243
Biochem. Cell Biol. Downloaded from www.nrcresearchpress.com by UNIVERSITY OF MICHIGAN on 02/09/15 For personal use only.
ARTICLE Ganglioside GM3 is required for caffeic acid phenethyl ester-induced megakaryocytic differentiation of human chronic myelogenous leukemia K562 cells Un-Ho Jin, Tae-Wook Chung, Kwon-Ho Song, Choong-Hwan Kwak, Hee-Jung Choi, Ki-Tae Ha, Young-Chae Chang, Young-Choon Lee, and Cheorl-Ho Kim
Abstract: The human chronic myelogenous cell line K562 has been used extensively as a model for the study of leukemia differentiation. We show here that treatment of K562 cells with caffeic acid phenethyl ester (CAPE) induced a majority of cells to differentiate towards the megakaryocytic lineage. Microscopy analysis showed that K562 cells treated with CAPE exhibited characteristic features of physiological megakaryocytic differentiation, including the presence of vacuoles and demarcation membranes. Differentiation of K562 cells treated with CAPE was also accompanied by a net increase in megakaryocytic markers. The transcriptional activity of lactosylceramide ␣-2,3-sialyltransferase (GM3 synthase) and synthesis of ganglioside GM3 were increased by CAPE treatment. The promoter analysis of GM3 synthase demonstrated that CAPE induced the expression of GM3 synthase mRNA via activation of the cAMP response element-binding protein (CREB), transcription factor in nucleus. Interestingly, the inhibition of ganglioside GM3 synthesis by D-threo-1-phenyl-2-decanoylamino-3-morpholino-1-propranol (D-PDMP) and GM3 synthase-siRNA blocked the CAPE-induced expression of the megakaryocytic markers and differentiation of K562 cells. Taken together, these results suggest that CAPE induces ganglioside GM3-mediated megakaryocytic differentiation of human chronic myelogenous cells. Key words: caffeic acid phenethyl ester, megakaryocytic differentiation, ganglioside GM3, cAMP response element-binding protein. Résumé : La lignée cellulaire myélogène chronique humaine K562 a été largement utilisée comme modèle d’étude de la différenciation des cellules leucémiques. Les auteurs montrent ici que le traitement des cellules K562 avec le phénylester d’acide caféique (PEAC) induisait la différenciation de la majorité des cellules vers le lignage des mégacaryocytes. L’analyse en microscopie a montré que les cellules K562 traitées au PEAC présentaient des caractéristiques de la différenciation physiologique en mégacaryocytes, incluant la présence de vacuoles et de membranes de démarcation. La différenciation des cellules K562 traitées au PEAC s’accompagnait aussi d’un accroissement net des marqueurs des mégacaryocytes. L’activité transciptionnelle de la lactosylcéramide a-2,3-sialyltransférase (GM3 synthase) et la synthèse du ganglioside GM3 étaient accrues par le traitement au PEAC. L’analyse du promoteur de la GM3 synthase a démontré que le PEAC induisait l’expression de l’ARNm de la GM3 synthase au moyen de l’activation de la protéine CREB (cAMP response element binding), un facteur de transcription nucléaire. Fait intéressant, l’inhibition de la synthèse du ganglioside GM3 par le D-thréo-1-phényl-1-2-décanoylamino-3-morpholino-1-propanolol (D-PDMP) ou par un pARNi de la GM3 synthase bloquait l’expression des marqueurs des mégacaryocytes induite par le PEAC et la différenciation des cellules K562. Dans leur ensemble, ces résultats suggèrent que le PEAC induit la différenciation des cellules myélogènes chroniques en mégacaryocytes par l’intermédiaire du ganglioside GM3. [Traduit par la Rédaction] Mots-clés : phénylester d’acide caféique, différenciation en mégacaryocytes, ganglioside GM3, CREB.
Introduction Ganglioside GM3, sialic acid (NeuAc)-containing glycosphingolipid, is the first and the simplest of the gangliosides and are found on the outer leaflet of the plasma membrane in vertebrates (Abrahamsson and Pascher 1977; Nakamura et al. 1991; Stults et al. 1989). It plays important roles in a large variety of biological pro-
cesses, such as cellular interactions, differentiation, oncogenesis, adhesion, cell growth, and receptor function in various cell systems (Varki 1993). Ganglioside GM3 is synthesized by GM3 synthase, which catalyzes the transfer of NeuAc from CMP-NeuAc to the nonreducing terminal galactose of lactosylceramide in human. GM3 synthase is a key regulatory enzyme for ganglioside
Received 24 January 2014. Revision received 25 April 2014. Accepted 30 April 2014. Abbreviations: CAPE, caffeic acid phenethyl ester; PMA, phorbol 12-myristate 13-acetate; NF-B, nuclear factor kappa B; GM3 synthase, human lactosylceramide ␣-2,3-sialyltransferase; D-PDMP, D-threo-1-phenyl-2-decanoylamino-3-morpholino-1-propranol. U.-H. Jin,*,† T.-W. Chung,† K.-H. Song, C.-H. Kwak, and C.-H. Kim. Molecular and Cellular Glycobiology Unit, Department of Biological Sciences, Sungkyunkwan University, Jangan-Gu, Suwon City, Kyunggi-Do 440-746, Korea. H.-J. Choi. Molecular and Cellular Glycobiology Unit, Department of Biological Sciences, Sungkyunkwan University, Jangan-Gu, Suwon City, Kyunggi-Do 440-746, Korea; Division of Applied Medicine, School of Korean Medicine, Pusan National University, Yangsan, Gyeongnam, Republic of Korea. K.-T. Ha. Division of Applied Medicine, School of Korean Medicine, Pusan National University, Yangsan, Gyeongnam, Republic of Korea. Y.-C. Chang. Catholic University of Daegu School of Medicine, Nam-gu, Daegu 705-034, Republic of Korea. Y.-C. Lee. Faculty of Medicinal Biotechnology, Dong-A University, Saha-Gu, Busan 604-714, Korea. Corresponding author: Cheorl-Ho Kim (e-mail: [email protected]). *Present address: Institute of Biosciences and Technology, Texas A&M Health Science Center, Houston, TX, 77030 USA. †These two authors equally contributed to the present study. Biochem. Cell Biol. 92: 243–249 (2014) dx.doi.org/10.1139/bcb-2014-0015
Published at www.nrcresearchpress.com/bcb on 13 May 2014.
Biochem. Cell Biol. Downloaded from www.nrcresearchpress.com by UNIVERSITY OF MICHIGAN on 02/09/15 For personal use only.
244
biosynthesis, because it catalyzes the first committed step in the synthesis of nearly all gangliosides (Fishman and Brady 1976). The K562 cell line serves as a model to study the molecular mechanisms associated with leukemia differentiation. The K562 cell line is thought to be multipotent hematopoietic cells and to be capable of differentiating into erythrocytic, monocytic, granulocytic, and megakaryocytic lineages (Jacquel et al. 2006; Nakamura et al. 1991). A widely used model for studying megakaryocytic differentiation is phorbol 12-myristate 13-acetate (PMA)-induced differentiation of K562 (Alitalo 1990; Herrera et al. 1998). PMA-induced differentiation is characterized by changes in cell morphology and adhesive properties, cell growth arrest, endomitosis, and expression of markers associated with megakaryocytes (Butler et al. 1990; Fukuda 1981; Hocevar et al. 1992; Long et al. 1990; Tetteroo et al. 1984). The amount of ganglioside GM3 increases with a concomitant increase of GM3 synthase activity during megakaryocytic differentiation of K562 cells treated with PMA, which is a megakaryocytic differentiation inducer, but not with an erythrocyte differentiation inducer, such as hemin (Nakamura et al. 1991). Also, GM3 synthase activity is remarkably elevated in a timedependent manner during megakaryocytic differentiation (Choi et al. 2004). Previously, changes in glycosphingolipids during megakaryocytic cell differentiation were studied using human leukemia cell line K562 cells, and it was demonstrated that exogenous ganglioside GM3 induced magakaryocytic differentiation in K562 cells (Nakamura et al. 1991). Our previous studies also showed that CREB-mediated GM3 accumulation played a significant role in the megakaryocytic differentiation of K562 cells by PMA (Choi et al. 2004). This indicated that ganglioside GM3 may play an important role as a trigger in differentiation induction of K562 cells. CAPE derived from honeybee propolis has been used as a folk medicine (Chung et al. 2004). Recent study also revealed that CAPE has several biological activities including antioxidation, antiinflammation, and inhibition of tumor growth (Chung et al. 2004). CAPE is also a potent and specific inhibitor of nuclear factor kappa B (NF-B) (Natarajan et al. 1996). However, although it has been reported that CAPE enhanced ATRA-induced granulocytic differentiation and induced apoptosis in HL-60, a human promyelocytic cell line (Kim et al. 2005; Kuo et al. 2006b), effects on megakaryocytic differentiation of leukemia by CAPE have not been reported to date. In the present study, we analyzed the effect of CAPE on megakaryocytic differentiation of the leukemia K562 cells. We demonstrated that ganglioside GM3 has crucial roles in the differentiation induction by CAPE treatment.
Materials and methods Reagents and antibodies CAPE, PMA, sodium fluoride (NaF), phenylmethylsulfonyl fluoride (PMSF), aprotinin, and Wright-Giemsa stain solution were purchased from Sigma-Aldrich (Saint-Louis, Mo, USA). CAPE and PMA were also solubilized in ethanol. Antibody to CD41 was purchased from Santa Cruz Biotechnology (Santa Cruz, Calif., USA). Antibodies to phospho-p65, p65, phospho-CREB, CREB, and GAPDH were purchased from Cell Signaling Technology (Beverly, Mass., USA). Anti-GM3 antibody (M2590) was purchased from Biotest Laboratories (Japan), and FITC-conjugated goat anti-mouse IgM and IgG from Biomeda (Foster City, Calif., USA). Cell culture and light microscopic analysis K562 cell line was cultured in RPMI 1640 medium (Gibco-BRL, Life Technologies) supplemented with 5% heat-inactivated fetal bovine serum, 100 U/mL penicillin, and 100 g/mL streptomycin under 5% CO2 in a humidified incubator. K562 Cells were treated for various times with 0–5 g/mL CAPE or 30 nmol/L PMA. Morphologic changes of megakaryocytic differentiation were visualized using standard optics (Nikon Eclipse 80i).
