cauda vein 2 day after initiation of DSS treatment (a). Mice without any treatment (CON) or mice that received 200 ll of PBS (DSS ? PBS) served as controls. Severity
and curative effect were monitored every day by body weight change (b), colon picture (c), and disease activity index (d). Colon sections were examined by H&E staining (e) and histopathological scoring (f). Values are expressed as the mean ± SEM. *p \ 0.05, **p \ 0.01 (One-way ANOVA and nonparametric). n = 10 miceper group for (b–d) and 5 mice per group for (e, f)
capacity, which make them highly suitable for further development of novel cell-based therapeutic potential. Although MSCs are known to have immunosuppressive effects, the mechanisms of immunosuppression are still controversial. Evidence has emerged that the immunosuppressive ability of resting MSCs is not strong, but it could be augmented by proinflammatory cytokines [28]. When
exposed to inflammatory signals, MSCs were found to significantly potentiate the immunosuppressive effects on T cells, monocytes/macrophages, and dendritic cells [29– 31]. These data were also validated in vivo using animal models, where IFN-c pretreatment improved MSC efficacy for the treatment of DSS or trinitrobenzene sulfonate (TNBS)-induced colitis in mice [10]. In the present study,
123
Gene delivery with IFN-c-expression plasmids enhances the therapeutic effects of MSCs on DSS…
Fig. 5 IFN-c-MSCs increase the proportion of Treg lymphocytes and decrease the proportion of Th 17 lymphocytes. a–d Treg, Th17, Th1, and Th2 cells in MLN and spleen of mice were analyzed by flow
cytometry. n = 5–6 mice per group. Values are expressed as the mean ± SEM. *p \ 0.05, **p \ 0.01, ***p \ 0.001 (One-way ANOVA and nonparametric)
Fig. 6 IFN-c-MSCs alter the expression level of IDO and some inflammation factors in colons. a–d The expression levels of IDO and colonic inflammatory cytokines (IL-6, IL-1b, and TNF-a) from different groups of mice were evaluated by qRT-PCR. Values are expressed as the mean ± SEM. *p \ 0.05, **p \ 0.01, ***p \ 0.001 (One-way ANOVA and nonparametric)
we delivered IFN-c gene to MSCs by transfecting pcDNA3.1-IFN-c plasmids so that MSCs could produce high level of IFN-c and last for 1 week. This modification
significantly enhanced the inhibition activity of MSCs on T cell proliferation (Fig. 3). Furthermore, significantly reduced disease severity was observed in IFN-c-MSCs
123
Y. Chen et al.
infused mice of DSS-induced colitis (Fig. 4). Intriguingly, the immunosuppressive activity of IFN-c-MSCs was similar or even greater than the recombinant human IFN-c pretreated cells (rhIFN-c-MSCs). Although rhIFN-c treatment could enhance the function of MSCs to some extent, the effect would not last long, and therefore, multiple MSCs injections were needed in clinical application. However, with IFN-c gene delivery, MSCs would be stably and continuously activated, so that the function would be more efficient and last for a longer time. In the present study, the improvement by IFN-c gene delivery was not so strong. This may be due to the low transfection efficiency. In the long run, a robust, safe, and efficient protocol of transfection is needed for an optimal use of genetically engineered MSCs for clinical applications. Inspite of this, IFN-c gene delivery of MSCs can be used as a tool for molecular and biological mechanism studies and therefore accelerates the use of genetically engineered MSCs in clinical applications. Based on the reduced disease severity, we tried to elucidate the putative mechanisms by which the IFN-c overexpressed MSCs could improve the immunosuppressive activities. Resent data suggest that the balance of Th17/Tregs contributes to the MSC-mediated immunosuppressive effects [32]. They prove that MSCs suppress the survival as well as the proliferation of T cells partially by increasing the proportion of regulatory T cells in vitro [33]. What is more, MSCs can negatively regulate both Th1 and Th17 responses and restore the balance of Th17/ Tregs in experimental autoimmune uveoretinitis [34]. Here, our results demonstrate that IFN-c-MSCs increase the proportion of CD4?CD25?FoxP3? regulatory T cells (Tregs), decrease the proportion of Th17, and influence the balance of Th1 and Th2 in MLN and spleen. These results are in accordance with the reports mentioned above. Indoleamine-2, 3 dioxygenase (IDO), an enzyme participating in the conversion of tryptophan into kynurenine, can be strongly promoted by IFN-c in human MSCs. Some reports show that IDO mediates inhibition of normal T cell proliferation, and the CD8? T cell-IFN-c-IDO axis is required for the therapeutic effects of allogeneic MSCs in lupus patients [35, 36]. However, resent study reveals a new immunosuppressive property of IFN-c-licensed MSCs [37]. It shows that IFN-c-licensed MSCs up-regulate IDO expression and activation, suppress T cell proliferation and effector function, but the suppression of T cell effector function by IFN-c-licensed MSCs is independent of IDO. In the present study, we prove that IFN-c-MSCs inhibit T cell proliferation and obviously increase IDO expression in the mouse colon. But whether IDO can directly influence T cell effector function in this system is still unknown and needs further investigation.
123
In conclusion, we successfully modify MSCs with IFNc-expression plasmids and prove that IFN-c-MSCs can obviously suppress T cell proliferation and ameliorate the symptoms of mouse colitis induced by DSS. This study provides a theoretical basis for the further use of genetically modified MSCs and makes them more suitable for the treatment of related diseases. Acknowledgments This work was supported by the Clinical Medicine Science and Technology Projects of Jiangsu Province (BL2014069), the National Natural Science Foundation of China (81101552), and the Natural Science Foundation of Jiangsu Province (BK2011571).
