Chemico-Biological Interactions 222 (2014) 27–36

Contents lists available at ScienceDirect

Chemico-Biological Interactions journal homepage: www.elsevier.com/locate/chembioint

Gastroprotective effect and mechanism of patchouli alcohol against ethanol, indomethacin and stress-induced ulcer in rats Yi-Feng Zheng a,1, Jian-Hui Xie a,b,1, Yi-Fei Xu a,1, Yong-Zhuo Liang a, Zhi-Zhun Mo a, Wei-Wen Jiang a, Xiao-Ying Chen a, Yu-Hong Liu a, Xiao-Dan Yu a, Ping Huang a,c,⇑, Zi-Ren Su a,c,⇑ a b c

School of Chinese Materia Medica, Guangzhou University of Chinese Medicine, Guangzhou 510006, PR China The Second Affiliated Hospital, Guangzhou University of Chinese Medicine, Guangzhou 510006, PR China Dongguan Mathematical Engineering Academy of Chinese Medicine, Guangzhou University of Chinese Medicine, Dongguan 510006, PR China

a r t i c l e

i n f o

Article history: Received 11 May 2014 Received in revised form 8 August 2014 Accepted 18 August 2014 Available online 26 August 2014 Keywords: Gastroprotective Patchouli alcohol Prostaglandin E2 Cyclooxygenase Gastric blood flow Gastric mucus

a b s t r a c t Pogostemonis Herba is an important Chinese medicine widely used in the treatment of gastrointestinal dysfunction. Patchouli alcohol (PA), a tricyclic sesquiterpene, is the major active constituent of Pogostemonis Herba. This study aimed to investigate the possible anti-ulcerogenic potential of PA and the underlying mechanism against ethanol, indomethacin and water immersion restraint-induced gastric ulcers in rats. Gross and histological gastric lesions, biochemical and immunological parameters were taken into consideration. The gastric mucus content and the antisecretory activity were analyzed through pylorus ligature model in rats. Results indicated that oral administration with PA significantly reduced the ulcer areas induced by ethanol, indomethacin and water immersion restraint. PA pretreatment significantly promoted gastric prostaglandin E2 (PGE2) and non-protein sulfhydryl group (NP-SH) levels, upregulated the cyclooxygenase-1 (COX-1) and cyclooxygenase-2 (COX-2) mRNA expression, and considerably boosted the gastric blood flow (GBF) and gastric mucus production in comparison with vehicle. In addition, PA modulated the levels of interleukin-6 (IL-6), interleukin-10 (IL-10) and tumor necrosis factor-a (TNF-a). The levels of glutathione (GSH), catalase (CAT) and malonaldehyde (MDA) were also restored by PA. However, the gastric secretion parameters (pH, volume of gastric juice and pepsin) did not show any significant alteration. These findings suggest that PA exhibited significant gastroprotective effects against gastric ulceration. The underlying mechanisms might involve the stimulation of COX-mediated PGE2, improvement of antioxidant and anti-inflammatory status, preservation of GBF and NP-SH, as well as boost of gastric mucus production. Ó 2014 Elsevier Ireland Ltd. All rights reserved.

1. Introduction Gastric ulcer remains a common gastrointestinal disorder in clinics, although its management has improved substantially following the introduction of proton pump inhibitors (PPIs) and therapy for Helicobacter pylori eradication [1]. Gastric mucosal injury may occur when noxious factors ‘‘overwhelm’’ an intact mucosal defense or the mucosal defensive mechanisms are impaired [2]. Noxious factors include acid and pepsin secretion, H. pylori infection, poor diet, alcoAbbreviation: PA, patchouli alcohol.

⇑ Corresponding authors at: School of Chinese Materia Medica, Guangzhou University of Chinese Medicine, 232# Wai Huan East Road, Guangzhou Higher Education Mega Center, Guangzhou 510006, China. Tel.: +86 20 3935 8517; fax: +86 20 3935 8390 (Z.-R. Su). Tel.: +86 20 3935 8086 (P. Huang). E-mail addresses: [email protected] (P. Huang), [email protected] (Z.-R. Su). 1 These authors contributed equally to this work. http://dx.doi.org/10.1016/j.cbi.2014.08.008 0009-2797/Ó 2014 Elsevier Ireland Ltd. All rights reserved.

hol ingestion, and the use of nonsteroidal anti-inflammatory drugs (NSAIDs). The basic components and mechanisms that provide gastric mucosal defense include an intact mucus barrier, adequate mucus secretion and mucosal blood flow, prostaglandins, activity of antioxidant and anti-inflammatory compounds, etc. Drug treatment of gastric ulcer is targeted at either counteracting aggressive factors or stimulating the mucosal defenses. Phytogenic agents have traditionally been used by herbalists and indigenous healers for the prevention and treatment of gastric ulcer. In recent decades, gastroprotection using medicinal plant products as possible therapeutic alternatives has become a subject of active scientific investigations [3]. Pogostemonis Herba, the dried aerial part of Pogostemon cablin (Blanco) Benth. (Labiatae), is a wellknown traditional Chinese medicinal herb in southeast Asia. Pogostemonis Herba has been widely applied for gastrointestinal disease in China, Japan, and Korea as an aromatic stomachic to improve impairment of the digestive system [4]. To date, Pogostemonis

28

Y.-F. Zheng et al. / Chemico-Biological Interactions 222 (2014) 27–36

Herba has been used as the main compositions in more than 40 kinds of traditional Chinese medicine (TCM) preparations, such as Huoxiang Zhengqi Shui and Po Chai Pills, which are mainly used for acute gastrointestinal disorders [5]. Modern researches have demonstrated that the aqueous extract of Pogostemonis Herba could effectively protect the intestinal barrier function [6], relieve gastrointestinal spasms [7] and improve the digestion function [8]. Patchouli alcohol (PA, chemical structure shown in Fig. 1), a tricyclic sesquiterpene, is the major active ingredient of Pogostemonis Herba and has been officially listed as an indicator for the quality assessment of Pogostemonis Herba in the Chinese Pharmacopoeia [9]. In recent years, PA has proved to exhibit radical-scavenging [10], anti-colorectal cancer and Ca2+ antagonist activities [11], etc. Recent work from our laboratory has also demonstrated the effectiveness of PA as an anti-inflammatory agent in vivo and in vitro [12,13]. In spite of the reputed effectiveness of Pogostemonis Herba in gastrointestinal diseases, there has not been any reporting of gastroprotective activity and mechanism attributive to its components so far. In a pioneering effort to substantiate the active phytoconstituent responsible for its purported gastroprotective activity scientifically, the present study was therefore undertaken to evaluate PA for the possible gastroprotective effect against ethanol, indomethacin and water immersion and restraint-induced gastric ulcer in rats. 2. Materials and methods