Biochem. Cell Biol. Vol. 92, 2014
Wright–Giemsa staining Cytospin preparations, after air drying, were stained with Wright–Giemsa stain (Sigma-Aldrich) according to the manufacturer’s instruction. Cell viability assay The cytotoxic effect of CAPE on K562 cells was investigated using a commercially available proliferation kit (XTT II, Boehringer Mannheim, Mannheim, Germany). Briefly, the cells were plated in 96-well culture plates at a density of 1 × 104 cells/well in 100 L of serum-depleted RPMI medium, containing various concentrations of CAPE or other drugs. After 24 h of culture, 50 L of XTT reaction solution (sodium 3=-[1-(phenyl-aminocarbonyl)3,4-tetrazolium]-bis(4-methoxy-6-nitro) benzenesulfonic acid hydrate and N-methyl dibenzopyrazine methyl sulfate; mixed in proportion 50:1) was added to the each well. The optical density was read at 490 nm wavelength in an ELISA plate reader after 4 h incubation of the plates in an incubator (37 °C and 5% CO2 + 95% air). All determinations were confirmed using replication in at least three identical experiments. Reverse transcription-polymerase chain reaction (RT-PCR) Total RNA was isolated using the Trizol reagent (Invitrogen, USA), and the cDNAs were synthesized by reverse transcriptase with an oligo-dT prime from a Takara RNA PCR kit (Takara Shuzo, Shiba, Japan) according to the manufacturer’s recommended protocol. The cDNA was amplified by PCR with the following primers: GM3 synthase, 5=- CCCTGCCATTCTGGGTACGAC-3= (sense) and 5=- CACGATCAATGCCTCCACTGAGATC -3= (antisense); CD10, 5=- GGTCATAGGACACGAAATCA -3= (sense) and 5=- AGATCACCAAACCCGGCACT -3= (antisense); CD41, 5=- AGGCCTCTGTCCAGCTAC -3= (sense) and 5=- GCCATTCCAGCCTCCGTG-3= (antisense); CD36, 5=- CTGGCTGTGTTTGGAGGTATTCT -3= (sense) and 5=- AGCGTCCTGGGTTACATTTTCC -3= (antisense); ␥-globin, 5=- GGACAAGGCTACTATCACAA -3= (sense) and 5=- CAGTGGTATCTGGAGGACAG -3= (antisense); CD44, 5=- GATCCACCCCAATTCCATCTGTGC -3= (sense) and 5=- AACCGCGAGAATCAAAGCCAAGGCC -3= (antisense); -actin, 5=- CAAGAGATGGCCACGGCTGCT -3= (sense) and 5=-TCCTTCTGCATCCTGTCGGCA-3= (antisense). The use of equal amounts of mRNA in the RT-PCR assays was confirmed by analyzing the expression levels of -actin. The PCR products were separated by gel electrophoresis on 1.5% agarose containing ethidium bromide with 1× TAE buffer. Western blot analysis K562 Cells were lysed in a buffer containing 50 mmol/L Tris-HCl (pH 8.0), 150 mmol/L NaCl, 100 mol/L NaF, 100 g/mL PMSF, 1 g/mL aprotinin, and 1% Triton X-100. Cell lysates were centrifuged at 12 000g, and supernatants were removed. Protein concentrations were measured using the Bio-Rad protein assay (Bio-Rad, Calif., USA). Samples containing equal amounts of protein were size fractionated by SDS-PAGE and electrophoretically transferred to nitrocellulose membranes using the Hoefer electrotransfer system (Amersham Biosciences, UK). The blots were probed with primary antibody as indicated. Detection was performed using a secondary horseradish peroxidase-linked antibody and the ECL chemiluminescence system (Amersham). The reused blot was stripped by washing the membrane in stripping buffer (Re-Blot plus kit, Chemicon, USA) and reprobed with the antibody indicated. Promoter-reporter assay Reporter plasmids, pGM3S-WT-CREB (pGL3-⌬177, +1 to –177 from transcription start site) and its derivative with mutation of CREB binding site, pGM3S-Mut-CREB were prepared as described previously (Choi et al. 2004; Kim et al. 2002). Mutation with base substitution at CREB binding site was accomplished using a QuikChange II XL site-directed mutagenesis kit (Stratagene, Published by NRC Research Press
Biochem. Cell Biol. Downloaded from www.nrcresearchpress.com by UNIVERSITY OF MICHIGAN on 02/09/15 For personal use only.
Jin et al.
La Jolla, Calif., USA), according to the manufacturer’s protocol with the following oligonucleotide primers: CREB-L, 5=GTCCTCGTGTTGTCAGACCCCGCCCACGCGCCCCT-3= and CREB-R, 5=-CGGGGTCTGACAACACGAGGACGCGGACGGCCAAT-3= (mutated nucleotides underlined). The presence of mutation was verified by sequence analysis. For the reporter analysis of GM3 synthase promoter, K562 cells were transfected by electroporation (Bio-Rad Gene Pulser Xcell; 950 F, 250 V) with 10 g of the luciferase reporter constructs (pGM3S-WT-CREB and pGM3S-Mut-CREB) or the reporter control vector, pGL3-basic. The cells were then incubated in RPMI 1640 medium containing 5% fetal bovine serum for 18 h and further incubated for the 24 h in the presence or absence of CAPE. Cells were harvested and luciferase activity was measured using the dual-luciferase reporter assay system kit (Promega, Madison, Wis., USA) and Luminoskan Ascent (Thermo Labsystems, Helsinki, Finland). For normalization, 3 g of a -galactosidase reporter vector (pCMV) as a transfection efficiency control was cotransfected, and -galactosidase activity was assayed using the -galactosidase enzyme assay system (Promega).
245
Fig. 1. CAPE inhibits growth of K562 cells. (A) The structure of CAPE. (B) K562 Cells treated for various times with 0–5 g/mL CAPE and (or) 30 nmol/L PMA. K562 cells were treated with CAPE were counted at the time indicated (*p < 0.05 and ** p < 0.01 in comparison with the control group). (C) K562 Cells treated with 0–10 g/mL CAPE and (or) 30 nmol/L PMA for 24 h. Cell viability was estimated using a XTT assay. (**p < 0.01 in comparison with the control group).
Preparation and transfection of small interfering RNAs Small interfering RNAs (siRNAs) duplexes were designed to target the coding sequence of GM3 synthase mRNA and synthesized by Bioneer Corp. (Korea). The target sequences of the GM3 synthase siRNA are 5=-CAGGUAUAGCGUGGACUUA-3=. Plant chlorophyll a/b-binding protein mRNA sequences as the negative control are 5=-CCUACGCCACCAAUUUCGU-3=. K562 cells were transfected with siRNAs by Gene Pulser Xcell Electroporation System (Bio-Rad) according to the manufacturer’s instructions. After 36 h incubation with fresh medium, conditioned medium was replaced for 24 h and cells were used in subsequent experiments. Statistical analysis Statistical analysis was performed using Student’s t test. All determinations were confirmed using replication in three independent experiments. The intensity of the bands obtained from Western blot was estimated with Scion Image (Scion, Mass., USA). The values are calculated by percent or ratio of control and expressed as means ± SE of three independent experiments.
Results Growth inhibition of K562 cells by CAPE CAPE, a potent flavonoid antioxidant (Fig. 1A), has varied biological activities, including anti-oxidant, anti-inflammatory, antiviral, and anti-cancer properties (Kuo et al. 2006a). Exposure of K562 cells to CAPE also inhibited growth. To determine the CAPEinduced cell growth inhibition, K562 cells treated with CAPE were counted at the time indicated. As shown in Fig. 1B, the growth of the K562 cells treated with 0.1–5 g/mL of CAPE was inhibited in a time-dependent and dose-dependent manner. When compared to the control, 1 and 5 g/mL of CAPE significantly inhibited the growth of the K562 cells after incubation for 2 and 3 days. Because CAPE did not induce sudden apoptosis for 24 h at least (data not shown), the inhibitory effect of CAPE on growth of K562 cells was compared with the level of growth inhibition (cell cycle arrest) occurred during megakaryocytic differentiation by PMA, inducer of megakaryocytic differentiation. As shown in Fig. 1B, K562 cells treated with 1 and 5 g/mL of CAPE experience cell growth inhibited at similar levels to cells treated with PMA. Notably, when CAPE (1 g/mL) was added concomitantly to PMA, greater inhibition of cell growth and reduction of cell number were observed in K562 cells. The cytotoxicity of CAPE on the K562 cells was also evaluated using XTT cell proliferation assay. The viability on K562 cells treated with 0.1–5 g/mL of CAPE or 30 nmol/L PMA was not inhibited significantly (Fig. 1C). These results indicate that CAPE induces the growth inhibition but not rapid apoptosis of K562 cells.
The enhanced expression of ganglioside GM3 during megakaryocytic differentiation of K562 cells by CAPE PMA induces megakaryocytic differentiation of K562 cells. This is accompanied by phenotypic changes and genetic modulation (Jacquel et al. 2006). In this study, to examine whether exposure of K562 cells to CAPE induces megakaryocytic differentiation, K562 cells treated with 1–5 g/mL of CAPE and 30 nmol/L PMA were used as positive control. After 3 days of treatment, K562 cells were stained using the Wright–Giemsa staining method to detectmorphological modification. As shown in Fig. 2A, some of the K562 cells treated with 5 g/mL of CAPE increased in cell size, and vacuoles were observed. The same morphological changes were also found in K562 cells teated with 30 nmol/L PMA. Published by NRC Research Press
Biochem. Cell Biol. Downloaded from www.nrcresearchpress.com by UNIVERSITY OF MICHIGAN on 02/09/15 For personal use only.
246
Biochem. Cell Biol. Vol. 92, 2014
Fig. 2. The expression of ganglioside GM3 in CAPE-induced megakaryocytic differentiation of K562 cells. (A) K562 Cells treated for various times with 0–5 g/mL CAPE or 30 nmol/L PMA for 3 days. After Wright–Giemsa staining, morphologic changes of megakaryocytic differentiation were visualized using standard optics. (B) RT-PCR analysis of differentiation markers in the K562 cells treated with indicated concentrations of CAPE for 24 h. (C) K562 cells were cultured for 24 h in the presence of 5 g/mL CAPE or 30 nmol/L PMA. Ganglioside GM3 was detected by fluorescence microscopic analysis using anti-GM3 and FITC-conjugated anti-mouse IgM. (D) K562 cells were cultured for 24 h in the presence of 0–5 g/mL CAPE or 30 nmol/L PMA. Cell lysates were separated by electrophoresis on polyacrylamide gels. CREB and p65, transcription factors, were detected by Western blot analysis. (E) Reporter plasmids, pGM3S-WT-CREB (pGL3-⌬177, +1 to –177 from transcription start site) containing promoter of GM3 synthase and its derivative with mutation of CREB binding site, pGM3S-Mut-CREB were used in this experiment. pGL3-Basic without any promoter and enhancer was used as negative control. The each transfectants were treated with or without 5 g/mL CAPE for 24 h. Cells were harvested and luciferase activity was measured using the dual-luciferase reporter assay system kit (Promega). Relative luciferase activity was normalized with -galactosidase activity derived from cotransfected pCMV.
