Tumor Biol. DOI 10.1007/s13277-014-2190-8
RESEARCH ARTICLE
Gemcitabine impacts differentially on bladder and kidney cancer cells: distinct modulations in the expression patterns of apoptosis-related microRNAs and BCL2 family genes Emmanuel I. Papadopoulos & George M. Yousef & Andreas Scorilas
Received: 16 March 2014 / Accepted: 3 June 2014 # International Society of Oncology and BioMarkers (ISOBM) 2015
Abstract Bladder and renal cancer are two representative cases of tumors that respond differentially to gemcitabine. Previous studies have shown that gemcitabine can trigger apoptosis in various cancer cells. Herein, we sought to investigate the impact of gemcitabine on the expression levels of the BCL2 family members BCL2, BAX, and BCL2L12 and the apoptosis-related microRNAs miR-182, miR-96, miR-145, and miR-16 in the human bladder and kidney cancer cell lines T24 and Caki-1, respectively. Cancer cells’ viability as well as the IC50 doses of gemcitabine were estimated by the MTT assay, while the detection of cleaved PARP via Western blotting was used as an indicator of apoptosis. Furthermore, T24 and Caki-1 cells’ ability to recover from treatment was also monitored. Two different highly sensitive quantitative realtime RT-PCR methodologies were developed in order to assess the expression levels of BCL2 family genes and microRNAs. Exposure of cancer cells to gemcitabine produced the IC50 values of 30 and 3 nM for Caki-1 and T24 cells, correspondingly, while cleaved PARP was detected only in Caki-1 cells. T24 cells demonstrated the ability to recover from gemcitabine treatment, whereas Caki-1 cells’ recovery capability was dependent on the initial time of exposure. BCL2 and BAX were significantly modulated in treated Caki-1 cells. Instead, T24 cells exhibited alterations only in the latter, as well as in all studied microRNAs. Therefore, according to our data, bladder and renal cancer cells’ response to gemcitabine is accompanied by distinct alterations in the E. I. Papadopoulos : A. Scorilas (*) Department of Biochemistry and Molecular Biology, Faculty of Biology, University of Athens, Panepistimiopolis, Athens 15701, Greece e-mail: [email protected] G. M. Yousef Department of Laboratory Medicine and Pathobiology, University of Toronto, Toronto, Ontario, Canada
expression levels of their apoptosis-related genes and microRNAs. Keywords T24 urinary bladder cancer cell line . Caki-1 renal cancer cell line . BCL2L12 . Gemcitabine . MicroRNAs . BCL2 family
Introduction Apoptosis, a highly regulated process, can remove damaged or unwanted cells from multicellular organisms as a response to a wide variety of stimuli and conditions both physiological and pathological [1]. Evasion of apoptosis remains one of the hallmarks of human cancers [2]. Most anticancer drugs primarily act by activating cell death pathways, including apoptosis [3]. The apoptotic process is either executed or regulated by specific protein families such as the aspartate-specific cysteine proteases, caspases, or the BCL2 family [4, 5]. The latter consists of proteins that share structural similarities relevant to a total of four structural domains, designated as BH (BCL2-homology) domains. According to their regulatory role, the members of the BCL2 family are divided into antiapoptotic or pro-survival, which protect cells from apoptosis, and proapoptotic that promote apoptotic cell death [5]. Up to date, the BCL2 family accounts for more than 25 members [5]. Two of the most widely studied members of the family are the antiapoptotic homonym founding member, B cell CLL/lymphoma 2 (BCL2) [6, 7] and the proapoptotic BCL-2-associated X protein (BAX) [8]. Recently, the discovery of a novel BCL2 family member has been reported, known as BCL2-like 12 (proline rich) (BCL2L12) [9]. The function of BCL2L12 in the apoptotic machinery remains somewhat obscure [10], its expression though seems to be significantly modulated by apoptosis-inducing antineoplastic drugs [11, 12]. In general, the detection of aberrations in
Tumor Biol.