and water. Prior to experimentation, all rats were fasted and housed in cages with raised floors of a wide mesh to prevent coprophagy. Experimental protocols were approved by the Animal Experimental Ethics Committee of Guangzhou University of Chinese Medicine (Guangzhou, China). 2.4. Drug administration and dose selection Male Sprague–Dawley rats were randomly divided into 6 groups (n = 8) and pretreated orally with the vehicle (200 mg/kg poloxamer 407), lansoprazole (30 mg/kg) and SDs of PA (equivalent to PA 10, 20 and 40 mg/kg) for 7 consecutive days. The sixth group (Intact) received just distilled water. The dose of PA was selected based on the previous investigation and preliminary experiment. In our previous investigation, 10, 20 and 40 mg/kg of PA was adopted for its possible anti-inflammatory effect in rats and 20, 40 and 80 mg/kg for anti-virus activity in mice [13,16]. The preliminary experiment in ethanol-induced ulceration showed that PA at a higher dose (80 mg/kg) did not display superior antiulcerogenic potential than 40 mg/kg concerning the ulcer area. At the same time, considering the dosage of Pogostemonis Herba used in Chinese medicine, 40 mg/kg was selected as the highest test dose. In our pilot trial, a lower dose (5 mg/kg) had been actually tested in ethanol and indomethacin-induced ulcer. However, PA pretreatment failed to show significant reduction in the ulcer areas at the dose of 5 mg/kg (data not shown). Therefore, the subsequent biochemical and immunological parameters were not taken into consideration at 5 mg/kg.

2.1. Drugs and chemicals Poloxamer 407 (LutrolÒF127) was provided by BASF Chemical Ltd., (Ludwigshafen, Germany). Indomethacin and Alcian Blue were obtained from Sigma–Aldrich. Lansoprazole tablets were purchased from Tuobin Pharmaceutical Factory (Shantou, China). All the chemicals and reagents used were of analytical grade. 2.2. Preparation of patchouli alcohol Patchouli alcohol was isolated from patchouli oil at purity of 99.0% and further confirmed by melting point, infrared spectroscopy (IR), as well as by 1H and 13C nuclear magnetic resonance spectroscopy (NMR) and mass spectrometry (MS) in our previous work [14]. In this investigation, patchouli alcohol solid dispersions (SDs) were prepared with poloxamer 407 by melting method as described in our previous studies [15]. 2.3. Animals Male Sprague–Dawley rats (6–7 weeks old, 200–250 g) were obtained from Laboratory Animal Center of Guangzhou University of Chinese Medicine (Guangzhou, China). Rats were housed in environmentally controlled conditions (22 ± 2 °C, relative humidity of 50 ± 5%) with a 12-h light/dark cycle and had free access to food

2.5. Ethanol-induced gastric ulcer All rats were fasted for 24 h with free access to drinking water before receiving absolute ethanol. Then, the rats were treated with distilled water (Intact), vehicle (200 mg/kg poloxamer 407), lansoprazole (30 mg/kg) and SDs of PA (equivalent to PA 10, 20 and 40 mg/kg). One hour later, the rats except the intact group received an oral dose of 1 ml of absolute ethanol. All rats were euthanized after 1 h and their stomachs were removed. Serum was collected for follow-up analyses before euthanasia. The stomachs were then opened along the greater curvature and rinsed with cold saline to remove the gastric contents and blood clots. The flattened stomach samples were photographed and the ulcer area (mm2) was measured using Image J software (developed by the National Institutes of Health). The inhibition percentage was calculated according to the formula: [(Ulcer Area(Vehicle)  Ulcer Area (Treated))/Ulcer Area(Vehicle)]  100%. 2.6. Indomethacin-induced gastric ulcer The rats were fasted for 24 h with free access to drinking water prior to indomethacin administration. The rats were treated with distilled water (Intact) vehicle (200 mg/kg poloxamer 407), lansoprazole (30 mg/kg) and SDs of PA (equivalent to PA 10, 20 and 40 mg/kg). Thirty minutes later, the rats except the intact group were orally administered indomethacin (100 mg/kg) and all rats were euthanized after 5 h [17]. The stomachs were removed, opened along the greater curvature, and then photographed as described in Section 2.5. The ulcer area (mm2) was determined using Image J software. The inhibition percentage was calculated in the same manner. 2.7. Histological analysis

Fig. 1. The structure of ()-patchouli alcohol.

Samples of the stomach of each rat were fixed in 10% buffered formalin and embedded in paraffin. Paraffin sections were then

29

Y.-F. Zheng et al. / Chemico-Biological Interactions 222 (2014) 27–36

cut to a thickness of 5 lm and stained with hematoxylin and eosin (H&E) for histological evaluation according to standard procedures. 2.8. Cytokines evaluation The levels of cytokines (IL-6, IL-10 and TNF-a) in the serum were evaluated using commercial enzyme-linked immunosorbent assay (ELISA) kits (eBioscience, USA) according to the manufacturer’s instruction. The absorbance was read at 450 nm with a microplate spectrophotometer (Multiskan GO, Thermo Fisher Scientific, USA). 2.9. Measurement of glutathione (GSH), malonaldehyde (MDA) level and catalase (CAT) activity Stomach tissues were homogenized in homogenization Trisbuffer (20 mM, pH 7.5) on ice using an Ultra Turraks (IKA, Germany) and then were centrifuged at 12,000g at 4 °C for 10 min. The supernatants were used to determine the activities of CAT and levels of GSH and MDA. The concentration of protein in the supernatants was measured by the Bradford method [18] using bovine serum albumin (BSA) as a standard. Levels of GSH, CAT and MDA were determined using the commercial assay kits according to the manufacturer’s instructions, respectively (Jiancheng Company, Nanjing, China). 2.10. Determination of non-protein sulfhydryls (NP-SH) Non-protein sulfhydryl (NP-SH) content was determined as previously described by Sedlak and Lindsay [19]. Stomach tissues were homogenized in 10 ml ice-cold 0.02 M ethylenediaminetetra-acetic acid (EDTA). 3 ml homogenate was mixed with 2 ml distilled water and 1 ml 50% trichloroacetic acid (TCA) and centrifuged at 3000g. The resulting supernatant was mixed with Tris buffer at pH 8.9. Then 1 ml 5,50 -dithio-bis (2-nitrobenzoic acid) (DTNB) was added and the sample was shaken. The absorbance was read within 5 min at 412 nm, against a reagent blank with no homogenate. 2.11. Determination of prostaglandin E2 (PGE2) The stomach tissue was homogenized and centrifuged as described in section 2.9 and the supernatant was used for determination of PGE2 by using an enzyme immunosorbent kit (R&D Systems, Abingdon, UK). The optical densities were measured at 450 nm and results were expressed as pg/mg tissue. 2.12. Determination of COX-1 and COX-2 mRNA by RT-qPCR Specimens of the gastric walls removed from indomethacinadministrated rats were obtained to quantify cyclooxygenase-1 (COX-1) and cyclooxygenase-2 (COX-2) mRNA using real-time reverse transcription polymerase chain reaction (RT-qPCR). Total RNA was extracted using RNAiso Plus Reagent (Takara, Japan), according to the protocol provided by the manufacturer. The concentration of RNA was determined by an absorbance at 260 nm and the purity was evaluated by measuring the A260/A280 ratio. Complementary DNA was generated from 1 lg total RNA using reverse transcription reagent kit with gDNA eraser (Takara BIO, Japan) following manufacturer’s instructions. The PCR was performed in Applied Biosystems 7500 Real-Time PCR System (Life Technologies, USA) using SYBRÒ Premix Ex TaqTM II kit (Takara BIO, Japan) as recommended by the manufacturer. The sequences of the primers were listed in Table 1. The cycling program was set at 1 cycle of pre-denaturation at 95 °C for 30 s, 40 cycles at 95 °C for 5 s and 60 °C for 34 s. At last, melting curve program