To determine the induction of specific marker for megakaryocytic differentiation by CAPE, after K562 cells were treated with 5 g/mL of CAPE and 30 nmol/L PMA for 24 h, RT-PCR analysis was performed. As shown in Fig. 2B, expressions of two megakaryocytic differentiation markers, CD10 and CD41, were induced by both CAPE and PMA treatment. On the other hand, as erythroid markers, CD36 expression was not changed and ␥-globin expression was reduced by CAPE. Because CD44 expression was induced during PMA-induced megakaryocytic differentiation of K562 cells (Jacquel et al. 2006), CD44 expression was used here as a positive control of PMA stimulation. Unexpectedly, 5 g/mL of CAPE also increased the expression of CD44 (Fig. 2B). These data support that CAPE induces megakaryocytic differentiation of K562 cells. In a previous study, we reported that CREB-mediated expression of GM3 synthase is involved in PMA-induced megakaryocytic differentiation of K562 cells (Choi et al. 2004). Furthermore, it has been reported that the activation of CREB phosphorylated by mitogen or stress signals regulates the transcription of target genes (De Cesare et al. 1999; Mayr and Montminy 2001; Shaywitz and Greenberg 1999). First, we investigated whether the expression of ganglioside GM3 is increased during CAPE-induced megakaryocytic differentiation of K562 cells. Interestingly, immunofluo-
rescence microscopic analysis revealed that ganglioside GM3 accumulated on the membrane of K562 cells in the presence of CAPE, and PMA also induced production of ganglioside GM3, as expected (Fig. 2C). Moreover, phosphorylation of CREB, a transcription factor necessary for the transcription of GM3 synthase, was examined using Western blot analysis. Another transcription factor, p65, was used here as control of the CAPE treatment. CAPE induced the phosphorylation of CREB at concentration of 0.5– 5 g/mL, but phosphorylation of p65 was inhibited at concentration of 1–5 g/mL of CAPE, reported previously as potent inhibitor of p65 (Fig. 2D). Thirty nmol/L PMA also induced phosphorylation of CREB. To confirm whether the CAPE induces the transcriptional activation of the GM3 synthase using the GM3 synthase promoter, K562 cells were transiently transfected with GM3 synthase promoter-driven luciferase reporter plasmids. As shown in Fig. 2E, CAPE significantly enhanced the transcriptional activity of the GM3 synthase-wild type promoter (pGM3S-WT CREB) by ⬃7.5-fold, compared with the activity without CAPE treatment. Moreover, to further investigate whether the CREB binding site of GM3 synthase promoter played an important role for CAPE-induced expression of GM3 synthase in K562 cell, we used pGM3S-Mut CREB Published by NRC Research Press
Jin et al.
247
Biochem. Cell Biol. Downloaded from www.nrcresearchpress.com by UNIVERSITY OF MICHIGAN on 02/09/15 For personal use only.
Fig. 3. Effects of D-PDMP on CAPE-induced differentiation of K562. (A) K562 cells were cultured for 24 h in the presence of 5 g/mL CAPE with or without 10 mol/L PDMP. Ganglioside GM3 was detected by fluorescence microscopic analysis using anti-GM3 and FITC-conjugated antimouse IgM. (B) RT-PCR analysis of differentiation marker CD41 in the K562 cells treated with indicated concentrations of CAPE for 24 h. (C) K562 Cells were treated with 5 g/mL CAPE with or without 10 mol/L PDMP for 3 days. After Wright–Giemsa staining, morphologic changes of megakaryocytic differentiation were visualized using standard optics.
modified by mutating CREB binding site from pGM3S-WT CREB. It was observed that this change abolished the CREB binding to this CREB binding site, since mutant CREB oligomer (containing TGTTGTCA) could not compete for the binding while wild-type CREB oligomer (containing TGACGTCA) could (Choi et al. 2004). In CAPE-treated K562 cells, this mutation caused a reduction in CAPE-induced promoter activity to about 80%, compared with pGM3S-WT CREB (Fig. 2E). These results indicate that the CREB is crucial for the induction of GM3 synthase by CAPE. Effects of ganglioside GM3 on CAPE-induced megakaryocytic differentiation of K562 cells The results above show that CREB phosphorylation and GM3 synthase expression are increased in CAPE-induced megakaryocytic differentiation of K562 cells. A previous study reported that ganglioside GM3 has crucial roles in the determination of the differentiation direction as well as megakaryocytic differentiation induction itself (Nakamura et al. 1991). Accordingly, to determine the roles of ganglioside GM3 in CAPE-induced megakaryocytic differentiation of K562 cells, we employed D-PDMP, a ceramide analog, to inhibit the biosynthesis of gangliosides including GM3 (Fujii et al. 2002). After K562 cells were cultured for 24 h in the presence of 5 g/mL CAPE with or without 10 mol/L of D-PDMP, change of ganglioside GM3 was checked by fluorescence microscopic analysis. As expected, D-PDMP blocked the synthesis of ganglioside GM3 in CAPE-treated K562 cells (Fig. 3A). Furthermore, the depletion of ganglioside GM3 by D-PDMP in CAPEtreated K562 cells resulted in the inhibition of expression of the megakaryocytic differentiation marker CD41 induced by CAPE (Fig. 3B). The morphological changes of these cells were also ob-
served by light microscopic analysis after Wright–Giemsa staining. As shown in Fig. 3C, K562 cells co-treated with D-PDMP and CAPE exhibited little changes in cell size, compared with cells treated with CAPE only. To further address whether endogenous ganglioside GM3 is involved in CAPE-induced megakaryocytic differentiation of K562 cells, siRNA experiments were performed. Transfection of the siRNA for the GM3 synthase inhibited increase of GM3 synthase mRNA in response to CAPE and also blocked the transcriptional induction of megakaryocytic specific genes such as CD10 and CD41 in CAPE-treated K562 cells (Fig. 4). In erythroid specific genes, CAPE-reduced ␥-globin mRNA was recovered by GM3 synthase siRNA transfection, while CD36 was not changed. Although expression of CD44, a PMA inducible gene, was increased by CAPE treatment, this induction was not changed by GM3 synthase siRNA transfection. Furthermore, the morphological changes of these cells were observed by light microscopic analysis after Wright–Giemsa staining. As shown in Fig. 4C, K562 cells transfected with siRNA for the GM3 synthase and treated with CAPE showed little change in cell size, compared with cells treated with CAPE only. Moreover, treatment of exogenous ganglioside GM3 in K562 cells transfected with siRNA for the GM3 synthase and treated with CAPE were increased in cell size as for K562 cells treated with CPAE only. These results clearly indicate that the enhanced production of gangliosides GM3 on plasma membranes by CAPE treatment play an important role in megakaryocytic differentiation of K562 cells. Published by NRC Research Press
248
Biochem. Cell Biol. Vol. 92, 2014
Biochem. Cell Biol. Downloaded from www.nrcresearchpress.com by UNIVERSITY OF MICHIGAN on 02/09/15 For personal use only.
Fig. 4. Effects of siRNA for GM3 synthase on CAPE-induced differentiation of K562. (A) K562 cells transfected with or without siRNA for GM3 synthase were cultured for 24 h in the presence of 5 g/mL CAPE. Ganglioside GM3 was detected by fluorescence microscopic analysis using anti-GM3 and FITC-conjugated anti-mouse IgM. (B) The cells were transfected with siRNA for GM3 synthase and incubated with 5 g/mL CAPE for 24 h. RT-PCR analysis for differentiation markers was performed. siGM3 synthase (–) indicates siRNA for negative control containing plant chlorophyll a/b-binding protein mRNA sequences. (C) K562 Cells transfected with or without siRNA for GM3 synthase were treated with 5 g/mL CAPE or with 5 g/mL CAPE in the presence of ganglioside GM3 for 3 days. After Wright–Giemsa staining, morphologic changes of megakaryocytic differentiation were visualized using standard optics.
Discussion Human chronic myeloid leukemia K562 cells have been established over the years and used as suitable model system to study the mechanisms of cell differentiation of multipotent hematopoietic cells. While several chemical agents such as hemin, butyric acid, Ara-C, and many other agents were identified as erythrocytic differentiation inducers for K562 cells (Tsiftsoglou et al. 2003), studies for new agents as megakaryocytic differentiation inducers are still limited. In the present study, using pharmacological and molecular biological approaches, we explored the effects of CAPE on megakaryocytic differentiation of K562 cells and its mechanism. It has been extensively reported that K562 cells are induced to differentiate towards the megakaryocytic lineage by PMA. PMA stimulates megakaryocytic development, resulting in an inhibition of cell proliferation, phenotypic changes, and genetic modulation. These morphological modifications are characterized by increased cell size, decreased nuclear-to-cytoplasmic ratio, occurrence of vacuoles, and adhesion of cells, and genetic modulation is represented by the up-regulation of megakaryocytic specific genes such as CD10 and CD41 (Jacquel et al. 2006). Our data showed that CAPE led to inhibition of cell proliferation (Fig. 1), morphological changes, and induced expression of megakaryocytic specific genes of K562 cells (Fig. 2). This observation suggests that the changes of K562 cells induced by CAPE mimic the physiologic and genetic modulations of megakaryocytic differentiation by PMA. CREB, a transcription factor, is the target of several signaling pathways involving cell responses to extracellular stimuli, proliferation, differentiation, and adaptive responses of cell process. Several signal pathways, such as PKA, PKC, Ca2þ/CaMKs, and MAPKs could activate CREB, and the CREB activity necessary to transcription is regulated by phosphorylation at serine 133 (De Cesare et al. 1999; Shaywitz and Greenberg 1999). On the one
hand, the endogenous GM3 synthase gene expression and CREB DNA binding activity was increased in PMA-treated K562 cells (Choi et al. 2004). Previously, our reports suggested that only the consensus CREB binding site (TGACGTCA), at position –143 to –136 in GM3 synthase promoter, contributes to its transcriptional activity up-regulated by PMA (Choi et al. 2004). This also indicates that this region is essential to GM3 synthase gene expression mediated by CREB in K562 cells. In our present results, CAPE, similar to PMA, stimulated the phosphorylation of CREB and site-directed mutagenesis analysis of CREB binding site on GM3 synthase promoter strongly suggested that CREB may play an important role in CAPE-induced expression of ganglioside GM3 in K562 cells (Fig. 2). Ganglioside GM3 is the simplest ganglioside and is known to play a critical role in cell growth by modifying signal transduction and cell differentiation. Ganglioside profiles of leukemia cells showed specific patterns and were thought to be biochemical markers for human hematopoietic cell lines (Rosenfelder et al. 1982). Moreover, they were dependent upon both differentiation stages and directions of differentiation (Nojiri et al. 1985). It was also reported that exogenous ganglioside GM3 could induce monocytic differentiation, and neolacto-series gangliosides could induce granulocytic differentiation of HL-60 cells (Nojiri et al. 1988; Nojiri et al. 1986). A previous study reported that GM3, GM2, and GD1a were the major components of gangliosides in K562 cells (Suzuki et al. 1981). After induction of differentiation by PMA and hemin, whereas the GM2 and GD1a were increased, GM3 was altered in a different manner in both lineages. Ganglioside GM3 was increased in PMA-induced megakaryocytic differentiation, but decreased in hemin-induced erythrocytic differentiation. This indicates that the megakaryocytic lineage has a large amount of ganglioside GM3, compared with the erythrocytic lineage. In K562 cells, however, it was known that the accumulation of ganglioside GM3 could induce differentiation into megakaryocytic (Nakamura et al. 1991). In our experiment, CAPE treatment Published by NRC Research Press
Biochem. Cell Biol. Downloaded from www.nrcresearchpress.com by UNIVERSITY OF MICHIGAN on 02/09/15 For personal use only.
Jin et al.
of K562 cells increased the transcriptional activity of GM3 synthase promoter and synthesis of ganglioside GM3 (Fig. 2) and treatment of D-PDMP inhibiting the biosynthesis of gangliosides blocked CAPE-induced GM3 synthesis and morphological modifications of K562 cells (Fig. 3). Moreover, transformation of siRNA for GM3 synthase also blocked expression of GM3 synthase and megakaryocytic marker genes, induced by CAPE (Fig. 4). These results strongly suggest that ganglioside GM3 have crucial roles in the induction of megakaryocytic differentiation of K562 cells by CAPE treatment, supporting the previous studies about effects of ganglioside GM3 on differentiation. There have been several reports that cell surface gangliosides play a role as a regulator or an inhibitor of cell growth via the interaction with growth factor receptor kinases (Rusnati et al. 2002; Yoon et al. 2006). Other GM3-specific binding proteins might exist also in hematopoietic cells. Although the mechanism of cell differentiation by gangliosides is not yet clear, by the presented results, it seems that ganglioside GM3 accumulated by CAPE has an important role in megakaryocytic differentiation of K562 cells. In summary, our present study demonstrates that CAPE induces megakaryocytic differentiation of K562 cells through CREB-mediated induction of ganglioside GM3.