BCL2 family genes expression has been correlated with tumorigenesis and chemoresistance [13]. In the last decade, there has been accumulated evidence that a new class of non protein-coding small RNAs, named microRNAs (miRNAs), plays a pivotal role in cell proliferation, survival, and death. miRNAs are single-stranded RNA molecules of about 20–23 nucleotides length. They are endogenously expressed as long primary transcripts that are further processed in mature miRNAs, which suppress the expression of the protein-coding genes by binding directly to their target mRNAs [14]. Several studies have demonstrated that miRNAs can exhibit a significant regulatory function in apoptosis [15]. A growing amount of experimental data has proved that miRNAs can affect all molecular processes that have been linked to cancer, including evasion of apoptosis and development of chemoresistance [16]. The majority of current anticancer drugs primarily aim to restore or activate cell death pathways in cancer cells [3]. The use of antimetabolites, which directly interfere with DNA replication, is a common strategy in cancer treatment. These substances affect DNA synthesis and usually trigger initiation of the intrinsic pathway of apoptosis, as a response to the DNA damage they provoked. However, the activation of the apoptotic machinery of the cell does not always result in cell death, as the balance between cell death and survival is subtle [3, 13]. Gemcitabine (2′,2′-difluorodeoxycytidine) is a deoxycytidine analog used as a chemotherapeutic drug. The major action of gemcitabine is the disruption of DNA synthesis either directly after incorporating a nucleoside analog to the newly synthesized DNA strand or indirectly via inhibition of ribonucleotide reductase. The administration of gemcitabine is indicated for a variety of cancer types, including urological malignancies [17]. Bladder and kidney cancers are among the most frequent urogenital malignancies [18]. Approximately 90 % of tumors originating in the kidney are renal cell carcinomas (RCC), while the clear cell RCC is the most common histological type of RCC [19]. The prognosis for all advanced RCC patients is poor, while the treatment options include immunotherapy and targeted therapy, but not chemotherapy [20]. In bladder cancer, transitional cell carcinoma (TCC) is the most frequent histological type exceeding 90 % of all bladder carcinoma cases [21]. The combined administration of gemcitabine and cisplatin remains a standard treatment option for patients with advanced bladder cancer [21]. Instead, patients with RCC who were treated with gemcitabine exhibited a moderate to negative response rate to this drug [22, 23]. Based on the above knowledge, we focused on studying the impact of gemcitabine on the expression levels of specifically selected apoptosis-related microRNAs and BCL2 family genes of cancer cells derived from malignancies that according to clinical data respond differentially to this drug. Given that renal cancer is refractory to gemcitabine, while
bladder cancer responds well to the aforementioned antimetabolite, the established RCC cell line Caki-1 and the respective urinary bladder TCC cell line T24 were selected as representative models for our study. The expression levels of BCL2, BAX, and BCL2L12, as well as those of miR-182, miR96, miR-145, and miR-16 were assessed in the above cancer cells following treatment with gemcitabine and the produced data were further analyzed in order to trace all significant modulations induced by this antineoplastic agent.
Materials and methods Cell culture The human cancer cell lines T24 and Caki-1 were cultured in McCoy's 5A Medium (PAA Laboratories GmbH, Pasching, Austria) modified to contain 1.5 mM L-glutamine, supplemented with 10 % fetal bovine serum (FBS), 100 kU/L penicillin, and 0.1 g/L streptomycin. Cells were incubated at 37 °C in a humidified atmosphere of 5 % CO2 in air. Gemcitabine treatment Both T24 and Caki-1 cancer cells were seeded in a density of 104 cells/mL in cell culture flasks and were left overnight to attach and adapt to culture conditions. Thereafter, gemcitabine (Gemzar; Eli Lilly, Indianapolis, IN, USA) was added to the culture medium and the cells were incubated with this drug for 24, 36, and 48 h. For each incubation period, a control sample of untreated cancer cells was also placed in the incubator. Cancer cells from both cell lines that were exposed to gemcitabine for 36 and 48 h were also tested for their ability to recover from treatment. For that purpose, at the aforementioned time points, the gemcitabine-containing medium was replaced by fresh medium that did not contain the drug and T24 and Caki-1 cells were left to recover in the incubator for 24 and 36 h, correspondingly. The incubation period during recovery experiment was selected according to the suggested doubling time of each cancer cell line. At the end of the recovery period, the cells were observed under a microscope and their recovery potential was assessed based on the amount of floating dead cells and cell confluency. MTT cytotoxicity assay The tetrazolium salt 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT; Sigma-Aldrich, St. Louis, MO, USA) was used as an indicator of cell viability following the exposure of cancer cells to gemcitabine. The MTT colorimetric assay was performed on both cell lines in order to determine the half maximal inhibitory concentration (IC50) of this drug. Briefly, for both cell lines, 104 cells/mL were seeded
Tumor Biol.