Table 1 Primer sequences. Gene

Forward primer (50 to 30 )

Reverse primer (50 to 30 )

GAPDH COX-1 COX-2

ACAGCAACAGGGTGGTGGAC TGACTATCTGGCGGGTGACT CGGACTTGCTCACTTTGTTG

TTTGAGGGTGCAGCGAACTT CTTGCTGGACATTGGGTTCT CTCTCTGCTCTGGTCAATGG

was added. The PCR data were analyzed by Applied Biosystems 7500 Real-Time PCR System software and the fold change in cDNA (target gene) relative to the GAPDH endogenous control was calculated using 244Ct method. All the RT-qPCR experiments were conducted strictly according to the MIQE guidelines [20]. 2.13. Measurement of gastric blood flow and gastric lesions induced by WRS The rats were divided into 6 groups and pretreated with distilled water (Intact), vehicle (200 mg/kg poloxamer 407), lansoprazole (30 mg/kg) and SDs of PA (equivalent to PA 10, 20 and 40 mg/kg) respectively for 7 consecutive days. Thirty minutes post the last administration, the rats except the intact group were immobilized in perforated metal tubes and immersed in the water (23 °C) for 3.5 h to the rat xyphoid level. At the end of 3.5 h water immersion and restraint stress (WRS), the rats were anesthetized with pentobarbital. Then the abdomen was opened and the stomach was exposed to determine the gastric blood flow (GBF) using the laser Doppler flowmeter (PeriFlux5000, Perimed, Sweden). The GBF was measured in the fundic part of the gastric mucosa not involving mucosal lesions and the mean values of three measurements were calculated. After measuring GBF, gastric lesion area was determined on photographed stomachs using Image J software. The inhibition percentage was also calculated. 2.14. Determination of gastric juice parameters and mucus adherence to the gastric wall Rats were fasted for 24 h with free access to water and randomly divided into 5 groups. One hour after oral administration with vehicle (200 mg/kg poloxamer 407), lansoprazole (30 mg/ kg) and SDs of PA (equivalent to PA 10, 20 and 40 mg/kg), the rats were subjected to longitudinal incisions slightly below the xiphoid apophysis to place a pyloric ligature [21]. Four hours later, the rats were sacrificed, the abdomen was opened, and another ligature was placed around the esophagus close to the diaphragm. The stomach was opened along the greater curvature and the gastric contents were collected and centrifuged for 15 min at 2000g. The supernatant volume of the gastric content was determined. The pH was measured using pH meter. Pepsin activity in gastric content was assayed using hemoglobin as substrate according to the modified method of Anson [22], involving digestion of 2% hemoglobin in 0.02 N HCl (pH 2.0, 37 °C, 15 min) followed by alkaline condensation with Folin Ciocalteu’s reagent and spectrophotometric measurement at 578 nm [23]. The glandular portion of the stomach was weighed and immersed for 2 h in Alcian Blue solution (Sigma–Aldrich, USA) for the mucus quantification procedure. The absorbance was measured in a spectrophotometer (Multiskan GO, Thermo Fisher Scientific, USA) at a wavelength of 585 nm, and the results were expressed as lg Alcian Blue/g tissue [24]. 2.15. Statistical analysis The results were expressed as mean ± SEM and analyzed by using a one-way analysis of variance (ANOVA) followed by Dunnett’s test for multiple comparisons. In case of comparison between two groups, Student’s t-test was used. All statistical analysis was

30

Y.-F. Zheng et al. / Chemico-Biological Interactions 222 (2014) 27–36

performed with Statistical Product and Service Solutions (SPSS) software. A value of P < 0.05 was considered significant. 3. Results 3.1. Ethanol-induced gastric ulcer The vehicle-treated group presented severe mucosal injury with ulcer area of 199.95 ± 47.75 mm2. A significant decrease (P < 0.01) in the ulcer area was observed in the lansoprazole-treated group with an average of 43.80 ± 13.91 mm2 (78.09% inhibition). For the PA-pretreated groups (10, 20 and 40 mg/kg), the ulcer area was significantly decreased (P < 0.01) in a dose-dependent manner, with the minimum ulcer area (56.28 ± 12.18 mm2) and the highest inhibition (71.85%) observed at the dose of 40 mg/kg. The ulcer area for PA at dose of 20 and 10 mg/kg was 72.21 ± 10.63 and 101.57 ± 18.34 mm2 (63.89% and 49.20% inhibition), respectively. A representative gross appearance of gastric mucosa for each group is shown in Fig. 2, and the ulcer areas are depicted in Fig. 3. 3.2. Indomethacin-induced gastric ulcer The vehicle-treated group presented small petechial lesions in the stomach with an average ulcer area of 3.21 ± 1.04 mm2. In this

model, pretreatment with PA at dose of 10 mg/kg resulted in a significant reduction in ulcer area (0.58 ± 0.12 mm2), with inhibition rate of 81.94% (P < 0.05). Orally administered PA (20 and 40 mg/ kg) could lead to decrease of ulcer area with inhibition of 36.39% and 31.39% respectively, although there was no statistical significance (P > 0.05). The typical macroscopic appearances of the gastric mucosa are presented in Fig. 2, and the ulcer areas are listed in Fig. 4.

3.3. Histological evaluations Results of histological analyses of the gastric mucosa are demonstrated in Fig. 5. Rats pretreated with the vehicle showed severe damages to the gastric epithelium and edema of submucosa with inflammatory infiltrate. In the histological observation of gastric lesions induced by ethanol, rats pretreated with PA (10 and 20 mg/kg) improved these alternations, and showed less mucosal damage and milder edema when compared to the vehicle group. Rats pretreated with PA at 40 mg/kg displayed normal histology or only very superficial lesions, which was comparable to the reference drug lansoprazole. In indomethacin-induced ulceration, rats pretreated with PA at 10 mg/kg or lansoprazole showed near-normal architecture comparable to the normal rats.