Acknowledgements The present study was supported from the Basic Science Research Program through National Research Foundation of Korea (NRF) grant, funded by the Ministry of Education, Science and Technology (MEST) of Korea (NRF-2013R1A1A2005387) and Personalized Tumor Engineering Research Center grant (2008-0062611). The funders had no role in study design, data collection, and analysis, decision to publish, or preparation of the manuscript. All of authors declare that there are no conflicts of interest. UHJ, TWC, and CHK (Cheorl-Ho Kim) designed the research; UHJ, TWC, KHS, CHK (Choong-Hwan Kwak), HJC, and KTH performed the research; UHJ, TWC, KTH, YCC, YCL, and CHK (Cheorl-Ho Kim) analyzed the data; UHJ, TWC, and CHK (Cheorl-Ho Kim) wrote the article.
References Abrahamsson, S., and Pascher, I. 1977. Structure of biological membranes: [proceedings]. Plenum Press, New York. Alitalo, R. 1990. Induced differentiation of K562 leukemia cells: a model for studies of gene expression in early megakaryoblasts. Leuk. Res. 14(6): 501– 514. doi:10.1016/0145-2126(90)90002-Q. PMID:2197510. Butler, T.M., Ziemiecki, A., and Friis, R.R. 1990. Megakaryocytic differentiation of K562 cells is associated with changes in the cytoskeletal organization and the pattern of chromatographically distinct forms of phosphotyrosyl-specific protein phosphatases. Cancer Res. 50(19): 6323–6329. PMID:2169344. Choi, H.J., Chung, T.W., Kang, N.Y., Kim, K.S., Lee, Y.C., and Kim, C.H. 2004. Involvement of CREB in the transcriptional regulation of the human GM3 synthase (hST3Gal V) gene during megakaryocytoid differentiation of human leukemia K562 cells. Biochem. Biophys. Res. Commun. 313(1): 142–147. doi: 10.1016/j.bbrc.2003.11.103. PMID:14672710. Chung, T.W., Moon, S.K., Chang, Y.C., Ko, J.H., Lee, Y.C., Cho, G., et al. 2004. Novel and therapeutic effect of caffeic acid and caffeic acid phenyl ester on hepatocarcinoma cells: complete regression of hepatoma growth and metastasis by dual mechanism. FASEB J. 18(14): 1670–1681. doi:10.1096/fj.04-2126com. PMID:15522912. De Cesare, D., Fimia, G.M., and Sassone-Corsi, P. 1999. Signaling routes to CREM and CREB: plasticity in transcriptional activation. Trends Biochem. Sci. 24(7): 281–285. doi:10.1016/S0968-0004(99)01414-0. PMID:10390618. Fishman, P.H., and Brady, R.O. 1976. Biosynthesis and function of gangliosides. Science, 194(4268): 906–915. doi:10.1126/science.185697. PMID:185697. Fujii, S., Igarashi, K., Sasaki, H., Furuse, H., Ito, K., Kaneko, K., et al. 2002. Effects of the mono- and tetrasialogangliosides GM1 and GQ1b on ATP-induced longterm potentiation in hippocampal CA1 neurons. Glycobiology, 12(5): 339– 344. doi:10.1093/glycob/12.5.339. PMID:12070076. Fukuda, M. 1981. Tumor-promoting phorbol diester-induced specific changes in cell surface glycoprotein profile of K562 human leukemic cells. Cancer Res. 41(11): 4621–4628. PMID:7306980. Herrera, R., Hubbell, S., Decker, S., and Petruzzelli, L. 1998. A role for the MEK/ MAPK pathway in PMA-induced cell cycle arrest: modulation of megakaryo-
249
cytic differentiation of K562 cells. Exp. Cell Res. 238(2): 407–414. doi:10.1006/ excr.1997.3847. PMID:9473349. Hocevar, B.A., Morrow, D.M., Tykocinski, M.L., and Fields, A.P. 1992. Protein kinase C isotypes in human erythroleukemia cell proliferation and differentiation. J. Cell Sci. 101(3): 671–679. PMID:1522149. Jacquel, A., Herrant, M., Defamie, V., Belhacene, N., Colosetti, P., Marchetti, S., et al. 2006. A survey of the signaling pathways involved in megakaryocytic differentiation of the human K562 leukemia cell line by molecular and c-DNA array analysis. Oncogene, 25(5): 781–794. doi:10.1038/sj.onc.1209119. PMID:16186797. Kim, M.K., Cho, Y.H., Kim, J.M., Chun, M.W., Lee, S.K., Lim, Y., and Lee, C.H. 2005. Induction of apoptosis in human leukemia cells by MCS-C2 via caspasedependent Bid cleavage and cytochrome c release. Cancer Lett. 223(2): 239– 247. doi:10.1016/j.canlet.2004.10.045. PMID:15896458. Kim, S.W., Lee, S.H., Kim, K.S., Kim, C.H., Choo, Y.K., and Lee, Y.C. 2002. Isolation and characterization of the promoter region of the human GM3 synthase gene. Biochim. Biophys. Acta, 1578(1–3): 84–89. doi:10.1016/S0167-4781(02) 00505-5. PMID:12393190. Kuo, H.C., Kuo, W.H., Lee, Y.J., Lin, W.L., Chou, F.P., and Tseng, T.H. 2006a. Inhibitory effect of caffeic acid phenethyl ester on the growth of C6 glioma cells in vitro and in vivo. Cancer Lett. 234(2): 199–208. doi:10.1016/j.canlet. 2005.03.046. PMID:15885897. Kuo, H.C., Kuo, W.H., Lee, Y.J., Wang, C.J., and Tseng, T.H. 2006b. Enhancement of caffeic acid phenethyl ester on all-trans retinoic acid-induced differentiation in human leukemia HL-60 cells. Toxicol. Appl. Pharmacol. 216(1): 80–88. doi:10.1016/j.taap.2006.04.007. PMID:16766008. Long, M.W., Heffner, C.H., Williams, J.L., Peters, C., and Prochownik, E.V. 1990. Regulation of megakaryocyte phenotype in human erythroleukemia cells. J. Clin. Invest. 85(4): 1072–1084. doi:10.1172/JCI114538. PMID:2318965. Mayr, B., and Montminy, M. 2001. Transcriptional regulation by the phosphorylation-dependent factor CREB. Nat. Rev. Mol. Cell Biol. 2(8): 599–609. doi:10.1038/35085068. PMID:11483993. Nakamura, M., Kirito, K., Yamanoi, J., Wainai, T., Nojiri, H., and Saito, M. 1991. Ganglioside GM3 can induce megakaryocytoid differentiation of human leukemia cell line K562 cells. Cancer Res. 51(7): 1940–1945. PMID:2004380. Natarajan, K., Singh, S., Burke, T.R., Jr., Grunberger, D., and Aggarwal, B.B. 1996. Caffeic acid phenethyl ester is a potent and specific inhibitor of activation of nuclear transcription factor NF-kappa B. Proc. Natl. Acad. Sci. U.S.A. 93(17): 9090–9095. doi:10.1073/pnas.93.17.9090. PMID:8799159. Nojiri, H., Takaku, F., Ohta, M., Miura, Y., and Saito, M. 1985. Changes in glycosphingolipid composition during differentiation of human leukemic granulocytes in chronic myelogenous leukemia compared with in vitro granulocytic differentiation of human promyelocytic leukemia cell line HL-60. Cancer Res. 45(12): 6100–6106. PMID:3864527. Nojiri, H., Takaku, F., Terui, Y., Miura, Y., and Saito, M. 1986. Ganglioside GM3: an acidic membrane component that increases during macrophage-like cell differentiation can induce monocytic differentiation of human myeloid and monocytoid leukemic cell lines HL-60 and U937. Proc. Natl. Acad. Sci. U.S.A. 83(3): 782–786. doi:10.1073/pnas.83.3.782. PMID:3456169. Nojiri, H., Kitagawa, S., Nakamura, M., Kirito, K., Enomoto, Y., and Saito, M. 1988. Neolacto-series gangliosides induce granulocytic differentiation of human promyelocytic leukemia cell line HL-60. J. Biol. Chem. 263(16): 7443–7446. PMID:2836383. Rosenfelder, G., Ziegler, A., Wernet, P., and Braun, D.G. 1982. Ganglioside patterns: new biochemical markers for human hematopoietic cell lines. J. Natl. Cancer Inst. 68(2): 203–209. doi:10.1093/jnci/68.2.203. PMID:6950153. Rusnati, M., Urbinati, C., Tanghetti, E., Dell’Era, P., Lortat-Jacob, H., and Presta, M. 2002. Cell membrane GM1 ganglioside is a functional coreceptor for fibroblast growth factor 2. Proc. Natl. Acad. Sci. U.S.A. 99(7): 4367–4372. doi:10.1073/pnas.072651899. PMID:11917140. Shaywitz, A.J., and Greenberg, M.E. 1999. CREB: a stimulus-induced transcription factor activated by a diverse array of extracellular signals. Annu. Rev. Biochem. 68: 821–861. doi:10.1146/annurev.biochem.68.1.821. PMID:10872467. Stults, C.L., Sweeley, C.C., and Macher, B.A. 1989. Glycosphingolipids: structure, biological source, and properties. Methods Enzymol. 179: 167–214. doi:10.1016/ 0076-6879(89)79122-9. PMID:2695766. Suzuki, A., Karol, R.A., Kundu, S.K., and Marcus, D.M. 1981. Glycosphingolipids of K562 cells: a chemical and immunological analysis. Int. J. Cancer, 28(3): 271–276. doi:10.1002/ijc.2910280304. PMID:7033147. Tetteroo, P.A., Massaro, F., Mulder, A., Schreuder-van Gelder, R., and von dem Borne, A.E. 1984. Megakaryoblastic differentiation of proerythroblastic K562 cell-line cells. Leuk. Res. 8(2): 197–206. doi:10.1016/0145-2126 (84)90143-7. PMID:6232432. Tsiftsoglou, A.S., Pappas, I.S., and Vizirianakis, I.S. 2003. Mechanisms involved in the induced differentiation of leukemia cells. Pharmacol. Ther. 100(3): 257– 290. doi:10.1016/j.pharmthera.2003.09.002. PMID:14652113. Varki, A. 1993. Biological roles of oligosaccharides: all of the theories are correct. Glycobiology, 3(2): 97–130. doi:10.1093/glycob/3.2.97. PMID:8490246. Yoon, S.J., Nakayama, K., Hikita, T., Handa, K., and Hakomori, S.I. 2006. Epidermal growth factor receptor tyrosine kinase is modulated by GM3 interaction with N-linked GlcNAc termini of the receptor. Proc. Natl. Acad. Sci. U.S.A. 103(50): 18987–18991. doi:10.1073/pnas.0609281103. PMID:17142315.