References 1. Hanauer SB. Inflammatory bowel disease: epidemiology, pathogenesis, and therapeutic opportunities. Inflamm Bowel Dis. 2006;12(Suppl 1):S3–9. 2. Ng SC, Bernstein CN, Vatn MH, Lakatos PL, Loftus EV Jr, Tysk C, et al. Geographical variability and environmental risk factors in inflammatory bowel disease. Gut. 2013;62:630–49. 3. Geremia A, Biancheri P, Allan P, Corazza GR, Di Sabatino A. Innate and adaptive immunity in inflammatory bowel disease. Autoimmun Rev. 2014;13:3–10. 4. Gonza´lez MA, Gonzalez-Rey E, Rico L, Bu¨scher D, Delgado M. Adipose-derived mesenchymal stem cells alleviate experimental colitis by inhibiting inflammatory and autoimmune responses. Gastroenterology. 2009;136:978–89. 5. Gonzalez-Rey E, Anderson P, Gonza´lez MA, Rico L, Bu¨scher D, Delgado M. Human adult stem cells derived from adipose tissue protect against experimental colitis and sepsis. Gut. 2009;58:929–39. 6. He XW, He XS, Lian L, Wu XJ, Lan P. Systemic infusion of bone marrow-derived mesenchymal stem cells for treatment of experimental colitis in mice. Dig Dis Sci. 2012;57:3136–44. 7. Shi Y, Hu G, Su J, Li W, Chen Q, Shou P, et al. Mesenchymal stem cells: a new strategy for immunosuppression and tissue repair. Cell Res. 2010;20:510–8. 8. Hemeda H, Jakob M, Ludwig AK, Giebel B, Lang S, Brandau S. Interferon-gamma and tumor necrosis factor-alpha differentially affect cytokine expression and migration properties of mesenchymal stem cells. Stem Cells Dev. 2010;19:693–706. 9. Tanaka F, Tominaga K, Ochi M, Tanigawa T, Watanabe T, Fujiwara Y, et al. Exogenous administration of mesenchymal stem cells ameliorates dextran sulfate sodium-induced colitis via anti-inflammatory action in damaged tissue in rats. Life Sci. 2008;83:771–9. 10. Duijvestein M, Wildenberg ME, Welling MM, Hennink S, Molendijk I, van Zuylen VL, et al. Pretreatment with interferon-c enhances the therapeutic activity of mesenchymal stromal cells in animal models of colitis. Stem Cells. 2011;29:1549–58. 11. Ren G, Zhang L, Zhao X, Xu G, Zhang Y, Roberts AI, et al. Mesenchymal stem cell-mediated immunosuppression occurs via concerted action of chemokines and nitric oxide. Cell Stem Cell. 2008;2:141–50. 12. Krampera M, Cosmi L, Angeli R, Pasini A, Liotta F, Andreini A, et al. Role for interferon-gamma in the immunomodulatory activity of human bone marrow mesenchymal stem cells. Stem Cells. 2006;24:386–98. 13. Fan H, Zhao G, Liu L, Liu F, Gong W, Liu X, et al. Pre-treatment with IL-1b enhances the efficacy of MSC transplantation in DSSinduced colitis. Cell Mol Immunol. 2012;9:473–81.
Gene delivery with IFN-c-expression plasmids enhances the therapeutic effects of MSCs on DSS… 14. Ryan JM, Barry F, Murphy JM, Mahon BP. Interferon-gamma does not break, but promotes the immunosuppressive capacity of adult human mesenchymal stem cells. Clin Exp Immunol. 2007;149:353–63. 15. Ren G, Zhao X, Zhang L, Zhang J, L’Huillier A, Ling W, et al. Inflammatory cytokine-induced intercellular adhesion molecule-1 and vascular cell adhesion molecule-1 in mesenchymal stem cells are critical for immunosuppression. J Immunol. 2010;184: 2321–8. 16. Croitoru-Lamoury J, Lamoury FM, Caristo M, Suzuki K, Walker D, Takikawa O, et al. Interferon-c regulates the proliferation and differentiation of mesenchymal stem cells via activation of indoleamine 2,3 dioxygenase (IDO). PLoS ONE. 2011;6: e14698. 17. Franc¸ois M, Romieu-Mourez R, Li M, Galipeau J. Human MSC suppression correlates with cytokine induction of indoleamine 2, 3-dioxygenase and bystander M2 macrophage differentiation. Mol Ther. 2012;2012(20):187–95. 18. Noone C, Kihm A, English K, O’Dea S, Mahon BP. IFN-c stimulated human umbilical-tissue-derived cells potently suppress NK activation and resist NK-mediated cytotoxicity in vitro. Stem Cells Dev. 2013;22:3003–14. 19. Sivanathan KN, Gronthos S, Rojas-Canales D, Thierry B, Coates PT. Interferon-gamma modification of mesenchymal stem cells: implications of autologous and allogeneic mesenchymal stem cell therapy in allotransplantation. Stem Cell Rev. 2014;10:351–75. 20. Kim DJ, Kim KS, Song MY, Seo SH, Kim SJ, Yang BG, et al. Delivery of IL-12p40 ameliorates DSS-induced colitis by suppressing IL-17A expression and inflammation in the intestinal mucosa. Clin Immunol. 2012;144:190–9. 21. Ankrum JA, Dastidar RG, Ong JF, Levy O, Karp JM. Performance-enhanced mesenchymal stem cells via intracellular delivery of steroids. Sci Rep. 2014;4:4645. 22. Liu L, Zhao X, Li P, Zhao G, Wang Y, Hu Y, et al. A novel way to isolate MSCs from umbilical cords. Eur J Immunol. 2012;42:2190–3. 23. Neurath MF, Fuss I, Kelsall BL, Stu¨ber E, Strober W. Antibodies to interleukin 12 abrogate established experimental colitis in mice. J Exp Med. 1995;182:1281–90. 24. Zuo L, Huang Z, Dong L, Xu L, Zhu Y, Zeng K, et al. Targeting delivery of anti-TNF alpha oligonucleotide into activated colonic macrophages protects against experimental colitis. Gut. 2010;59: 470–9. 25. Tondreau T, Meuleman N, Delforge A, Dejeneffe M, Leroy R, Massy M, et al. Mesenchymal stem cells derived from CD133positive cells in mobilized peripheral blood and cord blood: proliferation, Oct4 expression, and plasticity. Stem Cells. 2005;23:1105–12.
26. Alex P, Zachos NC, Nguyen T, Gonzales L, Chen TE, Conklin LS, et al. Distinct cytokine patterns identified from multiplex profiles of murine DSS and TNBS-induced colitis. Inflamm Bowel Dis. 2009;15:341–52. 27. Uccelli A, Moretta L, Pistoia V. Mesenchymal stem cells in health and disease. Nat Rev Immunol. 2008;8:726–36. 28. Bukulmez H, Bilgin A, Bebek G, Caplan AI, Jones O. A125: immunomodulatory factors produced by mesenchymal stem cells after in vitro priming with danger signals. Arthritis Rheumatol. 2014;66(Suppl 11):S163. 29. English K, Barry FP, Field-Corbett CP, Mahon BP. IFN-gamma and TNF-alpha differentially regulateimmunomodulation by murine mesenchymal stem cells. Immunol Lett. 2007;110: 91–100. 30. Zhao X, Liu D, Gong W, Zhao G, Liu L, Yang L, et al. The tolllike receptor 3 ligand, poly (I:C), improves immunosuppressive function and therapeutic effect of mesenchymal stem cells on sepsis via inhibiting miR-143. Stem Cells. 2014;32:521–33. 31. Dumitru CA, Hemeda H, Jakob M, Lang S, Brandau S. Stimulation of mesenchymal stromal cells (MSCs) via TLR3 reveals a novel mechanism of autocrine priming. FASEB J. 2014;28: 3856–66. 32. Luz-Crawford P, Kurte M, Bravo-Alegrı´a J, Contreras R, NovaLamperti E, Tejedor G, et al. Mesenchymal stem cells generate a CD4? CD25? Foxp3? regulatory T cell population during the differentiation process of Th1 and Th17 cells. Stem Cell Res Ther. 2013;4:65. 33. Han KH, Ro H, Hong JH, Lee EM, Cho B, Yeom HJ, et al. Immunosuppressive mechanisms of embryonic stem cells and mesenchymal stem cells in alloimmune response. Transpl Immunol. 2011;25:7–15. 34. Li G, Yuan L, Ren X, Nian H, Zhang L, Han ZC, et al. The effect of mesenchymal stem cells on dynamic changes of T cell subsets in experimental autoimmune uveoretinitis. Clin Exp Immunol. 2013;173:28–37. 35. Meisel R, Zibert A, Laryea M, Go¨bel U, Da¨ubener W, Dilloo D. Human bone marrow stromal cells inhibit allogeneic T-cell responses by indoleamine 2, 3-dioxygenase-mediated tryptophan degradation. Blood. 2004;103:4619–21. 36. Wang D, Feng X, Lu L, Konkel JE, Zhang H, Chen Z, et al. A CD8 T cell-IDO axis is required for mesenchymal stem cell suppression of human SLE. Arthritis Rheumatol. 2014;66: 2234–45. 37. Chinnadurai R, Copland IB, Patel SR, Galipeau J. IDO-independent suppression of T cell effector function by IFN-c-licensed human mesenchymal stromal cells. J Immunol. 2014;192: 1491–501.