Fig. 2. Effects of PA on the macroscopic appearance of the gastric mucosa in ethanol and indomethacin-induced gastric lesions in rats. (A) Intact gastric mucosa; (B–F) ethanol-induced ulcer with different degrees of hemorrhagic bands; (B) vehicle; (C) lansoprazole 30 mg/kg; (D–F) PA of different doses (10, 20 and 40 mg/kg); (G–I) indomethacin-induced ulcer with different degrees of petechial necrosis; (G) vehicle; (H) lansoprazole 30 mg/kg; (I) PA 10 mg/kg.

Y.-F. Zheng et al. / Chemico-Biological Interactions 222 (2014) 27–36

31

MDA content increased markedly (P < 0.01) in comparison to the intact group. Intragastric administration with PA (10, 20 and 40 mg/kg) alleviated the oxidant status by significantly augmenting GSH and CAT activities, and diminishing MDA level (P < 0.05) in gastric mucosa as compared with the vehicle group. The maximal effect was observed at the dose of 10 mg/kg. 3.6. Effects of PA on NP-SH and PGE2 levels Oral administration with PA significantly (P < 0.05) restored the depletion of NP-SH caused by ethanol and indomethacin (Table 4). Likewise, significant decrease of PGE2 level induced by ethanol and indomethacin (P < 0.01) was reversed by PA pretreatment dosedependently. 3.7. Expression of COX-1and COX-2 mRNA

Fig. 3. Gastric ulcer area (mm2) of rat stomachs (n = 8) induced by ethanol after treatment with vehicle, lansoprazole (30 mg/kg) or PA (10, 20, 40 mg/kg). The results were expressed as mean ± SEM and analyzed by ANOVA followed by Dunnett’s test. ⁄⁄P < 0.01 versus the vehicle group.

The real-time reverse transcription polymerase chain reaction (RT-qPCR) revealed that administration with indomethacin caused significant down-regulations of transcript COX-1 and COX-2 expressions (1.57-fold and 3.20-fold, respectively). In rats pretreated with PA, COX-1 and COX-2 mRNA expressions were significantly enhanced (1.37-fold and 2.54-fold, respectively), which was comparable to lansoprazole treatment (Fig. 6). 3.8. Effects of PA on WRS-induced gastric ulcer and GBF Exposure of 3.5 h water immersion and restraint stress (WRS) in vehicle-treated rats caused obvious gastric mucosal lesions (10.42 ± 1.64 mm2) accompanied by a significant fall (P < 0.01) in gastric blood flow (GBF), in comparison to the intact group (Fig. 7 and 8). The GBF in the vehicle group decreased from 937.80 ± 32.01 to 185.30 ± 20.31 perfusion units (PU). Administration with PA and lansoprazole resulted in significant reductions of gastric lesion area (P < 0.01) and increases of GBF (P < 0.01) as compared with the vehicle group. PA at dose of 10 mg/kg was observed to exhibit the minimum lesion area (2.62 ± 0.88 mm2) and highest GBF (500.56 ± 50.34 PU). 3.9. Effects of PA on gastric juice parameters and mucus production

Fig. 4. Gastric ulcer area (mm2) of rat stomachs (n = 8) induced by indomethacin after treatment with vehicle, lansoprazole (30 mg/kg) or PA (10, 20, 40 mg/kg). The results were expressed as mean ± SEM and analyzed by ANOVA followed by Dunnett’s test. ⁄⁄P < 0.01, ⁄P < 0.05 versus the vehicle group.

3.4. Effect of PA on serum cytokines The serum levels of pro-inflammatory cytokines TNF-a and IL-6 were amplified while anti-inflammatory factor IL-10 was reduced in the rats ulcerated by ethanol relative to the intact group. However, PA pretreatment ameliorated the elevated levels of TNF-a and IL-6 and restored the depleted IL-10 level compared to vehicle group (Table 2). 3.5. Effects of PA on GSH, CAT and MDA levels in the stomach tissue of rats given ethanol Table 3 shows that GSH and CAT activities decreased significantly (P < 0.01) in the stomach tissue of the vehicle group while

Compared with the vehicle group, rats subjected to PA pretreatment failed to show significant alterations in the volume of gastric juice, pH and pepsin, as shown in Table 5. Lansoprazole also failed to exert any significant effect on the volume of gastric juice, but could increase the pH value and reduce pepsin activity significantly (P < 0.01). However, there was a significant and dose-dependent increment in the amount of gastric adherent mucus in PA-pretreated group (P < 0.05), which was in line with the effect of PA on PGE2 level. Instead, lansoprazole did not augment gastric mucus significantly (Table 5). 4. Discussion Owing to the irreversible effects of modern drugs and therapies in recent years, use of medicinal plant products for treatment of various acute and chronic gastrointestinal diseases is gaining increasing importance around the globe. Hence, there is growing interest in identifying and characterizing natural compounds with gastroprotective activity. Pogostemonis Herba has long been used for regulating gastrointestinal functions. However, the component obligatory for this effect and the possible mechanism of action involved remains to be defined. The present study demonstrates, for the first time, the antiulcerogenic activity and action

32

Y.-F. Zheng et al. / Chemico-Biological Interactions 222 (2014) 27–36

Fig. 5. Effect of PA on histological evaluation in ethanol or indomethacin-induced ulcer (HE staining; magnification 100). (A) Intact stomach: Intact gastric epithelium with organized glandular structure and normal submucosa; (B–F) ethanol-induced ulcer; (G–I) indomethacin-induced ulcer. (B) and (G) Rats pretreated with vehicle: ⁄ indicates damaged mucosal epithelium with disrupted glandular structure, and arrow depicts edema of submucosa and inflammatory infiltrate; (C) and (H) lansoprazole (30 mg/kg); (D) and (I) PA 10 mg/kg; (E) PA 20 mg/kg; (F) PA 40 mg/kg. (C–F), (H) and (I) show a recovery in mucosal epithelium and reorganized glandular structure as well as improvement of edema under treatment with lansoprazole or PA, respectively.

Table 2 Effects of PA on the serum levels of TNF-a, IL-6 and IL-10 in rats (n = 8) with ethanol-induced gastric ulcers. Groups

Dose (mg/kg)

TNF-a (pg/ml)

IL-6 (pg/ml)

IL-10 (pg/ml)

Intact Vehicle Lansoprazole PA

– – 30 40 20 10

99.89 ± 4.20 135.83 ± 9.54## 114.04 ± 6.49⁄ 105.98 ± 4.41⁄⁄ 113.13 ± 6.69⁄ 101.54 ± 6.76⁄⁄

235.51 ± 26.16 388.00 ± 22.00## 303.30 ± 17.56⁄ 325.85 ± 13.37⁄ 315.90 ± 24.33⁄ 276.87 ± 29.14⁄⁄

198.11 ± 5.22 143.23 ± 4.64## 174.75 ± 6.98⁄ 173.12 ± 9.27⁄ 183.91 ± 14.94⁄⁄ 173.08 ± 7.45⁄

The results were expressed as mean ± SEM and analyzed by ANOVA followed by Dunnett’s test. ⁄⁄P < 0.01, ⁄P < 0.05 versus the vehicle group. Student’s t-test was performed for comparing intact and vehicle groups, ##P < 0.01.