Published by NRC Research Press
Biochem. Cell Biol. Downloaded from www.nrcresearchpress.com by UNIVERSITY OF MICHIGAN on 02/09/15 For personal use only.
ARTICLE Ganglioside GM3 is required for caffeic acid phenethyl ester-induced megakaryocytic differentiation of human chronic myelogenous leukemia K562 cells Un-Ho Jin, Tae-Wook Chung, Kwon-Ho Song, Choong-Hwan Kwak, Hee-Jung Choi, Ki-Tae Ha, Young-Chae Chang, Young-Choon Lee, and Cheorl-Ho Kim
Abstract: The human chronic myelogenous cell line K562 has been used extensively as a model for the study of leukemia differentiation. We show here that treatment of K562 cells with caffeic acid phenethyl ester (CAPE) induced a majority of cells to differentiate towards the megakaryocytic lineage. Microscopy analysis showed that K562 cells treated with CAPE exhibited characteristic features of physiological megakaryocytic differentiation, including the presence of vacuoles and demarcation membranes. Differentiation of K562 cells treated with CAPE was also accompanied by a net increase in megakaryocytic markers. The transcriptional activity of lactosylceramide ␣-2,3-sialyltransferase (GM3 synthase) and synthesis of ganglioside GM3 were increased by CAPE treatment. The promoter analysis of GM3 synthase demonstrated that CAPE induced the expression of GM3 synthase mRNA via activation of the cAMP response element-binding protein (CREB), transcription factor in nucleus. Interestingly, the inhibition of ganglioside GM3 synthesis by D-threo-1-phenyl-2-decanoylamino-3-morpholino-1-propranol (D-PDMP) and GM3 synthase-siRNA blocked the CAPE-induced expression of the megakaryocytic markers and differentiation of K562 cells. Taken together, these results suggest that CAPE induces ganglioside GM3-mediated megakaryocytic differentiation of human chronic myelogenous cells. Key words: caffeic acid phenethyl ester, megakaryocytic differentiation, ganglioside GM3, cAMP response element-binding protein. Résumé : La lignée cellulaire myélogène chronique humaine K562 a été largement utilisée comme modèle d’étude de la différenciation des cellules leucémiques. Les auteurs montrent ici que le traitement des cellules K562 avec le phénylester d’acide caféique (PEAC) induisait la différenciation de la majorité des cellules vers le lignage des mégacaryocytes. L’analyse en microscopie a montré que les cellules K562 traitées au PEAC présentaient des caractéristiques de la différenciation physiologique en mégacaryocytes, incluant la présence de vacuoles et de membranes de démarcation. La différenciation des cellules K562 traitées au PEAC s’accompagnait aussi d’un accroissement net des marqueurs des mégacaryocytes. L’activité transciptionnelle de la lactosylcéramide a-2,3-sialyltransférase (GM3 synthase) et la synthèse du ganglioside GM3 étaient accrues par le traitement au PEAC. L’analyse du promoteur de la GM3 synthase a démontré que le PEAC induisait l’expression de l’ARNm de la GM3 synthase au moyen de l’activation de la protéine CREB (cAMP response element binding), un facteur de transcription nucléaire. Fait intéressant, l’inhibition de la synthèse du ganglioside GM3 par le D-thréo-1-phényl-1-2-décanoylamino-3-morpholino-1-propanolol (D-PDMP) ou par un pARNi de la GM3 synthase bloquait l’expression des marqueurs des mégacaryocytes induite par le PEAC et la différenciation des cellules K562. Dans leur ensemble, ces résultats suggèrent que le PEAC induit la différenciation des cellules myélogènes chroniques en mégacaryocytes par l’intermédiaire du ganglioside GM3. [Traduit par la Rédaction] Mots-clés : phénylester d’acide caféique, différenciation en mégacaryocytes, ganglioside GM3, CREB.
Introduction Ganglioside GM3, sialic acid (NeuAc)-containing glycosphingolipid, is the first and the simplest of the gangliosides and are found on the outer leaflet of the plasma membrane in vertebrates (Abrahamsson and Pascher 1977; Nakamura et al. 1991; Stults et al. 1989). It plays important roles in a large variety of biological pro-
cesses, such as cellular interactions, differentiation, oncogenesis, adhesion, cell growth, and receptor function in various cell systems (Varki 1993). Ganglioside GM3 is synthesized by GM3 synthase, which catalyzes the transfer of NeuAc from CMP-NeuAc to the nonreducing terminal galactose of lactosylceramide in human. GM3 synthase is a key regulatory enzyme for ganglioside
Received 24 January 2014. Revision received 25 April 2014. Accepted 30 April 2014. Abbreviations: CAPE, caffeic acid phenethyl ester; PMA, phorbol 12-myristate 13-acetate; NF-B, nuclear factor kappa B; GM3 synthase, human lactosylceramide ␣-2,3-sialyltransferase; D-PDMP, D-threo-1-phenyl-2-decanoylamino-3-morpholino-1-propranol. U.-H. Jin,*,† T.-W. Chung,† K.-H. Song, C.-H. Kwak, and C.-H. Kim. Molecular and Cellular Glycobiology Unit, Department of Biological Sciences, Sungkyunkwan University, Jangan-Gu, Suwon City, Kyunggi-Do 440-746, Korea. H.-J. Choi. Molecular and Cellular Glycobiology Unit, Department of Biological Sciences, Sungkyunkwan University, Jangan-Gu, Suwon City, Kyunggi-Do 440-746, Korea; Division of Applied Medicine, School of Korean Medicine, Pusan National University, Yangsan, Gyeongnam, Republic of Korea. K.-T. Ha. Division of Applied Medicine, School of Korean Medicine, Pusan National University, Yangsan, Gyeongnam, Republic of Korea. Y.-C. Chang. Catholic University of Daegu School of Medicine, Nam-gu, Daegu 705-034, Republic of Korea. Y.-C. Lee. Faculty of Medicinal Biotechnology, Dong-A University, Saha-Gu, Busan 604-714, Korea. Corresponding author: Cheorl-Ho Kim (e-mail: [email protected]). *Present address: Institute of Biosciences and Technology, Texas A&M Health Science Center, Houston, TX, 77030 USA. †These two authors equally contributed to the present study. Biochem. Cell Biol. 92: 243–249 (2014) dx.doi.org/10.1139/bcb-2014-0015
Published at www.nrcresearchpress.com/bcb on 13 May 2014.
Biochem. Cell Biol. Downloaded from www.nrcresearchpress.com by UNIVERSITY OF MICHIGAN on 02/09/15 For personal use only.
244
biosynthesis, because it catalyzes the first committed step in the synthesis of nearly all gangliosides (Fishman and Brady 1976). The K562 cell line serves as a model to study the molecular mechanisms associated with leukemia differentiation. The K562 cell line is thought to be multipotent hematopoietic cells and to be capable of differentiating into erythrocytic, monocytic, granulocytic, and megakaryocytic lineages (Jacquel et al. 2006; Nakamura et al. 1991). A widely used model for studying megakaryocytic differentiation is phorbol 12-myristate 13-acetate (PMA)-induced differentiation of K562 (Alitalo 1990; Herrera et al. 1998). PMA-induced differentiation is characterized by changes in cell morphology and adhesive properties, cell growth arrest, endomitosis, and expression of markers associated with megakaryocytes (Butler et al. 1990; Fukuda 1981; Hocevar et al. 1992; Long et al. 1990; Tetteroo et al. 1984). The amount of ganglioside GM3 increases with a concomitant increase of GM3 synthase activity during megakaryocytic differentiation of K562 cells treated with PMA, which is a megakaryocytic differentiation inducer, but not with an erythrocyte differentiation inducer, such as hemin (Nakamura et al. 1991). Also, GM3 synthase activity is remarkably elevated in a timedependent manner during megakaryocytic differentiation (Choi et al. 2004). Previously, changes in glycosphingolipids during megakaryocytic cell differentiation were studied using human leukemia cell line K562 cells, and it was demonstrated that exogenous ganglioside GM3 induced magakaryocytic differentiation in K562 cells (Nakamura et al. 1991). Our previous studies also showed that CREB-mediated GM3 accumulation played a significant role in the megakaryocytic differentiation of K562 cells by PMA (Choi et al. 2004). This indicated that ganglioside GM3 may play an important role as a trigger in differentiation induction of K562 cells. CAPE derived from honeybee propolis has been used as a folk medicine (Chung et al. 2004). Recent study also revealed that CAPE has several biological activities including antioxidation, antiinflammation, and inhibition of tumor growth (Chung et al. 2004). CAPE is also a potent and specific inhibitor of nuclear factor kappa B (NF-B) (Natarajan et al. 1996). However, although it has been reported that CAPE enhanced ATRA-induced granulocytic differentiation and induced apoptosis in HL-60, a human promyelocytic cell line (Kim et al. 2005; Kuo et al. 2006b), effects on megakaryocytic differentiation of leukemia by CAPE have not been reported to date. In the present study, we analyzed the effect of CAPE on megakaryocytic differentiation of the leukemia K562 cells. We demonstrated that ganglioside GM3 has crucial roles in the differentiation induction by CAPE treatment.
Materials and methods Reagents and antibodies CAPE, PMA, sodium fluoride (NaF), phenylmethylsulfonyl fluoride (PMSF), aprotinin, and Wright-Giemsa stain solution were purchased from Sigma-Aldrich (Saint-Louis, Mo, USA). CAPE and PMA were also solubilized in ethanol. Antibody to CD41 was purchased from Santa Cruz Biotechnology (Santa Cruz, Calif., USA). Antibodies to phospho-p65, p65, phospho-CREB, CREB, and GAPDH were purchased from Cell Signaling Technology (Beverly, Mass., USA). Anti-GM3 antibody (M2590) was purchased from Biotest Laboratories (Japan), and FITC-conjugated goat anti-mouse IgM and IgG from Biomeda (Foster City, Calif., USA). Cell culture and light microscopic analysis K562 cell line was cultured in RPMI 1640 medium (Gibco-BRL, Life Technologies) supplemented with 5% heat-inactivated fetal bovine serum, 100 U/mL penicillin, and 100 g/mL streptomycin under 5% CO2 in a humidified incubator. K562 Cells were treated for various times with 0–5 g/mL CAPE or 30 nmol/L PMA. Morphologic changes of megakaryocytic differentiation were visualized using standard optics (Nikon Eclipse 80i).