in 96-well plates in quadruplicate and were left to adhere overnight. Cells were then treated with different concentrations of gemcitabine for specific time intervals set to 24, 36, and 48 h. Ten microliters of aqueous solution of MTT (5 mg/ mL in PBS) per 100 μL of cell suspension was added in each well at the selected time points. After a 4-h incubation at 37 °C, the supernatant was replaced by 100 μL of a solution containing 12.5 % (w/v) SDS and 45 % (v/v) formamide to lyse the cells and dissolve the enzymatically produced formazan. Finally, the absorbance of cell lysates was measured using a microtiter plate reader (HumaReader; Human GmbH, Wiesbaden, Germany) at the wave length of 550 nm with a reference wavelength set at 630 nm. Cell viability analysis The Trypan Blue exclusion method was performed to cancer cells of both cell lines treated with the corresponding IC50 doses of gemcitabine for 24, 36, and 48 h. In particular, following their incubation with this compound, the treated cells were initially trypsinized by using (1×) trypsin–EDTA (PAA Laboratories GmbH, Pasching, Austria) for 5 min at 37 °C. The resulting suspension was centrifuged and pelleted cells were resuspended in fresh culture medium. Fifty microliters of the final cell suspension was diluted 1:10 in (1×) PBS and subjected to Trypan Blue staining, while the rest of the volume was used for RNA and protein extraction. For Trypan Blue exclusion test, 18 μL of the diluted cell suspension was mixed with Trypan Blue solution (Sigma-Aldrich, St. Louis, MO, USA) at a final concentration of 0.04 (w/v) and the mixture was incubated for 5 min at room temperature. The concentration of Trypan Blue positively stained cells was determined using a hemocytometer. qRT-PCR detection For the analysis of the expression of microRNAs and BCL2 family genes included in our study, Caki-1 and T24 cells of the experiments conducted were initially subjected to total RNA extraction by using the TRI Reagent (Ambion Ltd, Huntingdon, UK) according to the manufacturer’s instructions. The total RNA concentration and purity were assessed spectrophotometrically at 260 and 280 nm, while its integrity was examined by electrophoretic analysis. Two different qRT-PCR methodologies were performed for the assessment of the expression levels of genes and miRNAs analyzed herein, respectively. In detail, for BCL2, BAX, and BCL2L12 expression analysis, 2 μg of total RNA was reverse transcribed into first-strand cDNA (20 μL) using M-MuLV Reverse Transcriptase RNase H– (Finnzymes, Espoo, Finland) following the manufacturer's recommendations. Subsequently, a real-time PCR protocol was developed for each gene by using SYBR Green I as the chemical detection system and the
housekeeping gene beta-2-microglobulin (B2M) as the endogenous control. Based on the published nucleotide sequences of BCL2 (GenBank: NM_000633.2), BAX (GenBank: NM_004324.3), BCL2L12 (GenBank: NM_138639.1), and B2M (GenBank: NM_004048.2), a set of oligonucleotide primers was designed and synthesized for the amplification of each gene (BCL2 forward: 5′-TCGCCCTGTGGATGAC TGA-3′, reverse: 5′-CAGAGACAGCCAGGAGAAATCA3′; BAX forward: 5′-TGGCAGCTGACATGTTTTCTGAC3′, reverse: 5′-TCACCCAACCACCCTGGTCTT-3′; BCL2L12 forward: 5′-CCCTCGGCCTTGCTCTCT-3′, reverse: 5′-TCCGCAGTATGGCTTCCTTCT-3′; B2M forward: 5′-ACTGAATTCACCCCCACTGA-3′, reverse: 5′-AAGC AAGCAAGCAGAATTTGG-3′). For each assay, a reaction mixture (10 μL) consisting of 20 ng of cDNA, (2×) KAPA SYBR® FAST qPCR Master Mix (Kapa Biosystems, Charlestown, MA, USA), and 50 nM of each primer was prepared. Real-time PCR reactions were carried out in an ABI 7500 thermal cycler (Applied Biosystems, Foster City, USA) and all samples were assayed in triplicate. The amplification protocol was performed as follows: one step at 95 °C for 3 min, followed by 40 cycles of 95 °C for 15 s (denaturation), and 60 °C for 1 min (primer annealing/extension). As for