123
Inflammation Research
ORIGINAL RESEARCH PAPER
Gene delivery with IFN-c-expression plasmids enhances the therapeutic effects of MSCs on DSS-induced mouse colitis Yueqiu Chen1 • Yuxian Song1 • Huishuang Miao1 • Yujun Xu1 • Mingming Lv1 Tingting Wang1,2 • Yayi Hou1,2
•
Received: 30 August 2014 / Revised: 13 February 2015 / Accepted: 18 June 2015 Springer Basel 2015
Abstract Objective Interferon-c (IFN-c) is known to enhance the immunosuppressive properties of mesenchymal stem cells (MSCs). The aim of this study was to determine whether gene modification with IFN-c-expression plasmids could boost the therapeutic effects of MSCs on DSS-induced colitis. Methods We first reconstructed pcDNA3.1-IFNc plasmids, transfected them to human umbilical cord derived MSCs, and detected the basic characters of MSCs including immune phenotype, cell vitality, proliferation, apoptosis and cell cycle progression after transfection. Subsequently, we analyzed the inhibition effect of IFN-cMSCs on T cell proliferation in vitro. Finally, we induced colitis in female C57BL/6 mice by 3 % DSS treatment and evaluated the therapeutic efficacy of IFN-c-MSCs on colitis. Results Transfection with pcDNA3.1-IFNc did not change the basic characters of MSCs. Interestingly, IFN-cMSCs showed more potent immunosuppressive effects on the proliferation of T cells compared to normal MSCs. Furthermore, systemic infusion with IFN-c-MSCs more efficiently ameliorated DSS-induced mouse colitis Responsible Editor: Liwu Li. & Yuxian Song [email protected] & Yayi Hou [email protected] 1
The State Key Laboratory of Pharmaceutical Biotechnology, Division of Immunology, Medical School, Nanjing University, Nanjing 210093, People’s Republic of China
2
Jiangsu Key Laboratory of Molecular Medicine, Nanjing 210093, People’s Republic of China
including colitis-related ease of body weight, increase of colon length, decrease of disease activity index, and improvement of small intestine tissues structure. In addition, IFN-c-MSCs increased the populations of Foxp3? Tregs and Th2 cells both in mesenteric lymph node and spleen, upregulated indoleamine 2, 3-dioxygenase expression, and suppressed inflammatory cytokine production in mouse colon. Conclusions Gene delivery with IFN-c-expression plasmids enhanced the therapeutic effects of MSCs on DSSinduced mouse colitis. This study provides an effective therapeutic strategy of MSCs for inflammatory diseases. Keywords MSC IFN-c Immunosuppressive DSS-induced colitis Treg
Introduction Ulcerative colitis (UC) is generally accepted to be a combination of genetic susceptibility, environmental factors, bacterial and immune imbalance, which characterized by dysfunction of the innate and adaptive immunity, resulting in colonic mucosal injuries to intestine [1, 2]. Dextran sulfate sodium (DSS)-induced colitis is one of the well-established murine models that provide useful tools for preclinical studies of therapeutic strategies, particularly stem cell-based therapies [3–5]. Mesenchymal stem cells (MSCs) have great potential for treating various diseases including immune-mediated and inflammatory disorders [6, 7]. MSCs can home to damaged, inflamed, and malignant tissues and display immune modulatory properties [8]. Some studies show that MSCs accumulate in inflamed tissues and ameliorate DSSinduced colitis through their local anti-inflammatory
123
Y. Chen et al.
effects [6, 9]. Recent data suggest that resting MSCs have little immunosuppressive properties, but the administration of MSCs by cytokines such as interferon-c (IFN-c) or interleukin-1b (IL-1b) can obviously improve the immunosuppressive activities [10–12]. Our previous studies had demonstrated that IL-1b signaling elicited the immunosuppressive properties of MSCs, and the IL-1btreated MSCs had improved efficacy in treating DSS-induced colitis [13]. Moreover, IFN-c is known to enhance the immunosuppressive properties of MSCs [14]. IFN-c pre-activated MSCs can directly or indirectly modulate T cell response by enhancing or inducing MSC inhibitory factors. IFN-c enhances MSCs to express chemokine receptors, intercellular adhesions [15], and indoleamine-2, 3 dioxygenase (IDO), a primary mediator of MSC immunomodulatory function [16]. IFN-c also influences MSCs on the differentiation of monocytes [17], activity of NK killing [18], and antagonism of transplant to hosts [19]. Accumulating evidence suggests that modification of MSCs with genes or microparticles can improve the immunosuppressive ability of MSCs [20, 21]. Accordingly, we supposed that delivery of IFN-c gene to MSCs could augment the therapeutic efficacy of MSCs in colitis and provide continuous activation. Therefore, in the present study, we delivered IFN-c gene to MSCs by transfecting pcDNA3.1-IFN-c plasmids. The effects of the modified MSCs on immune cells and therapeutic efficacies for DSSinduced colitis were analyzed and evaluated. Our results suggest that IFN-c-overexpressed MSCs may ameliorate DSS-induced colitis by balancing immunity, up-regulating IDO expression, and suppressing inflammatory cytokine production in the intestinal mucosa. This study provides an effective therapeutic strategy of MSCs for inflammatory diseases.