Table 3 Effects of PA on GSH, CAT and MDA levels in the stomach tissue of rats (n = 8) with or without ethanol. Groups

Dose (mg/kg)

CAT (units/mg protein)

GSH (mg/g protein)

MDA (lmol/g protein)

Intact Vehicle Lansoprazole PA

– – 30 40 20 10

350.06 ± 40.56 172.0 ± 32.63## 267.92 ± 31.21⁄ 270.11 ± 24.76⁄ 263.56 ± 23.39⁄ 311.57 ± 27.89⁄⁄

50.59 ± 3.45 30.79 ± 2.70## 37.30 ± 1.56⁄ 40.00 ± 2.74⁄ 37.81 ± 1.17⁄ 46.85 ± 1.95⁄⁄

117.8 ± 8.2 227.3 ± 23.6## 168.4 ± 14.5⁄ 173.9 ± 16.5⁄ 148.3 ± 14.9⁄⁄ 135.2 ± 9.8⁄⁄

The results were expressed as mean ± SEM and analyzed by ANOVA followed by Dunnett’s test. ⁄⁄P < 0.01, ⁄P < 0.05 versus the vehicle group. Student’s t-test was performed for comparing intact and vehicle groups, ##P < 0.01.

mechanisms of PA from Pogostemonis Herba, on different experimental rat models of gastric ulceration. The gastroprotective effect of PA was firstly investigated in acute gastric injury induced by ethanol. In this model, the vehicle rats subjected to ethanol clearly produced the expected character-

istic zone of necrotizing mucosal lesions, while pretreatment with PA had significantly decreased the ulcer areas. Ethanol leads to intense gastric mucosal damage, directly and indirectly through such mediators as reactive oxygen species (ROS) and cytokines [25]. Ethanol administration increases lipid peroxidation,

Y.-F. Zheng et al. / Chemico-Biological Interactions 222 (2014) 27–36

33

Table 4 Effects of PA on gastric NP-SH and PGE2 contents of rats (n = 8). Groups

NP-SH (lmol/g protein)

PGE2 (pg/mg tissue)

Intact Vehicle + ethanol Lansoprazole + ethanol PA 40 mg/kg + ethanol PA 20 mg/kg + ethanol PA 10 mg/kg + ethanol Vehicle + indomethacin Lansoprazole + indomethacin PA 10 mg/kg + indomethacin

50.69 ± 3.54 29.22 ± 1.96## 34.68 ± 0.71⁄ 33.61 ± 1.21⁄ 33.42 ± 0.70⁄ 34.33 ± 1.11⁄ 36.17 ± 1.17## 39.52 ± 1.94⁄ 41.91 ± 2.65⁄

102.18 ± 4.96 65.15 ± 1.95## 83.17 ± 5.65⁄ 90.63 ± 3.87⁄⁄ 83.22 ± 7.41⁄ 77.68 ± 5.12 82.79 ± 1.65## 90.85 ± 3.64⁄ 92.47 ± 4.42⁄

The results were expressed as mean ± SEM and analyzed by ANOVA followed by Dunnett’s test, ⁄⁄P < 0.01, ⁄P < 0.05 versus the vehicle group. Student’s t-test was performed for comparing intact and vehicle groups, ##P < 0.01.

Fig. 7. Average gastric lesion area of rat stomachs (n = 8) caused by WRS after administration with vehicle, lansoprazole (30 mg/kg) or PA (10, 20, 40 mg/kg). The results were expressed as mean ± SEM and analyzed by ANOVA followed by Dunnett’s test. ⁄⁄P < 0.01 versus the vehicle group.

Fig. 6. Effects of PA on mRNA expressions of COX-1 and COX-2 in gastric mucosa of rats (n = 6) submitted to gastric ulcer induced by indomethacin. Data were reported as mean ± SEM, analyzed by ANOVA followed by Dunnett’s test. ⁄P < 0.05, ##P < 0.01 versus the vehicle group.

decreases CAT, GSH levels and the protective factors of the gastric mucosa [26]. GSH and CAT are the first line of defense against ROS. GSH is an important intracellular antioxidant which protects the gastric mucosa from free radical-induced tissue damage [27]. CAT triggers the rapid conversion of peroxyl radical (H2O 2 ) into biologically safe substances, like water [28]. Lipid peroxidation is the result of ROS interaction with the cell membrane, subsequently producing highly lipid peroxidation products such as MDA to cause oxidative gastric damage [29]. In the present work, oral administration with PA normalized gastric mucosal levels of MDA, GSH and CAT, in response to oxidative stress caused by ethanol. In view of the fact that tissue oxidation is an important detrimental effect evoked by ethanol in the digestive system, it is suggestive of a significant role played by the antioxidant actions of PA in counteracting the gastric damage induced by ethanol administration. In fact, sesquiterpenes, especially sesquiterpene lactones, have been demonstrated with antioxidant effects due to their chemical functional group, a-methylene-b-lactone [30–32]. As far as the chemical structure is concerned, this tricyclic sesquiterpene ()-patchouli alcohol possessed a unique rigid tricyclic skeleton with the sterically hindered hydroxyl group, unlike many other sesquiterpene antioxidant agent. This structural characteristic should be responsible for its antioxidant activity. However, indepth structure–activ-

Fig. 8. GBF in rats (n = 8) exposed to 3.5 h of WRS after administration with vehicle, lansoprazole (30 mg/kg) or PA (10, 20, 40 mg/kg). Data were reported as mean ± SEM and analyzed by ANOVA followed by Dunnett’s test. ⁄⁄P < 0.01 versus the vehicle group. Student’s t-test was performed for comparing intact and vehicle groups, ##P < 0.01.

ity relationship studies are merited to unveil in great detail its mechanism. Besides generating ROS, ethanol administration provokes an inflammatory response, which releases a great number of inflammatory cytokines such as TNF-a and IL-6. It is suggested that the pro-inflammatory cytokines TNF-a and IL-6 are important in regulating the severity of gastric ulcers, which can enhance the effects of oxidative stress by inducing mitochondrial ROS generation and cytotoxicity [33,34]. IL-10 is one of the most important antiinflammatory cytokines and could suppress the inflammatory response. In our previous work, PA proved to exhibit both in vitro and in vivo anti-inflammatory activities in LPS-stimulated RAW264.7 macrophages and carrageenan-induced paw edema in rats respectively [12,13]. The present work indicated that, in the

34

Y.-F. Zheng et al. / Chemico-Biological Interactions 222 (2014) 27–36

Table 5 Effects of PA on gastric juice parameters and gastric adherent mucus in rats (n = 8) with pyloric ligation. Groups