miR-96, miR-182, miR-145, and miR-16 expression analysis, four different qRT-PCR protocols were developed according to the methodology suggested by Shi et al. [24]. Following the latter, total RNA was firstly subjected to a polyadenylation reaction in order to incorporate a poly(A) tail to mature miRNAs. For that purpose, 1 μg of total RNA was added to a 10 μL reaction mixture containing 2 U of Escherichia coli Poly(A) Polymerase (PAP; New England Biolabs, Hertfordshire, UK), 1 mM ATP, and (1×) PAP buffer. The reaction mixture was incubated at 37 °C for 1 h for the generation of the poly(A) tail to RNA molecules, which were subsequently reverse transcribed to cDNA inside the initial reaction tube. This was achieved by using M-MuLV Reverse Transcriptase RNase H– (Finnzymes, Espoo, Finland) according to the manufacturer’s instructions, 0.5 μM of a poly(T) adapter (5′GCGAGCACAGAATTAATACGACTCACTATAGGTTTT TTTTTTTTVN-3′, V = A, G, C; N = A, T, G, C) and RNasefree water to reach a final reaction volume of 20 μL. qRT-PCR was then performed by also using SYBR Green I as the chemical detection system, selecting though the small nucleolar RNA, C/D box 48 (SNORD48; also known as RNU48) as a reference gene. The amplification of small RNAs-derived cDNAs was achieved after designing and synthesizing a pair of oligonucleotide primers. All set of primers consisted of a universal reverse primer (5′-GCGAGCACAGAATTAATA CGAC-3′), complementary to the 5′-end sequence of the poly(T) adapter and a small RNA-specific forward primer (RNU48: 5′-TGATGATGACCCCAGGTAACTCT-3′; miR96: 5′-TGGCACTAGCACATTTTTGCTAAA-3′; miR-182: 5′-TTTGGCAATGGTAGAACTCACA-3′; miR-145: 5′-
Tumor Biol.
CCAGTTTTCCCAGGAATCCCTAA-3′; miR-16: 5′-TAGC AGCACGTAAATATTGGCG-3′). The design of forward primers of miRNAs was based on the nucleotide sequence of hsa-miR-96-5p (MIMAT0000095), hsa-miR-182-5p (MIMAT0000259), hsa-miR-145-5p (MIMAT0000437), and hsa-miR-16-5p (MIMAT0000069), provided by the miRBase [25]. Additionally, in cases of miR-96 and miR-145, three and two extra adenosines, respectively, were added at the 3′ end of each primer, considering the sequence of the corresponding cDNA products. RNU48 (GenBank: NR_002745.1) forward primer was designed according to the GenBank provided information. For small RNAs quantification assay, the 10 μL reaction mixture consisted of 5 ng of cDNA, (2×) KAPA SYBR® FAST qPCR Master Mix (Kapa Biosystems, Charlestown, MA, USA), 200 nM of reverse, and 200 nM of forward primer. The thermal cycling conditions were the same as those used for mRNA quantification, apart from miR-145 for which the stage of primer annealing and extension was performed at 65 °C instead of 60 °C. Similar to mRNA analysis, each sample was assayed in triplicate. Following PCR, all reactions were subjected to melting curve analysis in order to verify the specificity of the generated PCR products. For the analysis of the real-time PCR results, relative quantification was performed by applying the comparative CT (2−ΔΔCT) method. Prior to analyzing our results, a validation experiment, constructing a standard curve for each gene or miRNA, was conducted, so as to assess the amplification efficiencies of the target and reference genes. The relative quantification (RQ) values, measured according to the 2−ΔΔCT formula, were subsequently used to calculate the fold change due to treatment or recovery. Fold change values due to drug treatment were calculated relative to the untreated cells, while fold change calculations due to recovery were performed using treated cells prior to recovery as calibrator. For the cells used as calibrator, the RQ values of all target genes were set at 1.0. Therefore, RQ values >1.0 imply that there is an increase in the expression of the target gene as a result of treatment or recovery, which represents the fold change. Instead, RQ values
RESEARCH ARTICLE