Materials and methods Isolation and culture of MSCs Human umbilical cord-derived MSCs were harvested and cultured according to our previous report [22]. Briefly, umbilical cord-derived MSCs were collected through removing of umbilical arteries and vein, and the remaining tissue was transferred to a settle container of DMED/F12 (Gibco) and was diced to 1–2 mm3 fragments. The tissue was incubated in mixed enzymes ((hyaluronidase 5 U/ml, collagenase 125 U/ml and dispose 50 U/ml; Sigma) for about 60 min with gentle agitation at 37 C. The cells were then centrifugated (1300 rpm for 5 min), suspended in fresh medium, and transferred to culture dish containing the DMEM/F12 along with 20 % fetal bovine serum (FBS) for 2 days before changing to DMEM/F12 with 10 % FBS
123
(Gibco, Australia). MSCs were trypsinized and plated into a new flask 9–10 days later. Generation of recombinant plasmids The IFN-c gene extracted from human PBMCs which were activated by CD3 and CD28 (1 lg/ml) were cloned into the pcDNA3.1 vector (Promega, China) using the EcoR I and Hind III restriction sites, respectively. The reaction was conducted according to the Takara plasmid construction manufacturer’s instructions. The recombinant plasmids were transformed to E.coli and extracted by plasmid extraction kit (Biomiga, USA). The reconstructed plasmids were then detected by agarose gel electrophoresis and sequence. Transfection of MSCs MSCs (8 9 104) were seeded into 12-well plate and incubated overnight at 37 C pcDNA3.1-IFN-c or pcDNA3.1 plasmids were transfected using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions. The mRNA level of IFN-c was determined by RT-PCR. The released IFN-c in culture media was detected by using human IFN-c ELISA kit (Dakewe, China). Quantitative RT-PCR assay Total RNA was isolated from cultured cells and colons using Trizol reagent (Invitrogen) according to the manufacturer’s instructions. RNAs were reverse transcribed to cDNA with AMV reverse transcriptase (Takara, Japan). Q-PCR was performed to detect the expression of human b-actin, human IFN-c, mouse IL-1b, mouse IL-6, mouse TNF-a, and human cell cycle relative genes. The primers used in this study are listed in Table 1. Q-PCR reactions were carried out using SYBR green PCR Mix (Bio-Rad) by ABI Step one Plus Detection System (Applied Biosystems, USA). The PCR conditions were conducted according to the manufacturer’s instructions. Relative gene expression quantifications were calculated according to the comparative Ct method using b-actin as an internal standard. Gene expression was analyzed with the Step One software and quantified by the formula 2DDCt . Each sample was assayed in triplicates. Viability and proliferation assays MSCs in 96-well plates were transfected with pcDNA3.1IFNc or pcDNA3.1 plasmids and cultured at 37 C, 5 % CO2 condition. Forty-eight hours later, culture supernatants were changed to fresh medium with 10 % CCK8 (Dojindo Laboratories, Japan). The absorption data at 450 nm were
Gene delivery with IFN-c-expression plasmids enhances the therapeutic effects of MSCs on DSS… Table 1 Primer sequences used in real-time PCR of cultured cells Primer
Sense primer (50 –30 )
Antisense primer (50 –30 )
Human IFN-c
ATGAAATATACAAGTTATATCTTGG
TTACTGGGATGCTCTTCGAC
Human b-actin
CCACGAAACTACCTTCAACTC
TCATACTCCTGCTGCTTGCTGATCC
Human CCND1
GCTGCGAAGTGGAAACCATC
CCTCCTTCTGCACACATTTGAA
Human CDK4
CATGTAGACCAGGACCTAAGG
AACTGGCGCATCAGATCCTAG
Human CDK2
CCAGGAGTTACTTCTATGCCTA
TTCATCCAGGGGAGGTACAAC
Human CDK6
GCCTTGCCCGCATCTATAGT
AGCCAACACTCCAGAGATCC
Mouse IDO
TTATGCAGACTGTGTCCTGGCAAA
TTTCCAGCCAGACAGATATATGCG
Mouse IL-1b
TGGCTAAGGACCAAGACCATCCAA
TGCAGTTGTCTAATGGGAACGT
Mouse IL-6
TGGCTAAGGACCAAGACCATCCAA
AACGCACTAGGTTTGCCGAGTAGA
Mouse TNFa
CGAGTGACAAGCCTGTAGCCC
GTCTTTGAGATCCA-TGCCGTTG
Mouse b-actin
GTATGCCTCGGTCGTACCA
CTTCTGCATCCTGTCAGCAA
detected using microplate reader. The proliferation of MSCs was assessed with carboxyfluorescein diacetate succinimide ester (CFSE) (Invitrogen). MSCs were stained with CFSE at a final concentration of 10 lmol/lat RT for 8 min. Labeled cells were washed three times with PBS and placed to 12-well plates, and 12 h later those cells were transfected with pcDNA3.1-IFNc or pcDNA3.1 and cultures at 37 C, 5 % CO2. Forty-eight hours later, 10,000 cells were collected and analyzed by flow cytometry (BD, USA). Data were analyzed by FlowJo software. Flow cytometry To determine the phenotype, cell cycle, and apoptosis of MSCs, MSCs at passage 5 were placed in 12-well plates at 80 % confluence. Cells were transfected with 1.6 lg/well of either pcDNA3.1-IFNc or pcDNA3.1. Forty-eight hours later, cells were collected and washed with PBS and then stained with anti-human CD90, CD73, CD105, CD44, CD45, CD31, and CD34 (eBioscience, for phenotype detection), or propidium iodide (Sigma, for cell cycle analysis), or Annexin-V (eBioscience) and propidium iodide (for apoptosis analysis) for 30 min. The cells were detected by flow cytometry, and data were analyzed by ModFit or FlowJo software. Mixed lymphocyte reaction (MLR) Peripheral blood mononuclear cells (PBMCs) were obtained using FICOLL Lymphocytes Separation Medium (Hao ocean creatures, China) according to the instructions. The different handled MSCs were stimulated with phytohemagglutinin (2.5 lg/ml) and were seeded in 96-well flatbottom plates with RPMI-1640 supplemented with 10 % FBS and 20 U/ml IL-2. MSCs which were differently handled and treated with mitomycin C were added into coculture wells with the concentration of 1:10 (1 9 104
MSCs) or 1:50 (2 9 103 MSCs), respectively. Cell proliferation was measured by 3H-thymidine incorporation after the co-culture of three days. Each experiment was repeated five times. Mice Four to six week-old female C57BL/6 mice (18– 20 g/mouse) with isogenic background were purchased from the Laboratory Animal Center of Nanjing University (Nanjing, China). Mice were maintained under specific pathogenfree conditions, and the experiments were conducted according to institutional animal ethics guidelines. Induction of experimental colitis and treatment Colitis was induced by administration of dextran sulfate sodium (DSS) (3 % w/v) (molecular weight 40 kD, Sigma) in drinking water to C57BL/6 mice for 7 consecutive days as reported [23]. Mice (n = 60) were randomly and averaged divided into six groups: control group (CON), mice with sterile water, and phosphate buffered saline (PBS) treatment; model group (DSS ? PBS), mice with DSS in drinking water and PBS treatment; treatment group I (DSS ? MSC), mice with DSS and normal MSC treatment; treatment group II (DSS ? Vector-MSC), mice with DSS and MSCs which were transfected with pcDNA3.1 treatment; Treatment group III (DSS ? IFN-c-MSC), mice with DSS and MSCs transfected with pcDNA3.1-IFNc treatment; Treatment group IV (DSS ? rhIFN-c-MSC), mice with DSS and MSCs stimulated with rhIFN-c (Table 2). Different handled MSCs (1 9 106) were resuspended in 200 ll of phosphate buffer saline (PBS) and were injected trough tail vein 2 days after initiation of DSS treatment. The behavior of mice was observed daily. Mice were sacrificed at day 11, and the colons were excised for macroscopic observation, histopathological analysis, qRT-
123
Y. Chen et al. Table 2 Grouping of mice used in vivo experiment
Group (mice)
DSS treatment
MSC treatment
CON
–
–
DSS ? PBS
?