Dose (mg/kg)

Volume (ml)

pH

Pepsin activity (Units/ml)

Mucus (lg alcian blue/g tissue)

Vehicle Lansoprazole PA

– 30 40 20 10

5.06 ± 0.60 4.10 ± 0.57 5.44 ± 0.52 5.69 ± 0.71 6.13 ± 0.37

1.43 ± 0.13 6.72 ± 0.14⁄⁄ 1.64 ± 0.16 1.61 ± 0.23 1.45 ± 0.09

31.13 ± 0.58 16.30 ± 1.87⁄⁄ 29.83 ± 2.60 31.15 ± 2.08 31.32 ± 3.04

316.36 ± 39.36 476.99 ± 48.11 605.53 ± 85.97⁄ 565.98 ± 104.53⁄ 546.18 ± 43.74⁄

The results were expressed as mean ± SEM and analyzed by ANOVA followed by Dunnett’s test.

presence of ethanol-induced ulceration, PA pretreatment favorably decreased the levels of TNF-a and IL-6 and augmented IL-10 production. It is indicated that the beneficial effects of PA on mucosal injury are likely to be associated with its anti-inflammatory property. Endogenous NP-SH plays a critical role in maintaining gastric mucosal integrity. NP-SH binds the free radicals formed by ulcerogenic agents and acts as recycling antioxidants, which is also involved in controlling the production and nature of mucus [35]. Our study indicated that PA-pretreated groups effectively elevated gastric NP-SH content as compared to the vehicle group. Hence, the replenishment of endogenous NP-SH might be involved in the gastroprotective effect of PA. Another experimental protocol employed in the investigation was NSAIDs-induced ulcer by indomethacin, which induced gastric lesions due to the distinct mechanism in ulcerogenesis compared with ethanol. Indomethacin, a non-steroidal anti-inflammatory drug (NSAID), causes gastric ulcers mainly by inhibiting COX-mediated Prostaglandins (PGs) synthesis, although direct topical injury may occur. PGE2 has an essential role in maintaining the integrity of gastric mucosal defense by stimulating the synthesis and secretion of mucus and bicarbonate, which increases mucosal blood flow and promotes epithelial proliferation [36]. Our results demonstrated that even with indomethacin administration, PA at dose of 10 mg/kg was able to significantly increase the gastric mucosa PGE2 relative to the vehicle group. It was reported that ethanol administration would inhibit PGs synthesis [27], which was also consistent with our results. We found that PA was able to elicit an increment of PGE2 in a dosedependent manner after ethanol administration. This finding might explain why PA exhibited dose-dependent effect in reducing ethanol-induced ulceration, although it had better anti-inflammatory and antioxidant effect at lower doses. Interestingly, PA at the lowest dose (10 mg/kg) exerted superior protective effect over higher dose in indomethacin-induced ulcerogenesis. This might be attributed to the potent inhibition on PG synthesis caused by indomethacin, which weakened the PGE2 promotion and anti-ulcer activity of PA at higher doses. Therefore, PA at the dose of 10 mg/kg with better anti-inflammatory and antioxidant effects became more effective in indomethacin-induced ulceration. If an extrapolation of the above results is to be made to humans, then it may be said that, the minimum anticipated biological-effect level (MABEL) 10 mg/kg (approximately equal to 1.6 mg/kg for adult dose in terms of body surface area dose translation [37]), might be estimated as a possible starting dose for phase I clinical trial, regarding the above exposure–response data. However, standard preclinical safety assessment as well as pharmacokinetic/pharmacodynamic model should be conducted prior to further clinical trials. COX-1 and COX-2 are key enzymes in the biosynthesis of PGs. There is growing evidence that both COX-1 and COX-2 play a role in PG synthesis and maintain gastric mucosal integrity. COX-2 plays a ‘‘back-up’’ role by alleviating PG deficiency in situations in which COX-1-induced PG synthesis has been decreased [2]. Results obtained in mice show that inhibition of COX-1 and COX-

⁄⁄

P < 0.01, ⁄P < 0.05 versus the vehicle group.

2 is required for the formation of gastric lesions [38]. Indomethacin is a nonselective inhibitor of both COX-1 and COX-2 and can cause damage in the stomach with a marked decrease in the gastric mucosal PGE2 content. The expression of COX-1 and COX-2 enhanced by PA might contribute to maintain the gastric PGE2 post indomethacin administration, possibly resulting in gastric mucosa protection. Based on these findings, it is conceivable that COXmediated PGE2 biosynthesis might take significant parts in the beneficial effects of PA in the healing of ulcerative damage elicited by indomethacin. Normal gastric blood flow is essential for delivery of oxygen and nutrients and removal of toxic substances. Thus, when the gastric mucosa is exposed to a noxious irritant, such as stress, maintaining an adequate gastric blood flow is critical to protecting the gastric mucosa. It was known that WRS led to gastric injury mainly through decline in GBF [25]. PA pretreatment was found to ameliorate the severity of WRS-induced gastric lesions and this effect was possibly associated with the increase in GBF. Of note, PA exerted remarkable gastroprotective effect in WRS-induced ulceration with maximal effects observed at 10 mg/kg, which also exhibited the most evident promotion in GBF. Accordingly, the improvement of GBF by PA might also contribute favorably to its gastroprotective effect. Gastric secretion has been known for many decades to be a key factor in gastrointestinal functions. To gain insight into the effects of PA on gastric secretion, as possible mechanisms contributing to its gastroprotective actions, the gastric juice parameters in pylorus ligature rats were investigated. Results indicated that oral administration of PA failed to exert significant effects on the volume, pH and pepsin of the gastric juice. Therefore, PA did not protect the gastric mucosa through anti-secretory action. Another parameter measured in this study was gastric mucus. Gastric mucus is the first line of defense against acid and adheres together with bicarbonate secreted by the epithelium to serve as a barrier against self-digestion [39]. It is established that gastric mucus is capable of acting as an antioxidant agent and reducing mucosal damage mediated by oxygen free radicals [40]. Our results showed that the amount of adhered gastric mucus was augmented by pretreatment with PA compared to the vehicle. Thus, it could be proposed that enhanced mucus secretion by PA potentially play an important role in gastric mucosal protection. In recent years, numerous studies have shown that some phytogenic compounds owned anti-ulcer activity against experimentally induced gastric ulcers. Among these, of particular interest are menthol and curcumin. The gastroprotective activity of menthol is associated with mucus secretion, anti-apoptotic, antioxidant and anti-inflammatory mechanisms [34,41]. While curcumin displays a gastroprotective activity through stimulating cell proliferation and adjusting the pro-inflammatory cytokine-mediated oxidative damage to the gastric mucosa [42,43]. In the present study, PA was demonstrated to increase the gastric mucus and GBF, augment the decreased NP-SH and PGE2 production. Additionally, PA also exhibited antioxidant and anti-inflammatory properties against experimentally induced gastric ulcers in rats. In our previous study, PA was demonstrated to possess in vivo and in vitro