Gemcitabine impacts differentially on bladder and kidney cancer cells: distinct modulations in the expression patterns of apoptosis-related microRNAs and BCL2 family genes Emmanuel I. Papadopoulos & George M. Yousef & Andreas Scorilas
Received: 16 March 2014 / Accepted: 3 June 2014 # International Society of Oncology and BioMarkers (ISOBM) 2015
Abstract Bladder and renal cancer are two representative cases of tumors that respond differentially to gemcitabine. Previous studies have shown that gemcitabine can trigger apoptosis in various cancer cells. Herein, we sought to investigate the impact of gemcitabine on the expression levels of the BCL2 family members BCL2, BAX, and BCL2L12 and the apoptosis-related microRNAs miR-182, miR-96, miR-145, and miR-16 in the human bladder and kidney cancer cell lines T24 and Caki-1, respectively. Cancer cells’ viability as well as the IC50 doses of gemcitabine were estimated by the MTT assay, while the detection of cleaved PARP via Western blotting was used as an indicator of apoptosis. Furthermore, T24 and Caki-1 cells’ ability to recover from treatment was also monitored. Two different highly sensitive quantitative realtime RT-PCR methodologies were developed in order to assess the expression levels of BCL2 family genes and microRNAs. Exposure of cancer cells to gemcitabine produced the IC50 values of 30 and 3 nM for Caki-1 and T24 cells, correspondingly, while cleaved PARP was detected only in Caki-1 cells. T24 cells demonstrated the ability to recover from gemcitabine treatment, whereas Caki-1 cells’ recovery capability was dependent on the initial time of exposure. BCL2 and BAX were significantly modulated in treated Caki-1 cells. Instead, T24 cells exhibited alterations only in the latter, as well as in all studied microRNAs. Therefore, according to our data, bladder and renal cancer cells’ response to gemcitabine is accompanied by distinct alterations in the E. I. Papadopoulos : A. Scorilas (*) Department of Biochemistry and Molecular Biology, Faculty of Biology, University of Athens, Panepistimiopolis, Athens 15701, Greece e-mail: [email protected] G. M. Yousef Department of Laboratory Medicine and Pathobiology, University of Toronto, Toronto, Ontario, Canada
expression levels of their apoptosis-related genes and microRNAs. Keywords T24 urinary bladder cancer cell line . Caki-1 renal cancer cell line . BCL2L12 . Gemcitabine . MicroRNAs . BCL2 family
Introduction Apoptosis, a highly regulated process, can remove damaged or unwanted cells from multicellular organisms as a response to a wide variety of stimuli and conditions both physiological and pathological [1]. Evasion of apoptosis remains one of the hallmarks of human cancers [2]. Most anticancer drugs primarily act by activating cell death pathways, including apoptosis [3]. The apoptotic process is either executed or regulated by specific protein families such as the aspartate-specific cysteine proteases, caspases, or the BCL2 family [4, 5]. The latter consists of proteins that share structural similarities relevant to a total of four structural domains, designated as BH (BCL2-homology) domains. According to their regulatory role, the members of the BCL2 family are divided into antiapoptotic or pro-survival, which protect cells from apoptosis, and proapoptotic that promote apoptotic cell death [5]. Up to date, the BCL2 family accounts for more than 25 members [5]. Two of the most widely studied members of the family are the antiapoptotic homonym founding member, B cell CLL/lymphoma 2 (BCL2) [6, 7] and the proapoptotic BCL-2-associated X protein (BAX) [8]. Recently, the discovery of a novel BCL2 family member has been reported, known as BCL2-like 12 (proline rich) (BCL2L12) [9]. The function of BCL2L12 in the apoptotic machinery remains somewhat obscure [10], its expression though seems to be significantly modulated by apoptosis-inducing antineoplastic drugs [11, 12]. In general, the detection of aberrations in
Tumor Biol.