–
DSS ? MSC
?
Normal MSCs
DSS ? Vector-MSC
?
MSCs transfected with pcDNA3.1
DSS ? IFN-c-MSC
?
MSCs transfected with pcDNA3.1-IFNc
DSS ? rhIFN-c-MSC
?
MSCs stimulated with rhIFN-c
DSS dextran sulfate sodium, MSC, mesenchymal stem cell, rhIFN-c human recombinant interferon-c
PCR, and cytokine analysis. The disease activity index (DAI) was used to evaluate the grade of inflammatory bowel disease induced by DSS including weight loss, stool consistency, and presence of fecal blood. As to histopathological examination, histological score of H&E staining sections was graded from 0 to 4 according to report [24].
more groups. Values of P \ 0.05 were considered to be statistically significant. Statistical analysis was done using GraphPad Prism software (San Diego, CA, USA, version 5.01).
Immune cells assay
IFN-c-transfected MSCs successfully overexpress IFN-c
For the collection of splenic cells and mesenteric lymph nodes cells (MLN), single-cell suspension was dissociated by gently pressing the organ through a fine, 50 lm-nylon mesh, and cells were collected by centrifugation at 1300 rpm for 5 min. Erythrocytes in splenic cells were removed by treating the splenic cells with red blood cell lysis buffer (0.15 M NH4Cl, 1.0 mmol/l KHCO3, 0.1 mmol/l ethylene diamine tetraacetie acid (EDTA), pH 7.2) for 2 min and washing twice with cold PBS. For immune cells detection, 1 9 106 cells were suspended in PBS and incubated with related anti-mouse antibodies CD4 for 30 min at 4 C, and then washed twice with fluorescence activating cell sorter washing buffer. For intracellular cytokines (IFN-c,IL-4 and IL-17), phorbol esters (PMA)(25 lg/ml), ionomycin (1 lg/ml), and monensin (2 lmol/l) were used to active the expression of them. The cells were fixed with 4 % PFA, permeabilized with 0.2 % saponin (Fluka) in FACS buffer for 10 min at RT and incubated with either anti-mouse IFN-c-PE, antimouse IL-4-PE, or anti-mouse IL-17-PE for 30 min at 4 C, washed, and then fixed in 1 % PFA. The following antibodies were used for Treg cell analysis: anti-CD4FITC, anti-CD25-PE, anti-Foxp3-APC, and isotype control antibodies were purchased from eBioscience (San Diego, CA). Cells were collected and analyzed with Cell Quest software (Cell Quest Pro, Becton–Dickinson). Statistical analysis Data were expressed as mean ± SEM. Difference between two groups was evaluated by the student t test. ANOVA analysis of variance was used to compare among three or
123
Results
The reconstructed plasmids inserted with IFN-c gene were detected by agarose gel electrophoresis and sequence. Results showed that the reconstructed plasmids expressed high level of IFN-c (Fig. 1a), and the sequencing results showed that there was no difference with the reported sequence in Gene bank (data were not shown).We then transfected the MSCs with pcDNA3.1 or pcDNA3.1-IFNc plasmids for different days. The transfection efficiency was around 40 % (Fig. 1b). Expression level of IFN-c was detected the by RT-PCR and ELISA. Results showed that only pcDNA3.1-IFNc-transfected cells express high level of IFN-c. This IFN-c level significantly increased at day 2, reached the peak at day 3, and still detectable at day 7 (Fig. 1c, d). Moreover, we detected the surface markers of MSCs 48 h after transfection. Results showed that after transfection, Vector-MSCs and IFN-c-MSCs shared the similar phenotype. They were positive for CD105, CD44, CD90, and CD73, and negative for CD14, CD45, CD31, and CD34 (Fig. 1e), which were in accordance with the previous reports [22, 25]. These data together proved that we successfully modified MSCs with IFN-c gene. IFN-c gene delivery does not change the ability of proliferation and apoptosis of MSCs To detect the influence of transfection on basic characters of MSCs, cell vitality, proliferation, cell cycle, and apoptosis were detected using flow cytometry. MSCs were placed into 12-well plates at 80 % confluence. Each well was transfected with 1.6 lg of either pcDNA3.1-IFNc or pcDNA3.1.
Gene delivery with IFN-c-expression plasmids enhances the therapeutic effects of MSCs on DSS…
Fig. 1 IFN-c-MSCs successfully express high level of IFN-c. a The fragment electrophoretogram of reconstructed plasmids. b Transfection efficiency was detected by flow cytometry. IFN-c expression level of MSCs transfected with pcDNA3.1 (Vector-MSC) or pcDNA3.1-IFNc (IFN-c-MSC) was detected through RT-PCR
(c) and ELISA (d). Values are present as the mean ± SEM. *p \ 0.05, **p \ 0.01 compared to Vector-MSCs (Two-tailed unpaired t test). e Phenotypic surface antigens of MSCs transfected with pcDNA3.1 or pcDNA3.1-IFNc were analyzed. Data are representative of three independent experiments
Cell viability was detected 48 h later by using CCK8. Results showed that MSCs transfected with different plasmids had the same vitality (Fig. 2a). Proliferation assay showed that most of cells were at generation 3, and there was no significant difference between pcDNA3.1-IFNc and pcDNA3.1 transfected cells (Fig. 2b).