Y.-F. Zheng et al. / Chemico-Biological Interactions 222 (2014) 27–36

anti-bacterial effect against H. pylori [44], a major pathogen of chronic gastritis and peptic ulcer. Taken together with the fact that PA has been widely used as food additive permitted for direct addition to food for human consumption for a long time [45], PA was envisaged to provide a wide margin of safety for potential medicinal application. Thus, PA might have the potential for further development as a safe and effective alternative/complementary to conventional medication in treating gastric ulcer. 5. Conclusion The results obtained suggest that PA possessed gastroprotective effect against ethanol, indomethacin and water immersion and restraint stress-induced gastric ulcer in rat models. The underlying mechanisms might involve the stimulation of COX-mediated PGE2, improvement of antioxidant and anti-inflammatory status, preservation of GBF and NP-SH, as well as boost of gastric mucus production. Nevertheless, this activity did not seem to be connected with antisecretory mechanism. The results also indicate that PA may account at least in part, for the traditional application of Pogostemonis Herba in the treatment of gastrointestinal disorders. PA might have the potential for further development as a promising alternative for antiulcer treatment. Conflict of Interest There are no conflicts of interest. Transparency Document The Transparency document associated with this article can be found in the online version.

Acknowledgements This work was supported by grants from Guangdong International Cooperation Project (No. 2012B050300002), National Science Foundation of China (Nos. 81374043 & 81173534), Science and Technological Program for Dongguan’s Higher Education, Science and Research, and Health Care Institutions (No. 2012105102009), Ph.D. Programs Foundation of Ministry of Education of China (No. 20134425110009) and Science and Technology Innovation Project of Guangdong Provincial Department of Education (No. 2013KJCX0045). References [1] J.J.Y. Sung, E.J. Kuipers, H.B. El-Serag, Systematic review: the global incidence and prevalence of peptic ulcer disease, Aliment. Pharmacol. Therap. 29 (2009) 938–946. [2] L. Laine, K. Takeuchi, A. Tarnawski, Gastric mucosal defense and cytoprotection: bench to bedside, Gastroenterology 135 (2008) 41–60. [3] F. Borrelli, A.A. Izzo, The plant kingdom as a source of anti-ulcer remedies, Phytother. Res. 14 (2000) 581–591. [4] H. Kiyohara, C. Ichino, Y. Kawamura, T. Nagai, N. Sato, H. Yamada, Patchouli alcohol: in vitro direct anti-influenza virus sesquiterpene in Pogostemon cablin Benth, J. Nat. Med. 66 (2012) 55–61. [5] M.W. Chen, J.M. Zhang, Y.F. Lai, S.P. Wang, P. Li, J. Xiao, C.M. Fu, H. Hu, Y.T. Wang, Analysis of Pogostemon cablin from pharmaceutical research to market performances, Exp. Opin. Invest. Drugs 22 (2013) 245–257. [6] Y. Xie, F. Tang, Protective effect of Pogostemon cablin on membrane fluidity of intestinal epithelia cell in ischemia reperfusion rats after ischemia reperfusion, Chin. J. Integr. Tradit. West. Med. 29 (2009) 639–641. [7] X. Chen, B. He, X. Li, J. Luo, Effects of Herba Pogostemonis on gastrointestinal tract, J. Chin. Med. Mater. 21 (1998) 462–466. [8] B. He, X. Chen, X. Li, J. Luo, Comparison of effects of Herba Pogostmonis from gaoyao and wuchuan on digestive system, J. Chin. Med. Mater. 22 (1999) 201– 203.