Biochem. Cell Biol. Vol. 92, 2014
Wright–Giemsa staining Cytospin preparations, after air drying, were stained with Wright–Giemsa stain (Sigma-Aldrich) according to the manufacturer’s instruction. Cell viability assay The cytotoxic effect of CAPE on K562 cells was investigated using a commercially available proliferation kit (XTT II, Boehringer Mannheim, Mannheim, Germany). Briefly, the cells were plated in 96-well culture plates at a density of 1 × 104 cells/well in 100 L of serum-depleted RPMI medium, containing various concentrations of CAPE or other drugs. After 24 h of culture, 50 L of XTT reaction solution (sodium 3=-[1-(phenyl-aminocarbonyl)3,4-tetrazolium]-bis(4-methoxy-6-nitro) benzenesulfonic acid hydrate and N-methyl dibenzopyrazine methyl sulfate; mixed in proportion 50:1) was added to the each well. The optical density was read at 490 nm wavelength in an ELISA plate reader after 4 h incubation of the plates in an incubator (37 °C and 5% CO2 + 95% air). All determinations were confirmed using replication in at least three identical experiments. Reverse transcription-polymerase chain reaction (RT-PCR) Total RNA was isolated using the Trizol reagent (Invitrogen, USA), and the cDNAs were synthesized by reverse transcriptase with an oligo-dT prime from a Takara RNA PCR kit (Takara Shuzo, Shiba, Japan) according to the manufacturer’s recommended protocol. The cDNA was amplified by PCR with the following primers: GM3 synthase, 5=- CCCTGCCATTCTGGGTACGAC-3= (sense) and 5=- CACGATCAATGCCTCCACTGAGATC -3= (antisense); CD10, 5=- GGTCATAGGACACGAAATCA -3= (sense) and 5=- AGATCACCAAACCCGGCACT -3= (antisense); CD41, 5=- AGGCCTCTGTCCAGCTAC -3= (sense) and 5=- GCCATTCCAGCCTCCGTG-3= (antisense); CD36, 5=- CTGGCTGTGTTTGGAGGTATTCT -3= (sense) and 5=- AGCGTCCTGGGTTACATTTTCC -3= (antisense); ␥-globin, 5=- GGACAAGGCTACTATCACAA -3= (sense) and 5=- CAGTGGTATCTGGAGGACAG -3= (antisense); CD44, 5=- GATCCACCCCAATTCCATCTGTGC -3= (sense) and 5=- AACCGCGAGAATCAAAGCCAAGGCC -3= (antisense); -actin, 5=- CAAGAGATGGCCACGGCTGCT -3= (sense) and 5=-TCCTTCTGCATCCTGTCGGCA-3= (antisense). The use of equal amounts of mRNA in the RT-PCR assays was confirmed by analyzing the expression levels of -actin. The PCR products were separated by gel electrophoresis on 1.5% agarose containing ethidium bromide with 1× TAE buffer. Western blot analysis K562 Cells were lysed in a buffer containing 50 mmol/L Tris-HCl (pH 8.0), 150 mmol/L NaCl, 100 mol/L NaF, 100 g/mL PMSF, 1 g/mL aprotinin, and 1% Triton X-100. Cell lysates were centrifuged at 12 000g, and supernatants were removed. Protein concentrations were measured using the Bio-Rad protein assay (Bio-Rad, Calif., USA). Samples containing equal amounts of protein were size fractionated by SDS-PAGE and electrophoretically transferred to nitrocellulose membranes using the Hoefer electrotransfer system (Amersham Biosciences, UK). The blots were probed with primary antibody as indicated. Detection was performed using a secondary horseradish peroxidase-linked antibody and the ECL chemiluminescence system (Amersham). The reused blot was stripped by washing the membrane in stripping buffer (Re-Blot plus kit, Chemicon, USA) and reprobed with the antibody indicated. Promoter-reporter assay Reporter plasmids, pGM3S-WT-CREB (pGL3-⌬177, +1 to –177 from transcription start site) and its derivative with mutation of CREB binding site, pGM3S-Mut-CREB were prepared as described previously (Choi et al. 2004; Kim et al. 2002). Mutation with base substitution at CREB binding site was accomplished using a QuikChange II XL site-directed mutagenesis kit (Stratagene, Published by NRC Research Press
Biochem. Cell Biol. Downloaded from www.nrcresearchpress.com by UNIVERSITY OF MICHIGAN on 02/09/15 For personal use only.
Jin et al.
La Jolla, Calif., USA), according to the manufacturer’s protocol with the following oligonucleotide primers: CREB-L, 5=GTCCTCGTGTTGTCAGACCCCGCCCACGCGCCCCT-3= and CREB-R, 5=-CGGGGTCTGACAACACGAGGACGCGGACGGCCAAT-3= (mutated nucleotides underlined). The presence of mutation was verified by sequence analysis. For the reporter analysis of GM3 synthase promoter, K562 cells were transfected by electroporation (Bio-Rad Gene Pulser Xcell; 950 F, 250 V) with 10 g of the luciferase reporter constructs (pGM3S-WT-CREB and pGM3S-Mut-CREB) or the reporter control vector, pGL3-basic. The cells were then incubated in RPMI 1640 medium containing 5% fetal bovine serum for 18 h and further incubated for the 24 h in the presence or absence of CAPE. Cells were harvested and luciferase activity was measured using the dual-luciferase reporter assay system kit (Promega, Madison, Wis., USA) and Luminoskan Ascent (Thermo Labsystems, Helsinki, Finland). For normalization, 3 g of a -galactosidase reporter vector (pCMV) as a transfection efficiency control was cotransfected, and -galactosidase activity was assayed using the -galactosidase enzyme assay system (Promega).
245
Fig. 1. CAPE inhibits growth of K562 cells. (A) The structure of CAPE. (B) K562 Cells treated for various times with 0–5 g/mL CAPE and (or) 30 nmol/L PMA. K562 cells were treated with CAPE were counted at the time indicated (*p < 0.05 and ** p < 0.01 in comparison with the control group). (C) K562 Cells treated with 0–10 g/mL CAPE and (or) 30 nmol/L PMA for 24 h. Cell viability was estimated using a XTT assay. (**p < 0.01 in comparison with the control group).
Preparation and transfection of small interfering RNAs Small interfering RNAs (siRNAs) duplexes were designed to target the coding sequence of GM3 synthase mRNA and synthesized by Bioneer Corp. (Korea). The target sequences of the GM3 synthase siRNA are 5=-CAGGUAUAGCGUGGACUUA-3=. Plant chlorophyll a/b-binding protein mRNA sequences as the negative control are 5=-CCUACGCCACCAAUUUCGU-3=. K562 cells were transfected with siRNAs by Gene Pulser Xcell Electroporation System (Bio-Rad) according to the manufacturer’s instructions. After 36 h incubation with fresh medium, conditioned medium was replaced for 24 h and cells were used in subsequent experiments. Statistical analysis Statistical analysis was performed using Student’s t test. All determinations were confirmed using replication in three independent experiments. The intensity of the bands obtained from Western blot was estimated with Scion Image (Scion, Mass., USA). The values are calculated by percent or ratio of control and expressed as means ± SE of three independent experiments.
Results Growth inhibition of K562 cells by CAPE CAPE, a potent flavonoid antioxidant (Fig. 1A), has varied biological activities, including anti-oxidant, anti-inflammatory, antiviral, and anti-cancer properties (Kuo et al. 2006a). Exposure of K562 cells to CAPE also inhibited growth. To determine the CAPEinduced cell growth inhibition, K562 cells treated with CAPE were counted at the time indicated. As shown in Fig. 1B, the growth of the K562 cells treated with 0.1–5 g/mL of CAPE was inhibited in a time-dependent and dose-dependent manner. When compared to the control, 1 and 5 g/mL of CAPE significantly inhibited the growth of the K562 cells after incubation for 2 and 3 days. Because CAPE did not induce sudden apoptosis for 24 h at least (data not shown), the inhibitory effect of CAPE on growth of K562 cells was compared with the level of growth inhibition (cell cycle arrest) occurred during megakaryocytic differentiation by PMA, inducer of megakaryocytic differentiation. As shown in Fig. 1B, K562 cells treated with 1 and 5 g/mL of CAPE experience cell growth inhibited at similar levels to cells treated with PMA. Notably, when CAPE (1 g/mL) was added concomitantly to PMA, greater inhibition of cell growth and reduction of cell number were observed in K562 cells. The cytotoxicity of CAPE on the K562 cells was also evaluated using XTT cell proliferation assay. The viability on K562 cells treated with 0.1–5 g/mL of CAPE or 30 nmol/L PMA was not inhibited significantly (Fig. 1C). These results indicate that CAPE induces the growth inhibition but not rapid apoptosis of K562 cells.
The enhanced expression of ganglioside GM3 during megakaryocytic differentiation of K562 cells by CAPE PMA induces megakaryocytic differentiation of K562 cells. This is accompanied by phenotypic changes and genetic modulation (Jacquel et al. 2006). In this study, to examine whether exposure of K562 cells to CAPE induces megakaryocytic differentiation, K562 cells treated with 1–5 g/mL of CAPE and 30 nmol/L PMA were used as positive control. After 3 days of treatment, K562 cells were stained using the Wright–Giemsa staining method to detectmorphological modification. As shown in Fig. 2A, some of the K562 cells treated with 5 g/mL of CAPE increased in cell size, and vacuoles were observed. The same morphological changes were also found in K562 cells teated with 30 nmol/L PMA. Published by NRC Research Press
Biochem. Cell Biol. Downloaded from www.nrcresearchpress.com by UNIVERSITY OF MICHIGAN on 02/09/15 For personal use only.
246
Biochem. Cell Biol. Vol. 92, 2014
Fig. 2. The expression of ganglioside GM3 in CAPE-induced megakaryocytic differentiation of K562 cells. (A) K562 Cells treated for various times with 0–5 g/mL CAPE or 30 nmol/L PMA for 3 days. After Wright–Giemsa staining, morphologic changes of megakaryocytic differentiation were visualized using standard optics. (B) RT-PCR analysis of differentiation markers in the K562 cells treated with indicated concentrations of CAPE for 24 h. (C) K562 cells were cultured for 24 h in the presence of 5 g/mL CAPE or 30 nmol/L PMA. Ganglioside GM3 was detected by fluorescence microscopic analysis using anti-GM3 and FITC-conjugated anti-mouse IgM. (D) K562 cells were cultured for 24 h in the presence of 0–5 g/mL CAPE or 30 nmol/L PMA. Cell lysates were separated by electrophoresis on polyacrylamide gels. CREB and p65, transcription factors, were detected by Western blot analysis. (E) Reporter plasmids, pGM3S-WT-CREB (pGL3-⌬177, +1 to –177 from transcription start site) containing promoter of GM3 synthase and its derivative with mutation of CREB binding site, pGM3S-Mut-CREB were used in this experiment. pGL3-Basic without any promoter and enhancer was used as negative control. The each transfectants were treated with or without 5 g/mL CAPE for 24 h. Cells were harvested and luciferase activity was measured using the dual-luciferase reporter assay system kit (Promega). Relative luciferase activity was normalized with -galactosidase activity derived from cotransfected pCMV.