PI staining and cell cycle analysis showed that no obvious differences were shown in populations at G1, G2, and S phase between IFN-c-MSCs and Vector-MSCs (Fig. 2c). Subsequently, qRT-PCR was performed to detect some cell cycle-related genes, such as CCND1, CDK2, CDK4, and CDK6. No significant differences of them were
123
Y. Chen et al.
Fig. 2 Transfection does not change the ability of proliferation and apoptosis of MSCs. MSCs were transfected with different plasmids for 48 h. a Cell viabilities were determined by CCK8 assay (n = 5). b Proliferation Index was detected by CFSE staining and flow cytometry. c Cell cycle was detected by PI staining and flow cytometry, *p \ 0.05 compared to Vector-MSCs (Two-tailed
unpaired t test). d Cell cycle relative genes were analyzed by qRTPCR. e Apoptosis were analyzed by Annexin-V/PI staining and flow cytometry. In the scatter diagram, the proportion in lower right corner presents the early apoptosis cells and the proportion in top right corner presents the late apoptosis cells. ns no significant change
observed between IFN-c-MSCs and Vector-MSCs (Fig. 2d). We also detected the apoptosis of MSCs. Results showed that there was still no obvious difference between IFN-c-MSCs and Vector-MSCs (Fig. 2e).
lower than IFN-c transfected MSCs (IFN-c-MSC); When MSCs:PBMC = 1:50, resting MSCs could not significantly inhibit the proliferation of T cells, but both IFN-cMSC and rhIFN-c-MSC could inhibit the proliferation of T cells obviously (Fig. 3b). These results implicated that IFN-c-MSCs had more potent immunosuppressive effects on the proliferation of T cells than resting MSCs.
IFN-c gene delivery enhances immunosuppressive properties of MSCs in vitro
IFN-c-MSCs ameliorate DSS-induced mouse colitis To detect the immunosuppressive effects of IFN-c-MSCs, mixed lymphocytes reaction was performed. As shown in Fig. 3a, when MSCs:PBMC = 1:10, MSCs significantly inhibited the proliferation of T lymphocytes and the inhibition rate of recombinant human IFN pretreated MSCs (rhIFN-c-MSC) was higher than resting MSCs but still
123
Given the augmented immunosuppressive properties of IFN-c-MSCs in vitro, we examined the anti-inflammatory effects of IFN-c-MSCs in vivo using a DSS-induced colitis model (Fig. 4a). Similar to previous reports [5, 26], we confirmed that oral administration of 3 % DSS for 7 days
Gene delivery with IFN-c-expression plasmids enhances the therapeutic effects of MSCs on DSS…
Fig. 3 IFN-c-MSCs enhance immunosuppressive properties in vitro. PBMCs (1 9 105 cells) were stimulated with anti-CD3/CD28 antibody and co-cultured with MSCs which were different handled. The ratio of MSC with PBMC was 1:10 (a) or 1:50 (b). Proliferation was measured by 3H-thymidine uptake in counts per minute and expressed
as a percentage of PBMC proliferation in the absence of MSCs (n = 5). *p \ 0.05, **p \ 0.01, ***p \ 0.001 (One-way ANOVA and nonparametric). Data are representative of three independent experiments
induced acute colitis in C57BL/6 mice characterized by an overall elevation of colitis scores based on the presence of sustained weight loss (Fig. 4b–d). Histological examination showed that DSS-induced colitis affected all layers of the colon, including sub-mucosal edema and leukocyte infiltration and disruption of crypt architecture (Fig. 4e). These same results were also reflected by histology score (Fig. 4f). Importantly, our results showed that systemic infusion with IFN-c-MSCs recovered the loss of body weight (Fig. 4b), reduced the overall disease severity (Fig. 4c, d), and protected mice against colitis-related tissue injuries (Fig. 4e, f). The body weight recovery reflected that IFN-c gene-modified MSCs were more effective than recombinant human IFN-c pretreated MSCs (Fig. 4b).
and shifted to a Th2 type. The increase of Treg and Th2 cells but decrease of Th17 and Th1 cells may contribute to the IFN-c-MSCs induced amelioration of colitis.
IFN-c-MSCs alter the balance of immune cells in vivo To confirm the role of IFN-c-MSCs in DSS-induced colitis, we next analyzed the profiles of T lymphocytes in MLN and spleen. As we all know, CD4? Th cells can be roughly classified into Th1, Th2, Th17, and regulatory T cells (Treg cells). We then evaluate the effect of different handled MSCs on the change of T cells. We observed increased percentage of Treg cells and decreased percentage of Th17 cells both in MLN and spleen of different MSC-treated mice, and the IFN-c-MSC-treated mice showed the most significant changes (Fig. 5a, b). These results suggested that MSCs regulated the differentiation of CD4? T cells. In addition, a percentage of Th1 cells were decreased in MLN and a percentage of Th2 cells were increased both in MLN and spleen of IFN-c-MSC-treated mice (Fig. 5c, d), which suggested that IFN-c-MSCs regulated the Th1/Th2 balance
IFN-c-MSCs increase the expression of IDO and decrease the expression of inflammation factors in colons To detect the inflammation level of colons, we extracted the total RNA and assayed the gene level of IDO and inflammatory factors, such as IL-6, IL-1b, and TNF-a. We observed that the expression level of IDO in IFN-c-MSCtreated mice was higher than other groups (Fig. 6a). This indicated that there might be more MSCs migrated to the inflammatory sites of IFN-c-MSC-treated mice. The increased expression of IL-6, IL-1b, and TNF-a in inflamed clones was confirmed by qRT-PCR. Systemic infusion with IFN-c-MSCs significantly decreased the expression of inflammatory factors, and the inhibition rate was similar or even higher than those infused with rhIFNc-MSCs (Fig. 6b–d). These results proved that the inflammation in IFN-c-MSC-treated group was less than other groups.
Discussion MSCs are pluripotent cells and can be isolated from many tissues including bone marrow, adipose tissue, adult muscle, and corneal stroma [27]. Umbilical cord tissue-derived MSCs have many advantages, such as noninvasive accessibility, lack of ethical controversy, reduced risk of viral contamination, higher proliferation rate, and differentiation
123
Y. Chen et al.
Fig. 4 IFN-c-MSCs ameliorate DSS-induced mouse colitis. Colitis was induced by oral administration of 3 % DSS in drinking water for 7 days. One 9 106 of different treated MSCs in 200 ll of PBS were injected into mice by cauda vein 2 day after initiation of DSS treatment (a). Mice without any treatment (CON) or mice that received 200 ll of PBS (DSS ? PBS) served as controls. Severity
and curative effect were monitored every day by body weight change (b), colon picture (c), and disease activity index (d). Colon sections were examined by H&E staining (e) and histopathological scoring (f). Values are expressed as the mean ± SEM. *p \ 0.05, **p \ 0.01 (One-way ANOVA and nonparametric). n = 10 miceper group for (b–d) and 5 mice per group for (e, f)
capacity, which make them highly suitable for further development of novel cell-based therapeutic potential. Although MSCs are known to have immunosuppressive effects, the mechanisms of immunosuppression are still controversial. Evidence has emerged that the immunosuppressive ability of resting MSCs is not strong, but it could be augmented by proinflammatory cytokines [28]. When
exposed to inflammatory signals, MSCs were found to significantly potentiate the immunosuppressive effects on T cells, monocytes/macrophages, and dendritic cells [29– 31]. These data were also validated in vivo using animal models, where IFN-c pretreatment improved MSC efficacy for the treatment of DSS or trinitrobenzene sulfonate (TNBS)-induced colitis in mice [10]. In the present study,
123
Gene delivery with IFN-c-expression plasmids enhances the therapeutic effects of MSCs on DSS…
Fig. 5 IFN-c-MSCs increase the proportion of Treg lymphocytes and decrease the proportion of Th 17 lymphocytes. a–d Treg, Th17, Th1, and Th2 cells in MLN and spleen of mice were analyzed by flow
cytometry. n = 5–6 mice per group. Values are expressed as the mean ± SEM. *p \ 0.05, **p \ 0.01, ***p \ 0.001 (One-way ANOVA and nonparametric)
Fig. 6 IFN-c-MSCs alter the expression level of IDO and some inflammation factors in colons. a–d The expression levels of IDO and colonic inflammatory cytokines (IL-6, IL-1b, and TNF-a) from different groups of mice were evaluated by qRT-PCR. Values are expressed as the mean ± SEM. *p \ 0.05, **p \ 0.01, ***p \ 0.001 (One-way ANOVA and nonparametric)
we delivered IFN-c gene to MSCs by transfecting pcDNA3.1-IFN-c plasmids so that MSCs could produce high level of IFN-c and last for 1 week. This modification
significantly enhanced the inhibition activity of MSCs on T cell proliferation (Fig. 3). Furthermore, significantly reduced disease severity was observed in IFN-c-MSCs