BCL2 family genes expression has been correlated with tumorigenesis and chemoresistance [13]. In the last decade, there has been accumulated evidence that a new class of non protein-coding small RNAs, named microRNAs (miRNAs), plays a pivotal role in cell proliferation, survival, and death. miRNAs are single-stranded RNA molecules of about 20–23 nucleotides length. They are endogenously expressed as long primary transcripts that are further processed in mature miRNAs, which suppress the expression of the protein-coding genes by binding directly to their target mRNAs [14]. Several studies have demonstrated that miRNAs can exhibit a significant regulatory function in apoptosis [15]. A growing amount of experimental data has proved that miRNAs can affect all molecular processes that have been linked to cancer, including evasion of apoptosis and development of chemoresistance [16]. The majority of current anticancer drugs primarily aim to restore or activate cell death pathways in cancer cells [3]. The use of antimetabolites, which directly interfere with DNA replication, is a common strategy in cancer treatment. These substances affect DNA synthesis and usually trigger initiation of the intrinsic pathway of apoptosis, as a response to the DNA damage they provoked. However, the activation of the apoptotic machinery of the cell does not always result in cell death, as the balance between cell death and survival is subtle [3, 13]. Gemcitabine (2′,2′-difluorodeoxycytidine) is a deoxycytidine analog used as a chemotherapeutic drug. The major action of gemcitabine is the disruption of DNA synthesis either directly after incorporating a nucleoside analog to the newly synthesized DNA strand or indirectly via inhibition of ribonucleotide reductase. The administration of gemcitabine is indicated for a variety of cancer types, including urological malignancies [17]. Bladder and kidney cancers are among the most frequent urogenital malignancies [18]. Approximately 90 % of tumors originating in the kidney are renal cell carcinomas (RCC), while the clear cell RCC is the most common histological type of RCC [19]. The prognosis for all advanced RCC patients is poor, while the treatment options include immunotherapy and targeted therapy, but not chemotherapy [20]. In bladder cancer, transitional cell carcinoma (TCC) is the most frequent histological type exceeding 90 % of all bladder carcinoma cases [21]. The combined administration of gemcitabine and cisplatin remains a standard treatment option for patients with advanced bladder cancer [21]. Instead, patients with RCC who were treated with gemcitabine exhibited a moderate to negative response rate to this drug [22, 23]. Based on the above knowledge, we focused on studying the impact of gemcitabine on the expression levels of specifically selected apoptosis-related microRNAs and BCL2 family genes of cancer cells derived from malignancies that according to clinical data respond differentially to this drug. Given that renal cancer is refractory to gemcitabine, while
bladder cancer responds well to the aforementioned antimetabolite, the established RCC cell line Caki-1 and the respective urinary bladder TCC cell line T24 were selected as representative models for our study. The expression levels of BCL2, BAX, and BCL2L12, as well as those of miR-182, miR96, miR-145, and miR-16 were assessed in the above cancer cells following treatment with gemcitabine and the produced data were further analyzed in order to trace all significant modulations induced by this antineoplastic agent.
Materials and methods Cell culture The human cancer cell lines T24 and Caki-1 were cultured in McCoy's 5A Medium (PAA Laboratories GmbH, Pasching, Austria) modified to contain 1.5 mM L-glutamine, supplemented with 10 % fetal bovine serum (FBS), 100 kU/L penicillin, and 0.1 g/L streptomycin. Cells were incubated at 37 °C in a humidified atmosphere of 5 % CO2 in air. Gemcitabine treatment Both T24 and Caki-1 cancer cells were seeded in a density of 104 cells/mL in cell culture flasks and were left overnight to attach and adapt to culture conditions. Thereafter, gemcitabine (Gemzar; Eli Lilly, Indianapolis, IN, USA) was added to the culture medium and the cells were incubated with this drug for 24, 36, and 48 h. For each incubation period, a control sample of untreated cancer cells was also placed in the incubator. Cancer cells from both cell lines that were exposed to gemcitabine for 36 and 48 h were also tested for their ability to recover from treatment. For that purpose, at the aforementioned time points, the gemcitabine-containing medium was replaced by fresh medium that did not contain the drug and T24 and Caki-1 cells were left to recover in the incubator for 24 and 36 h, correspondingly. The incubation period during recovery experiment was selected according to the suggested doubling time of each cancer cell line. At the end of the recovery period, the cells were observed under a microscope and their recovery potential was assessed based on the amount of floating dead cells and cell confluency. MTT cytotoxicity assay The tetrazolium salt 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT; Sigma-Aldrich, St. Louis, MO, USA) was used as an indicator of cell viability following the exposure of cancer cells to gemcitabine. The MTT colorimetric assay was performed on both cell lines in order to determine the half maximal inhibitory concentration (IC50) of this drug. Briefly, for both cell lines, 104 cells/mL were seeded
Tumor Biol.