35

[9] C.P. Committee, Pharmacopoeia of the People’s Republic of China, 2010 ed., China Medical Science Press, Beijing, 2010. [10] H.W. Kim, S.J. Cho, B.Y. Kim, S.I. Cho, Y.K. Kim, Pogostemon cablin as ROS scavenger in oxidant-induced cell death of human neuroglioma cells, Evid. Based Complement Alternat. Med. 7 (2010) 239–247. [11] J.B. Jeong, J. Choi, Z.Y. Lou, X.J. Jiang, S.H. Lee, Patchouli alcohol, an essential oil of Pogostemon cablin, exhibits anti-tumorigenic activity in human colorectal cancer cells, Int. Immunopharmacol. 16 (2013) 184–190. [12] Y.F. Xian, Y.C. Li, S.P. Ip, Z.X. Lin, X.P. Lai, Z.R. Su, Anti-inflammatory effect of patchouli alcohol isolated from Pogostemonis Herba in LPS-stimulated RAW264.7 macrophages, Exp. Therap. Med. 2 (2011) 545–550. [13] Y.C. Li, Y.F. Xian, S.P. Ip, Z.R. Su, J.Y. Su, J.J. He, Q.F. Xie, X.P. Lai, Z.X. Lin, Antiinflammatory activity of patchouli alcohol isolated from Pogostemonis Herba in animal models, Fitoterapia 82 (2011) 1295–1301. [14] Z.Q. Su, X.L. Wu, M.J. Bao, C.W. Li, S.Z. Kong, Z.R. Su, X.P. Lai, Y.C. Li, J.N. Chen, Isolation of ()-patchouli alcohol from patchouli oil by fractional distillation and crystallization, Trop. J. Pharm. Res. 13 (2014) 359–363. [15] J.B. Liao, Y.Z. Liang, Y.L. Chen, J.H. Xie, W.H. Liu, J.N. Chen, X.P. Lai, Z.R. Su, Novel patchouli alcohol ternary solid dispersion pellets prepared by poloxamers, Iran. J. Pharm. Res., in press.. [16] Y.C. Li, S.Z. Peng, H.M. Chen, F.X. Zhang, P.P. Xu, J.H. Xie, J.J. He, J.N. Chen, X.P. Lai, Z.R. Su, Oral administration of patchouli alcohol isolated from Pogostemonis Herba augments protection against influenza viral infection in mice, Int. Immunopharmacol. 12 (2012) 294–301. [17] A.L. Rozza, C.A. Hiruma-Lima, A. Tanimoto, C.H. Pellizzon, Morphologic and pharmacological investigations in the epicatechin gastroprotective effect, Evid. Based Complement Alternat. Med. 2012 (2012) 708156. [18] M.M. Bradford, A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein–dye binding, Anal. Biochem. 72 (1976) 248–254. [19] J. Sedlak, R.H. Lindsay, Estimation of total, protein-bound, and nonprotein sulfhydryl groups in tissue with Ellman’s reagent, Anal. Biochem. 25 (1968) 192–205. [20] S.A. Bustin, V. Benes, J.A. Garson, J. Hellemans, J. Huggett, M. Kubista, R. Mueller, T. Nolan, M.W. Pfaffl, G.L. Shipley, J. Vandesompele, C.T. Wittwer, The MIQE guidelines: minimum information for publication of quantitative realtime PCR experiments, Clin. Chem. 55 (2009) 611–622. [21] H. Shay, A simple method for the uniform production of gastric ulceration in the rat, Gastroenterology 5 (1945) 43–61. [22] M.L. Anson, The estimation of pepsin, trypsin, papain, and cathepsin with hemoglobin, J. Gen. Physiol. 22 (1938) 79–89. [23] V.J. Shine, P.G. Latha, S. Shyamal, S.R. Suja, G.I. Anuja, S. Sini, S. Pradeep, S. Rajasekharan, Gastric antisecretory and antiulcer activities of Cyclea peltata (Lam.) Hook. f. & Thoms. in rats, J. Ethnopharmacol. 125 (2009) 350–355. [24] S. Rafatullah, M. Tariq, M.A. Al-Yahya, J.S. Mossa, A.M. Ageel, Evaluation of turmeric (Curcuma longa) for gastric and duodenal antiulcer activity in rats, J. Ethnopharmacol. 29 (1990) 25–34. [25] O.M. Abdel-Salam, J. Czimmer, A. Debreceni, J. Szolcsanyi, G. Mozsik, Gastric mucosal integrity: gastric mucosal blood flow and microcirculation. An overview, J. Physiol. Paris 95 (2001) 105–127. [26] A.L. Rozza, M. Moraes Tde, H. Kushima, A. Tanimoto, M.O. Marques, T.M. Bauab, C.A. Hiruma-Lima, C.H. Pellizzon, Gastroprotective mechanisms of Citrus lemon (Rutaceae) essential oil and its majority compounds limonene and beta-pinene: involvement of heat-shock protein-70, vasoactive intestinal peptide, glutathione, sulfhydryl compounds, nitric oxide and prostaglandin E(2), Chem. Biol. Interact. 189 (2011) 82–89. [27] H.M. Sidahmed, N.M. Hashim, J. Amir, M.A. Abdulla, A.H. Hadi, S.I. Abdelwahab, M.M. Taha, P. Hassandarvish, X. Teh, M.F. Loke, J. Vadivelu, M. Rahmani, S. Mohan, Pyranocycloartobiloxanthone A, a novel gastroprotective compound from Artocarpus obtusus Jarret, against ethanol-induced acute gastric ulcer in vivo, Phytomedicine 20 (2013) 834–843. [28] J.Y. Wong, M.A. Abdulla, J. Raman, C.W. Phan, U.R. Kuppusamy, S. Golbabapour, V. Sabaratnam, Gastroprotective effects of Lion’s mane mushroom Hericium erinaceus (Bull.:Fr.) Pers. (Aphyllophoromycetideae) extract against ethanolinduced ulcer in rats, Evid. Based Complement Alternat. Med. (2013) 9. [29] S. Kwiecien, T. Brzozowski, S.J. Konturek, Effects of reactive oxygen species action on gastric mucosa in various models of mucosal injury, J. Physiol. Pharmacol. 53 (2002) 39–50. [30] M.G. Repetto, A. Boveris, Bioactivity of sesquiterpenes: compounds that protect from alcohol-induced gastric mucosal lesions and oxidative damage, Mini Rev. Med. Chem. 10 (2010) 615–623. [31] K. Celik, B. Togar, H. Turkez, N. Taspinar, In vitro cytotoxic, genotoxic, and oxidative effects of acyclic sesquiterpene farnesene, Turk. J. Biol. 38 (2014) 253–259. [32] M.E. Neganova, S.V. Afanas’eva, S.G. Klochkov, E.F. Shevtsova, Mechanisms of antioxidant effect of natural sesquiterpene lactone and alkaloid derivatives, Bull. Exp. Biol. Med. 152 (2012) 720–722. [33] M.M. Taha, M.S. Salga, H.M. Ali, M.A. Abdulla, S.I. Abdelwahab, A.H. Hadi, Gastroprotective activities of Turnera diffusa Willd. ex Schult. revisited: role of arbutin, J. Ethnopharmacol. 141 (2012) 273–281. [34] A.L. Rozza, F. Meira de Faria, A.R. Souza Brito, C.H. Pellizzon, The gastroprotective effect of menthol: involvement of anti-apoptotic, antioxidant and anti-inflammatory activities, PLoS One 9 (2014) e86686. [35] A.S. Salim, Sulphydryl-containing agents: a new approach to the problem of refractory peptic ulceration, Pharmacology 45 (1992) 301–306.

36

Y.-F. Zheng et al. / Chemico-Biological Interactions 222 (2014) 27–36

[36] P. Malfertheiner, F.K. Chan, K.E. McColl, Peptic ulcer disease, Lancet 374 (2009) 1449–1461. [37] S. Reagan-Shaw, M. Nihal, N. Ahmad, Dose translation from animal to human studies revisited, FASEB J. 22 (2008) 659–661. [38] A. Tanaka, H. Araki, Y. Komoike, S. Hase, K. Takeuchi, Inhibition of both COX-1 and COX-2 is required for development of gastric damage in response to nonsteroidal antiinflammatory drugs, J. Physiol. Paris 95 (2001) 21–27. [39] A. Allen, G. Flemstrom, Gastroduodenal mucus bicarbonate barrier: protection against acid and pepsin, Am. J. Physiol. Cell Physiol. 288 (2005) C1–C19. [40] L.D. Arawwawala, M.I. Thabrew, L.S. Arambewela, Gastroprotective activity of Trichosanthes cucumerina in rats, J. Ethnopharmacol. 127 (2010) 750–754. [41] A.L. Rozza, C.A. Hiruma-Lima, R.K. Takahira, C.R. Padovani, C.H. Pellizzon, Effect of menthol in experimentally induced ulcers: pathways of gastroprotection, Chem. Biol. Interact. 206 (2013) 272–278.

[42] X. Mei, D. Xu, S. Xu, Y. Zheng, S. Xu, Novel role of Zn(II)-curcumin in enhancing cell proliferation and adjusting proinflammatory cytokine-mediated oxidative damage of ethanol-induced acute gastric ulcers, Chem. Biol. Interact. 197 (2012) 31–39. [43] S. Swarnakar, K. Ganguly, P. Kundu, A. Banerjee, P. Maity, A.V. Sharma, Curcumin regulates expression and activity of matrix metalloproteinases 9 and 2 during prevention and healing of indomethacin-induced gastric ulcer, J. Biol. Chem. 280 (2005) 9409–9415. [44] X.P. Lai, Z.R. Su, J.N. Chen, Y.C. Li, J.J. He, Use of patchouli alcohol in preparation of drug against Helicobacter Pylori. U.S. patent US20140031434 A1, 2014. [45] R. Murugan, C. Livingstone, Origin of the name ‘patchouli’ and its history, Curr. Sci. 99 (2010) 1274–1276.