123
Y. Chen et al.
infused mice of DSS-induced colitis (Fig. 4). Intriguingly, the immunosuppressive activity of IFN-c-MSCs was similar or even greater than the recombinant human IFN-c pretreated cells (rhIFN-c-MSCs). Although rhIFN-c treatment could enhance the function of MSCs to some extent, the effect would not last long, and therefore, multiple MSCs injections were needed in clinical application. However, with IFN-c gene delivery, MSCs would be stably and continuously activated, so that the function would be more efficient and last for a longer time. In the present study, the improvement by IFN-c gene delivery was not so strong. This may be due to the low transfection efficiency. In the long run, a robust, safe, and efficient protocol of transfection is needed for an optimal use of genetically engineered MSCs for clinical applications. Inspite of this, IFN-c gene delivery of MSCs can be used as a tool for molecular and biological mechanism studies and therefore accelerates the use of genetically engineered MSCs in clinical applications. Based on the reduced disease severity, we tried to elucidate the putative mechanisms by which the IFN-c overexpressed MSCs could improve the immunosuppressive activities. Resent data suggest that the balance of Th17/Tregs contributes to the MSC-mediated immunosuppressive effects [32]. They prove that MSCs suppress the survival as well as the proliferation of T cells partially by increasing the proportion of regulatory T cells in vitro [33]. What is more, MSCs can negatively regulate both Th1 and Th17 responses and restore the balance of Th17/ Tregs in experimental autoimmune uveoretinitis [34]. Here, our results demonstrate that IFN-c-MSCs increase the proportion of CD4?CD25?FoxP3? regulatory T cells (Tregs), decrease the proportion of Th17, and influence the balance of Th1 and Th2 in MLN and spleen. These results are in accordance with the reports mentioned above. Indoleamine-2, 3 dioxygenase (IDO), an enzyme participating in the conversion of tryptophan into kynurenine, can be strongly promoted by IFN-c in human MSCs. Some reports show that IDO mediates inhibition of normal T cell proliferation, and the CD8? T cell-IFN-c-IDO axis is required for the therapeutic effects of allogeneic MSCs in lupus patients [35, 36]. However, resent study reveals a new immunosuppressive property of IFN-c-licensed MSCs [37]. It shows that IFN-c-licensed MSCs up-regulate IDO expression and activation, suppress T cell proliferation and effector function, but the suppression of T cell effector function by IFN-c-licensed MSCs is independent of IDO. In the present study, we prove that IFN-c-MSCs inhibit T cell proliferation and obviously increase IDO expression in the mouse colon. But whether IDO can directly influence T cell effector function in this system is still unknown and needs further investigation.
123
In conclusion, we successfully modify MSCs with IFNc-expression plasmids and prove that IFN-c-MSCs can obviously suppress T cell proliferation and ameliorate the symptoms of mouse colitis induced by DSS. This study provides a theoretical basis for the further use of genetically modified MSCs and makes them more suitable for the treatment of related diseases. Acknowledgments This work was supported by the Clinical Medicine Science and Technology Projects of Jiangsu Province (BL2014069), the National Natural Science Foundation of China (81101552), and the Natural Science Foundation of Jiangsu Province (BK2011571).
References 1. Hanauer SB. Inflammatory bowel disease: epidemiology, pathogenesis, and therapeutic opportunities. Inflamm Bowel Dis. 2006;12(Suppl 1):S3–9. 2. Ng SC, Bernstein CN, Vatn MH, Lakatos PL, Loftus EV Jr, Tysk C, et al. Geographical variability and environmental risk factors in inflammatory bowel disease. Gut. 2013;62:630–49. 3. Geremia A, Biancheri P, Allan P, Corazza GR, Di Sabatino A. Innate and adaptive immunity in inflammatory bowel disease. Autoimmun Rev. 2014;13:3–10. 4. Gonza´lez MA, Gonzalez-Rey E, Rico L, Bu¨scher D, Delgado M. Adipose-derived mesenchymal stem cells alleviate experimental colitis by inhibiting inflammatory and autoimmune responses. Gastroenterology. 2009;136:978–89. 5. Gonzalez-Rey E, Anderson P, Gonza´lez MA, Rico L, Bu¨scher D, Delgado M. Human adult stem cells derived from adipose tissue protect against experimental colitis and sepsis. Gut. 2009;58:929–39. 6. He XW, He XS, Lian L, Wu XJ, Lan P. Systemic infusion of bone marrow-derived mesenchymal stem cells for treatment of experimental colitis in mice. Dig Dis Sci. 2012;57:3136–44. 7. Shi Y, Hu G, Su J, Li W, Chen Q, Shou P, et al. Mesenchymal stem cells: a new strategy for immunosuppression and tissue repair. Cell Res. 2010;20:510–8. 8. Hemeda H, Jakob M, Ludwig AK, Giebel B, Lang S, Brandau S. Interferon-gamma and tumor necrosis factor-alpha differentially affect cytokine expression and migration properties of mesenchymal stem cells. Stem Cells Dev. 2010;19:693–706. 9. Tanaka F, Tominaga K, Ochi M, Tanigawa T, Watanabe T, Fujiwara Y, et al. Exogenous administration of mesenchymal stem cells ameliorates dextran sulfate sodium-induced colitis via anti-inflammatory action in damaged tissue in rats. Life Sci. 2008;83:771–9. 10. Duijvestein M, Wildenberg ME, Welling MM, Hennink S, Molendijk I, van Zuylen VL, et al. Pretreatment with interferon-c enhances the therapeutic activity of mesenchymal stromal cells in animal models of colitis. Stem Cells. 2011;29:1549–58. 11. Ren G, Zhang L, Zhao X, Xu G, Zhang Y, Roberts AI, et al. Mesenchymal stem cell-mediated immunosuppression occurs via concerted action of chemokines and nitric oxide. Cell Stem Cell. 2008;2:141–50. 12. Krampera M, Cosmi L, Angeli R, Pasini A, Liotta F, Andreini A, et al. Role for interferon-gamma in the immunomodulatory activity of human bone marrow mesenchymal stem cells. Stem Cells. 2006;24:386–98. 13. Fan H, Zhao G, Liu L, Liu F, Gong W, Liu X, et al. Pre-treatment with IL-1b enhances the efficacy of MSC transplantation in DSSinduced colitis. Cell Mol Immunol. 2012;9:473–81.