To determine the induction of specific marker for megakaryocytic differentiation by CAPE, after K562 cells were treated with 5 g/mL of CAPE and 30 nmol/L PMA for 24 h, RT-PCR analysis was performed. As shown in Fig. 2B, expressions of two megakaryocytic differentiation markers, CD10 and CD41, were induced by both CAPE and PMA treatment. On the other hand, as erythroid markers, CD36 expression was not changed and ␥-globin expression was reduced by CAPE. Because CD44 expression was induced during PMA-induced megakaryocytic differentiation of K562 cells (Jacquel et al. 2006), CD44 expression was used here as a positive control of PMA stimulation. Unexpectedly, 5 g/mL of CAPE also increased the expression of CD44 (Fig. 2B). These data support that CAPE induces megakaryocytic differentiation of K562 cells. In a previous study, we reported that CREB-mediated expression of GM3 synthase is involved in PMA-induced megakaryocytic differentiation of K562 cells (Choi et al. 2004). Furthermore, it has been reported that the activation of CREB phosphorylated by mitogen or stress signals regulates the transcription of target genes (De Cesare et al. 1999; Mayr and Montminy 2001; Shaywitz and Greenberg 1999). First, we investigated whether the expression of ganglioside GM3 is increased during CAPE-induced megakaryocytic differentiation of K562 cells. Interestingly, immunofluo-
rescence microscopic analysis revealed that ganglioside GM3 accumulated on the membrane of K562 cells in the presence of CAPE, and PMA also induced production of ganglioside GM3, as expected (Fig. 2C). Moreover, phosphorylation of CREB, a transcription factor necessary for the transcription of GM3 synthase, was examined using Western blot analysis. Another transcription factor, p65, was used here as control of the CAPE treatment. CAPE induced the phosphorylation of CREB at concentration of 0.5– 5 g/mL, but phosphorylation of p65 was inhibited at concentration of 1–5 g/mL of CAPE, reported previously as potent inhibitor of p65 (Fig. 2D). Thirty nmol/L PMA also induced phosphorylation of CREB. To confirm whether the CAPE induces the transcriptional activation of the GM3 synthase using the GM3 synthase promoter, K562 cells were transiently transfected with GM3 synthase promoter-driven luciferase reporter plasmids. As shown in Fig. 2E, CAPE significantly enhanced the transcriptional activity of the GM3 synthase-wild type promoter (pGM3S-WT CREB) by ⬃7.5-fold, compared with the activity without CAPE treatment. Moreover, to further investigate whether the CREB binding site of GM3 synthase promoter played an important role for CAPE-induced expression of GM3 synthase in K562 cell, we used pGM3S-Mut CREB Published by NRC Research Press
Jin et al.
247
Biochem. Cell Biol. Downloaded from www.nrcresearchpress.com by UNIVERSITY OF MICHIGAN on 02/09/15 For personal use only.
Fig. 3. Effects of D-PDMP on CAPE-induced differentiation of K562. (A) K562 cells were cultured for 24 h in the presence of 5 g/mL CAPE with or without 10 mol/L PDMP. Ganglioside GM3 was detected by fluorescence microscopic analysis using anti-GM3 and FITC-conjugated antimouse IgM. (B) RT-PCR analysis of differentiation marker CD41 in the K562 cells treated with indicated concentrations of CAPE for 24 h. (C) K562 Cells were treated with 5 g/mL CAPE with or without 10 mol/L PDMP for 3 days. After Wright–Giemsa staining, morphologic changes of megakaryocytic differentiation were visualized using standard optics.
modified by mutating CREB binding site from pGM3S-WT CREB. It was observed that this change abolished the CREB binding to this CREB binding site, since mutant CREB oligomer (containing TGTTGTCA) could not compete for the binding while wild-type CREB oligomer (containing TGACGTCA) could (Choi et al. 2004). In CAPE-treated K562 cells, this mutation caused a reduction in CAPE-induced promoter activity to about 80%, compared with pGM3S-WT CREB (Fig. 2E). These results indicate that the CREB is crucial for the induction of GM3 synthase by CAPE. Effects of ganglioside GM3 on CAPE-induced megakaryocytic differentiation of K562 cells The results above show that CREB phosphorylation and GM3 synthase expression are increased in CAPE-induced megakaryocytic differentiation of K562 cells. A previous study reported that ganglioside GM3 has crucial roles in the determination of the differentiation direction as well as megakaryocytic differentiation induction itself (Nakamura et al. 1991). Accordingly, to determine the roles of ganglioside GM3 in CAPE-induced megakaryocytic differentiation of K562 cells, we employed D-PDMP, a ceramide analog, to inhibit the biosynthesis of gangliosides including GM3 (Fujii et al. 2002). After K562 cells were cultured for 24 h in the presence of 5 g/mL CAPE with or without 10 mol/L of D-PDMP, change of ganglioside GM3 was checked by fluorescence microscopic analysis. As expected, D-PDMP blocked the synthesis of ganglioside GM3 in CAPE-treated K562 cells (Fig. 3A). Furthermore, the depletion of ganglioside GM3 by D-PDMP in CAPEtreated K562 cells resulted in the inhibition of expression of the megakaryocytic differentiation marker CD41 induced by CAPE (Fig. 3B). The morphological changes of these cells were also ob-
served by light microscopic analysis after Wright–Giemsa staining. As shown in Fig. 3C, K562 cells co-treated with D-PDMP and CAPE exhibited little changes in cell size, compared with cells treated with CAPE only. To further address whether endogenous ganglioside GM3 is involved in CAPE-induced megakaryocytic differentiation of K562 cells, siRNA experiments were performed. Transfection of the siRNA for the GM3 synthase inhibited increase of GM3 synthase mRNA in response to CAPE and also blocked the transcriptional induction of megakaryocytic specific genes such as CD10 and CD41 in CAPE-treated K562 cells (Fig. 4). In erythroid specific genes, CAPE-reduced ␥-globin mRNA was recovered by GM3 synthase siRNA transfection, while CD36 was not changed. Although expression of CD44, a PMA inducible gene, was increased by CAPE treatment, this induction was not changed by GM3 synthase siRNA transfection. Furthermore, the morphological changes of these cells were observed by light microscopic analysis after Wright–Giemsa staining. As shown in Fig. 4C, K562 cells transfected with siRNA for the GM3 synthase and treated with CAPE showed little change in cell size, compared with cells treated with CAPE only. Moreover, treatment of exogenous ganglioside GM3 in K562 cells transfected with siRNA for the GM3 synthase and treated with CAPE were increased in cell size as for K562 cells treated with CPAE only. These results clearly indicate that the enhanced production of gangliosides GM3 on plasma membranes by CAPE treatment play an important role in megakaryocytic differentiation of K562 cells. Published by NRC Research Press
248
Biochem. Cell Biol. Vol. 92, 2014
Biochem. Cell Biol. Downloaded from www.nrcresearchpress.com by UNIVERSITY OF MICHIGAN on 02/09/15 For personal use only.
Fig. 4. Effects of siRNA for GM3 synthase on CAPE-induced differentiation of K562. (A) K562 cells transfected with or without siRNA for GM3 synthase were cultured for 24 h in the presence of 5 g/mL CAPE. Ganglioside GM3 was detected by fluorescence microscopic analysis using anti-GM3 and FITC-conjugated anti-mouse IgM. (B) The cells were transfected with siRNA for GM3 synthase and incubated with 5 g/mL CAPE for 24 h. RT-PCR analysis for differentiation markers was performed. siGM3 synthase (–) indicates siRNA for negative control containing plant chlorophyll a/b-binding protein mRNA sequences. (C) K562 Cells transfected with or without siRNA for GM3 synthase were treated with 5 g/mL CAPE or with 5 g/mL CAPE in the presence of ganglioside GM3 for 3 days. After Wright–Giemsa staining, morphologic changes of megakaryocytic differentiation were visualized using standard optics.
Discussion Human chronic myeloid leukemia K562 cells have been established over the years and used as suitable model system to study the mechanisms of cell differentiation of multipotent hematopoietic cells. While several chemical agents such as hemin, butyric acid, Ara-C, and many other agents were identified as erythrocytic differentiation inducers for K562 cells (Tsiftsoglou et al. 2003), studies for new agents as megakaryocytic differentiation inducers are still limited. In the present study, using pharmacological and molecular biological approaches, we explored the effects of CAPE on megakaryocytic differentiation of K562 cells and its mechanism. It has been extensively reported that K562 cells are induced to differentiate towards the megakaryocytic lineage by PMA. PMA stimulates megakaryocytic development, resulting in an inhibition of cell proliferation, phenotypic changes, and genetic modulation. These morphological modifications are characterized by increased cell size, decreased nuclear-to-cytoplasmic ratio, occurrence of vacuoles, and adhesion of cells, and genetic modulation is represented by the up-regulation of megakaryocytic specific genes such as CD10 and CD41 (Jacquel et al. 2006). Our data showed that CAPE led to inhibition of cell proliferation (Fig. 1), morphological changes, and induced expression of megakaryocytic specific genes of K562 cells (Fig. 2). This observation suggests that the changes of K562 cells induced by CAPE mimic the physiologic and genetic modulations of megakaryocytic differentiation by PMA. CREB, a transcription factor, is the target of several signaling pathways involving cell responses to extracellular stimuli, proliferation, differentiation, and adaptive responses of cell process. Several signal pathways, such as PKA, PKC, Ca2þ/CaMKs, and MAPKs could activate CREB, and the CREB activity necessary to transcription is regulated by phosphorylation at serine 133 (De Cesare et al. 1999; Shaywitz and Greenberg 1999). On the one
hand, the endogenous GM3 synthase gene expression and CREB DNA binding activity was increased in PMA-treated K562 cells (Choi et al. 2004). Previously, our reports suggested that only the consensus CREB binding site (TGACGTCA), at position –143 to –136 in GM3 synthase promoter, contributes to its transcriptional activity up-regulated by PMA (Choi et al. 2004). This also indicates that this region is essential to GM3 synthase gene expression mediated by CREB in K562 cells. In our present results, CAPE, similar to PMA, stimulated the phosphorylation of CREB and site-directed mutagenesis analysis of CREB binding site on GM3 synthase promoter strongly suggested that CREB may play an important role in CAPE-induced expression of ganglioside GM3 in K562 cells (Fig. 2). Ganglioside GM3 is the simplest ganglioside and is known to play a critical role in cell growth by modifying signal transduction and cell differentiation. Ganglioside profiles of leukemia cells showed specific patterns and were thought to be biochemical markers for human hematopoietic cell lines (Rosenfelder et al. 1982). Moreover, they were dependent upon both differentiation stages and directions of differentiation (Nojiri et al. 1985). It was also reported that exogenous ganglioside GM3 could induce monocytic differentiation, and neolacto-series gangliosides could induce granulocytic differentiation of HL-60 cells (Nojiri et al. 1988; Nojiri et al. 1986). A previous study reported that GM3, GM2, and GD1a were the major components of gangliosides in K562 cells (Suzuki et al. 1981). After induction of differentiation by PMA and hemin, whereas the GM2 and GD1a were increased, GM3 was altered in a different manner in both lineages. Ganglioside GM3 was increased in PMA-induced megakaryocytic differentiation, but decreased in hemin-induced erythrocytic differentiation. This indicates that the megakaryocytic lineage has a large amount of ganglioside GM3, compared with the erythrocytic lineage. In K562 cells, however, it was known that the accumulation of ganglioside GM3 could induce differentiation into megakaryocytic (Nakamura et al. 1991). In our experiment, CAPE treatment Published by NRC Research Press
Biochem. Cell Biol. Downloaded from www.nrcresearchpress.com by UNIVERSITY OF MICHIGAN on 02/09/15 For personal use only.
Jin et al.
of K562 cells increased the transcriptional activity of GM3 synthase promoter and synthesis of ganglioside GM3 (Fig. 2) and treatment of D-PDMP inhibiting the biosynthesis of gangliosides blocked CAPE-induced GM3 synthesis and morphological modifications of K562 cells (Fig. 3). Moreover, transformation of siRNA for GM3 synthase also blocked expression of GM3 synthase and megakaryocytic marker genes, induced by CAPE (Fig. 4). These results strongly suggest that ganglioside GM3 have crucial roles in the induction of megakaryocytic differentiation of K562 cells by CAPE treatment, supporting the previous studies about effects of ganglioside GM3 on differentiation. There have been several reports that cell surface gangliosides play a role as a regulator or an inhibitor of cell growth via the interaction with growth factor receptor kinases (Rusnati et al. 2002; Yoon et al. 2006). Other GM3-specific binding proteins might exist also in hematopoietic cells. Although the mechanism of cell differentiation by gangliosides is not yet clear, by the presented results, it seems that ganglioside GM3 accumulated by CAPE has an important role in megakaryocytic differentiation of K562 cells. In summary, our present study demonstrates that CAPE induces megakaryocytic differentiation of K562 cells through CREB-mediated induction of ganglioside GM3.