in 96-well plates in quadruplicate and were left to adhere overnight. Cells were then treated with different concentrations of gemcitabine for specific time intervals set to 24, 36, and 48 h. Ten microliters of aqueous solution of MTT (5 mg/ mL in PBS) per 100 μL of cell suspension was added in each well at the selected time points. After a 4-h incubation at 37 °C, the supernatant was replaced by 100 μL of a solution containing 12.5 % (w/v) SDS and 45 % (v/v) formamide to lyse the cells and dissolve the enzymatically produced formazan. Finally, the absorbance of cell lysates was measured using a microtiter plate reader (HumaReader; Human GmbH, Wiesbaden, Germany) at the wave length of 550 nm with a reference wavelength set at 630 nm. Cell viability analysis The Trypan Blue exclusion method was performed to cancer cells of both cell lines treated with the corresponding IC50 doses of gemcitabine for 24, 36, and 48 h. In particular, following their incubation with this compound, the treated cells were initially trypsinized by using (1×) trypsin–EDTA (PAA Laboratories GmbH, Pasching, Austria) for 5 min at 37 °C. The resulting suspension was centrifuged and pelleted cells were resuspended in fresh culture medium. Fifty microliters of the final cell suspension was diluted 1:10 in (1×) PBS and subjected to Trypan Blue staining, while the rest of the volume was used for RNA and protein extraction. For Trypan Blue exclusion test, 18 μL of the diluted cell suspension was mixed with Trypan Blue solution (Sigma-Aldrich, St. Louis, MO, USA) at a final concentration of 0.04 (w/v) and the mixture was incubated for 5 min at room temperature. The concentration of Trypan Blue positively stained cells was determined using a hemocytometer. qRT-PCR detection For the analysis of the expression of microRNAs and BCL2 family genes included in our study, Caki-1 and T24 cells of the experiments conducted were initially subjected to total RNA extraction by using the TRI Reagent (Ambion Ltd, Huntingdon, UK) according to the manufacturer’s instructions. The total RNA concentration and purity were assessed spectrophotometrically at 260 and 280 nm, while its integrity was examined by electrophoretic analysis. Two different qRT-PCR methodologies were performed for the assessment of the expression levels of genes and miRNAs analyzed herein, respectively. In detail, for BCL2, BAX, and BCL2L12 expression analysis, 2 μg of total RNA was reverse transcribed into first-strand cDNA (20 μL) using M-MuLV Reverse Transcriptase RNase H– (Finnzymes, Espoo, Finland) following the manufacturer's recommendations. Subsequently, a real-time PCR protocol was developed for each gene by using SYBR Green I as the chemical detection system and the
housekeeping gene beta-2-microglobulin (B2M) as the endogenous control. Based on the published nucleotide sequences of BCL2 (GenBank: NM_000633.2), BAX (GenBank: NM_004324.3), BCL2L12 (GenBank: NM_138639.1), and B2M (GenBank: NM_004048.2), a set of oligonucleotide primers was designed and synthesized for the amplification of each gene (BCL2 forward: 5′-TCGCCCTGTGGATGAC TGA-3′, reverse: 5′-CAGAGACAGCCAGGAGAAATCA3′; BAX forward: 5′-TGGCAGCTGACATGTTTTCTGAC3′, reverse: 5′-TCACCCAACCACCCTGGTCTT-3′; BCL2L12 forward: 5′-CCCTCGGCCTTGCTCTCT-3′, reverse: 5′-TCCGCAGTATGGCTTCCTTCT-3′; B2M forward: 5′-ACTGAATTCACCCCCACTGA-3′, reverse: 5′-AAGC AAGCAAGCAGAATTTGG-3′). For each assay, a reaction mixture (10 μL) consisting of 20 ng of cDNA, (2×) KAPA SYBR® FAST qPCR Master Mix (Kapa Biosystems, Charlestown, MA, USA), and 50 nM of each primer was prepared. Real-time PCR reactions were carried out in an ABI 7500 thermal cycler (Applied Biosystems, Foster City, USA) and all samples were assayed in triplicate. The amplification protocol was performed as follows: one step at 95 °C for 3 min, followed by 40 cycles of 95 °C for 15 s (denaturation), and 60 °C for 1 min (primer annealing/extension). As for miR-96, miR-182, miR-145, and miR-16 expression analysis, four different qRT-PCR protocols were developed according to the methodology suggested by Shi et al. [24]. Following the latter, total RNA was firstly subjected to a polyadenylation reaction in order to incorporate a poly(A) tail to mature miRNAs. For that purpose, 1 μg of total RNA was added to a 10 μL reaction mixture containing 2 U of Escherichia coli Poly(A) Polymerase (PAP; New England Biolabs, Hertfordshire, UK), 1 mM ATP, and (1×) PAP buffer. The reaction mixture was incubated at 37 °C for 1 h for the generation of the poly(A) tail to RNA molecules, which were subsequently reverse transcribed to cDNA inside the initial reaction tube. This was achieved by using M-MuLV Reverse Transcriptase RNase H– (Finnzymes, Espoo, Finland) according to the manufacturer’s instructions, 0.5 μM of a poly(T) adapter (5′GCGAGCACAGAATTAATACGACTCACTATAGGTTTT TTTTTTTTVN-3′, V = A, G, C; N = A, T, G, C) and RNasefree water to reach a final reaction volume of 20 μL. qRT-PCR was then performed by also using SYBR Green I as the chemical detection system, selecting though the small nucleolar RNA, C/D box 48 (SNORD48; also known as RNU48) as a reference gene. The amplification of small RNAs-derived cDNAs was achieved after designing and synthesizing a pair of oligonucleotide primers. All set of primers consisted of a universal reverse primer (5′-GCGAGCACAGAATTAATA CGAC-3′), complementary to the 5′-end sequence of the poly(T) adapter and a small RNA-specific forward primer (RNU48: 5′-TGATGATGACCCCAGGTAACTCT-3′; miR96: 5′-TGGCACTAGCACATTTTTGCTAAA-3′; miR-182: 5′-TTTGGCAATGGTAGAACTCACA-3′; miR-145: 5′-
Tumor Biol.
CCAGTTTTCCCAGGAATCCCTAA-3′; miR-16: 5′-TAGC AGCACGTAAATATTGGCG-3′). The design of forward primers of miRNAs was based on the nucleotide sequence of hsa-miR-96-5p (MIMAT0000095), hsa-miR-182-5p (MIMAT0000259), hsa-miR-145-5p (MIMAT0000437), and hsa-miR-16-5p (MIMAT0000069), provided by the miRBase [25]. Additionally, in cases of miR-96 and miR-145, three and two extra adenosines, respectively, were added at the 3′ end of each primer, considering the sequence of the corresponding cDNA products. RNU48 (GenBank: NR_002745.1) forward primer was designed according to the GenBank provided information. For small RNAs quantification assay, the 10 μL reaction mixture consisted of 5 ng of cDNA, (2×) KAPA SYBR® FAST qPCR Master Mix (Kapa Biosystems, Charlestown, MA, USA), 200 nM of reverse, and 200 nM of forward primer. The thermal cycling conditions were the same as those used for mRNA quantification, apart from miR-145 for which the stage of primer annealing and extension was performed at 65 °C instead of 60 °C. Similar to mRNA analysis, each sample was assayed in triplicate. Following PCR, all reactions were subjected to melting curve analysis in order to verify the specificity of the generated PCR products. For the analysis of the real-time PCR results, relative quantification was performed by applying the comparative CT (2−ΔΔCT) method. Prior to analyzing our results, a validation experiment, constructing a standard curve for each gene or miRNA, was conducted, so as to assess the amplification efficiencies of the target and reference genes. The relative quantification (RQ) values, measured according to the 2−ΔΔCT formula, were subsequently used to calculate the fold change due to treatment or recovery. Fold change values due to drug treatment were calculated relative to the untreated cells, while fold change calculations due to recovery were performed using treated cells prior to recovery as calibrator. For the cells used as calibrator, the RQ values of all target genes were set at 1.0. Therefore, RQ values >1.0 imply that there is an increase in the expression of the target gene as a result of treatment or recovery, which represents the fold change. Instead, RQ values