Gene delivery with IFN-c-expression plasmids enhances the therapeutic effects of MSCs on DSS… 14. Ryan JM, Barry F, Murphy JM, Mahon BP. Interferon-gamma does not break, but promotes the immunosuppressive capacity of adult human mesenchymal stem cells. Clin Exp Immunol. 2007;149:353–63. 15. Ren G, Zhao X, Zhang L, Zhang J, L’Huillier A, Ling W, et al. Inflammatory cytokine-induced intercellular adhesion molecule-1 and vascular cell adhesion molecule-1 in mesenchymal stem cells are critical for immunosuppression. J Immunol. 2010;184: 2321–8. 16. Croitoru-Lamoury J, Lamoury FM, Caristo M, Suzuki K, Walker D, Takikawa O, et al. Interferon-c regulates the proliferation and differentiation of mesenchymal stem cells via activation of indoleamine 2,3 dioxygenase (IDO). PLoS ONE. 2011;6: e14698. 17. Franc¸ois M, Romieu-Mourez R, Li M, Galipeau J. Human MSC suppression correlates with cytokine induction of indoleamine 2, 3-dioxygenase and bystander M2 macrophage differentiation. Mol Ther. 2012;2012(20):187–95. 18. Noone C, Kihm A, English K, O’Dea S, Mahon BP. IFN-c stimulated human umbilical-tissue-derived cells potently suppress NK activation and resist NK-mediated cytotoxicity in vitro. Stem Cells Dev. 2013;22:3003–14. 19. Sivanathan KN, Gronthos S, Rojas-Canales D, Thierry B, Coates PT. Interferon-gamma modification of mesenchymal stem cells: implications of autologous and allogeneic mesenchymal stem cell therapy in allotransplantation. Stem Cell Rev. 2014;10:351–75. 20. Kim DJ, Kim KS, Song MY, Seo SH, Kim SJ, Yang BG, et al. Delivery of IL-12p40 ameliorates DSS-induced colitis by suppressing IL-17A expression and inflammation in the intestinal mucosa. Clin Immunol. 2012;144:190–9. 21. Ankrum JA, Dastidar RG, Ong JF, Levy O, Karp JM. Performance-enhanced mesenchymal stem cells via intracellular delivery of steroids. Sci Rep. 2014;4:4645. 22. Liu L, Zhao X, Li P, Zhao G, Wang Y, Hu Y, et al. A novel way to isolate MSCs from umbilical cords. Eur J Immunol. 2012;42:2190–3. 23. Neurath MF, Fuss I, Kelsall BL, Stu¨ber E, Strober W. Antibodies to interleukin 12 abrogate established experimental colitis in mice. J Exp Med. 1995;182:1281–90. 24. Zuo L, Huang Z, Dong L, Xu L, Zhu Y, Zeng K, et al. Targeting delivery of anti-TNF alpha oligonucleotide into activated colonic macrophages protects against experimental colitis. Gut. 2010;59: 470–9. 25. Tondreau T, Meuleman N, Delforge A, Dejeneffe M, Leroy R, Massy M, et al. Mesenchymal stem cells derived from CD133positive cells in mobilized peripheral blood and cord blood: proliferation, Oct4 expression, and plasticity. Stem Cells. 2005;23:1105–12.
26. Alex P, Zachos NC, Nguyen T, Gonzales L, Chen TE, Conklin LS, et al. Distinct cytokine patterns identified from multiplex profiles of murine DSS and TNBS-induced colitis. Inflamm Bowel Dis. 2009;15:341–52. 27. Uccelli A, Moretta L, Pistoia V. Mesenchymal stem cells in health and disease. Nat Rev Immunol. 2008;8:726–36. 28. Bukulmez H, Bilgin A, Bebek G, Caplan AI, Jones O. A125: immunomodulatory factors produced by mesenchymal stem cells after in vitro priming with danger signals. Arthritis Rheumatol. 2014;66(Suppl 11):S163. 29. English K, Barry FP, Field-Corbett CP, Mahon BP. IFN-gamma and TNF-alpha differentially regulateimmunomodulation by murine mesenchymal stem cells. Immunol Lett. 2007;110: 91–100. 30. Zhao X, Liu D, Gong W, Zhao G, Liu L, Yang L, et al. The tolllike receptor 3 ligand, poly (I:C), improves immunosuppressive function and therapeutic effect of mesenchymal stem cells on sepsis via inhibiting miR-143. Stem Cells. 2014;32:521–33. 31. Dumitru CA, Hemeda H, Jakob M, Lang S, Brandau S. Stimulation of mesenchymal stromal cells (MSCs) via TLR3 reveals a novel mechanism of autocrine priming. FASEB J. 2014;28: 3856–66. 32. Luz-Crawford P, Kurte M, Bravo-Alegrı´a J, Contreras R, NovaLamperti E, Tejedor G, et al. Mesenchymal stem cells generate a CD4? CD25? Foxp3? regulatory T cell population during the differentiation process of Th1 and Th17 cells. Stem Cell Res Ther. 2013;4:65. 33. Han KH, Ro H, Hong JH, Lee EM, Cho B, Yeom HJ, et al. Immunosuppressive mechanisms of embryonic stem cells and mesenchymal stem cells in alloimmune response. Transpl Immunol. 2011;25:7–15. 34. Li G, Yuan L, Ren X, Nian H, Zhang L, Han ZC, et al. The effect of mesenchymal stem cells on dynamic changes of T cell subsets in experimental autoimmune uveoretinitis. Clin Exp Immunol. 2013;173:28–37. 35. Meisel R, Zibert A, Laryea M, Go¨bel U, Da¨ubener W, Dilloo D. Human bone marrow stromal cells inhibit allogeneic T-cell responses by indoleamine 2, 3-dioxygenase-mediated tryptophan degradation. Blood. 2004;103:4619–21. 36. Wang D, Feng X, Lu L, Konkel JE, Zhang H, Chen Z, et al. A CD8 T cell-IDO axis is required for mesenchymal stem cell suppression of human SLE. Arthritis Rheumatol. 2014;66: 2234–45. 37. Chinnadurai R, Copland IB, Patel SR, Galipeau J. IDO-independent suppression of T cell effector function by IFN-c-licensed human mesenchymal stromal cells. J Immunol. 2014;192: 1491–501.
123