Acknowledgements The present study was supported from the Basic Science Research Program through National Research Foundation of Korea (NRF) grant, funded by the Ministry of Education, Science and Technology (MEST) of Korea (NRF-2013R1A1A2005387) and Personalized Tumor Engineering Research Center grant (2008-0062611). The funders had no role in study design, data collection, and analysis, decision to publish, or preparation of the manuscript. All of authors declare that there are no conflicts of interest. UHJ, TWC, and CHK (Cheorl-Ho Kim) designed the research; UHJ, TWC, KHS, CHK (Choong-Hwan Kwak), HJC, and KTH performed the research; UHJ, TWC, KTH, YCC, YCL, and CHK (Cheorl-Ho Kim) analyzed the data; UHJ, TWC, and CHK (Cheorl-Ho Kim) wrote the article.
References Abrahamsson, S., and Pascher, I. 1977. Structure of biological membranes: [proceedings]. Plenum Press, New York. Alitalo, R. 1990. Induced differentiation of K562 leukemia cells: a model for studies of gene expression in early megakaryoblasts. Leuk. Res. 14(6): 501– 514. doi:10.1016/0145-2126(90)90002-Q. PMID:2197510. Butler, T.M., Ziemiecki, A., and Friis, R.R. 1990. Megakaryocytic differentiation of K562 cells is associated with changes in the cytoskeletal organization and the pattern of chromatographically distinct forms of phosphotyrosyl-specific protein phosphatases. Cancer Res. 50(19): 6323–6329. PMID:2169344. Choi, H.J., Chung, T.W., Kang, N.Y., Kim, K.S., Lee, Y.C., and Kim, C.H. 2004. Involvement of CREB in the transcriptional regulation of the human GM3 synthase (hST3Gal V) gene during megakaryocytoid differentiation of human leukemia K562 cells. Biochem. Biophys. Res. Commun. 313(1): 142–147. doi: 10.1016/j.bbrc.2003.11.103. PMID:14672710. Chung, T.W., Moon, S.K., Chang, Y.C., Ko, J.H., Lee, Y.C., Cho, G., et al. 2004. Novel and therapeutic effect of caffeic acid and caffeic acid phenyl ester on hepatocarcinoma cells: complete regression of hepatoma growth and metastasis by dual mechanism. FASEB J. 18(14): 1670–1681. doi:10.1096/fj.04-2126com. PMID:15522912. De Cesare, D., Fimia, G.M., and Sassone-Corsi, P. 1999. Signaling routes to CREM and CREB: plasticity in transcriptional activation. Trends Biochem. Sci. 24(7): 281–285. doi:10.1016/S0968-0004(99)01414-0. PMID:10390618. Fishman, P.H., and Brady, R.O. 1976. Biosynthesis and function of gangliosides. Science, 194(4268): 906–915. doi:10.1126/science.185697. PMID:185697. Fujii, S., Igarashi, K., Sasaki, H., Furuse, H., Ito, K., Kaneko, K., et al. 2002. Effects of the mono- and tetrasialogangliosides GM1 and GQ1b on ATP-induced longterm potentiation in hippocampal CA1 neurons. Glycobiology, 12(5): 339– 344. doi:10.1093/glycob/12.5.339. PMID:12070076. Fukuda, M. 1981. Tumor-promoting phorbol diester-induced specific changes in cell surface glycoprotein profile of K562 human leukemic cells. Cancer Res. 41(11): 4621–4628. PMID:7306980. Herrera, R., Hubbell, S., Decker, S., and Petruzzelli, L. 1998. A role for the MEK/ MAPK pathway in PMA-induced cell cycle arrest: modulation of megakaryo-
249
cytic differentiation of K562 cells. Exp. Cell Res. 238(2): 407–414. doi:10.1006/ excr.1997.3847. PMID:9473349. Hocevar, B.A., Morrow, D.M., Tykocinski, M.L., and Fields, A.P. 1992. Protein kinase C isotypes in human erythroleukemia cell proliferation and differentiation. J. Cell Sci. 101(3): 671–679. PMID:1522149. Jacquel, A., Herrant, M., Defamie, V., Belhacene, N., Colosetti, P., Marchetti, S., et al. 2006. A survey of the signaling pathways involved in megakaryocytic differentiation of the human K562 leukemia cell line by molecular and c-DNA array analysis. Oncogene, 25(5): 781–794. doi:10.1038/sj.onc.1209119. PMID:16186797. Kim, M.K., Cho, Y.H., Kim, J.M., Chun, M.W., Lee, S.K., Lim, Y., and Lee, C.H. 2005. Induction of apoptosis in human leukemia cells by MCS-C2 via caspasedependent Bid cleavage and cytochrome c release. Cancer Lett. 223(2): 239– 247. doi:10.1016/j.canlet.2004.10.045. PMID:15896458. Kim, S.W., Lee, S.H., Kim, K.S., Kim, C.H., Choo, Y.K., and Lee, Y.C. 2002. Isolation and characterization of the promoter region of the human GM3 synthase gene. Biochim. Biophys. Acta, 1578(1–3): 84–89. doi:10.1016/S0167-4781(02) 00505-5. PMID:12393190. Kuo, H.C., Kuo, W.H., Lee, Y.J., Lin, W.L., Chou, F.P., and Tseng, T.H. 2006a. Inhibitory effect of caffeic acid phenethyl ester on the growth of C6 glioma cells in vitro and in vivo. Cancer Lett. 234(2): 199–208. doi:10.1016/j.canlet. 2005.03.046. PMID:15885897. Kuo, H.C., Kuo, W.H., Lee, Y.J., Wang, C.J., and Tseng, T.H. 2006b. Enhancement of caffeic acid phenethyl ester on all-trans retinoic acid-induced differentiation in human leukemia HL-60 cells. Toxicol. Appl. Pharmacol. 216(1): 80–88. doi:10.1016/j.taap.2006.04.007. PMID:16766008. Long, M.W., Heffner, C.H., Williams, J.L., Peters, C., and Prochownik, E.V. 1990. Regulation of megakaryocyte phenotype in human erythroleukemia cells. J. Clin. Invest. 85(4): 1072–1084. doi:10.1172/JCI114538. PMID:2318965. Mayr, B., and Montminy, M. 2001. Transcriptional regulation by the phosphorylation-dependent factor CREB. Nat. Rev. Mol. Cell Biol. 2(8): 599–609. doi:10.1038/35085068. PMID:11483993. Nakamura, M., Kirito, K., Yamanoi, J., Wainai, T., Nojiri, H., and Saito, M. 1991. Ganglioside GM3 can induce megakaryocytoid differentiation of human leukemia cell line K562 cells. Cancer Res. 51(7): 1940–1945. PMID:2004380. Natarajan, K., Singh, S., Burke, T.R., Jr., Grunberger, D., and Aggarwal, B.B. 1996. Caffeic acid phenethyl ester is a potent and specific inhibitor of activation of nuclear transcription factor NF-kappa B. Proc. Natl. Acad. Sci. U.S.A. 93(17): 9090–9095. doi:10.1073/pnas.93.17.9090. PMID:8799159. Nojiri, H., Takaku, F., Ohta, M., Miura, Y., and Saito, M. 1985. Changes in glycosphingolipid composition during differentiation of human leukemic granulocytes in chronic myelogenous leukemia compared with in vitro granulocytic differentiation of human promyelocytic leukemia cell line HL-60. Cancer Res. 45(12): 6100–6106. PMID:3864527. Nojiri, H., Takaku, F., Terui, Y., Miura, Y., and Saito, M. 1986. Ganglioside GM3: an acidic membrane component that increases during macrophage-like cell differentiation can induce monocytic differentiation of human myeloid and monocytoid leukemic cell lines HL-60 and U937. Proc. Natl. Acad. Sci. U.S.A. 83(3): 782–786. doi:10.1073/pnas.83.3.782. PMID:3456169. Nojiri, H., Kitagawa, S., Nakamura, M., Kirito, K., Enomoto, Y., and Saito, M. 1988. Neolacto-series gangliosides induce granulocytic differentiation of human promyelocytic leukemia cell line HL-60. J. Biol. Chem. 263(16): 7443–7446. PMID:2836383. Rosenfelder, G., Ziegler, A., Wernet, P., and Braun, D.G. 1982. Ganglioside patterns: new biochemical markers for human hematopoietic cell lines. J. Natl. Cancer Inst. 68(2): 203–209. doi:10.1093/jnci/68.2.203. PMID:6950153. Rusnati, M., Urbinati, C., Tanghetti, E., Dell’Era, P., Lortat-Jacob, H., and Presta, M. 2002. Cell membrane GM1 ganglioside is a functional coreceptor for fibroblast growth factor 2. Proc. Natl. Acad. Sci. U.S.A. 99(7): 4367–4372. doi:10.1073/pnas.072651899. PMID:11917140. Shaywitz, A.J., and Greenberg, M.E. 1999. CREB: a stimulus-induced transcription factor activated by a diverse array of extracellular signals. Annu. Rev. Biochem. 68: 821–861. doi:10.1146/annurev.biochem.68.1.821. PMID:10872467. Stults, C.L., Sweeley, C.C., and Macher, B.A. 1989. Glycosphingolipids: structure, biological source, and properties. Methods Enzymol. 179: 167–214. doi:10.1016/ 0076-6879(89)79122-9. PMID:2695766. Suzuki, A., Karol, R.A., Kundu, S.K., and Marcus, D.M. 1981. Glycosphingolipids of K562 cells: a chemical and immunological analysis. Int. J. Cancer, 28(3): 271–276. doi:10.1002/ijc.2910280304. PMID:7033147. Tetteroo, P.A., Massaro, F., Mulder, A., Schreuder-van Gelder, R., and von dem Borne, A.E. 1984. Megakaryoblastic differentiation of proerythroblastic K562 cell-line cells. Leuk. Res. 8(2): 197–206. doi:10.1016/0145-2126 (84)90143-7. PMID:6232432. Tsiftsoglou, A.S., Pappas, I.S., and Vizirianakis, I.S. 2003. Mechanisms involved in the induced differentiation of leukemia cells. Pharmacol. Ther. 100(3): 257– 290. doi:10.1016/j.pharmthera.2003.09.002. PMID:14652113. Varki, A. 1993. Biological roles of oligosaccharides: all of the theories are correct. Glycobiology, 3(2): 97–130. doi:10.1093/glycob/3.2.97. PMID:8490246. Yoon, S.J., Nakayama, K., Hikita, T., Handa, K., and Hakomori, S.I. 2006. Epidermal growth factor receptor tyrosine kinase is modulated by GM3 interaction with N-linked GlcNAc termini of the receptor. Proc. Natl. Acad. Sci. U.S.A. 103(50): 18987–18991. doi:10.1073/pnas.0609281103. PMID:17142315.
Published by NRC Research Press
