Int. J . Cancer: 45, 562-565 (1990) 0 1990 Wiley-Liss, Inc.

Publication of the International Union Against Cancer Publication de I’Union Internationale Contre le Cancer

FURTHER CHARACTERIZATION, ISOLATION AND IDENTIFICATION OF THE EPITHELIAL CELL-SURFACE ANTIGEN DEFINED BY MONOCLONAL ANTIBODY AUAl H. DURBIN’,N. RODRIGUES and W.F. BODMER Imperial Cancer Research Fund, Lincoln’s Inn Fields, London, WC2A SPX, U K . The human epithelial antigen recognized by monoclonal antibody (MAb) AUAl has been characterized as a cell-surface glycoprotein. It has been isolated from human colonic mucosa by AUAl affinity separation. N-terminal peptide sequence of this purified material has revealed a I7 amino acid sequence which identifies it with one of a group of similar epithelial/ tumour-associated glycoproteins defined by a variety of MAbs. Using the polymerase chain reaction to map the gene encodingthis antigen, our previous AUAl antigen assignment to chromosome 1 has been confirmed.

The antigen recognized by the AUAl MAb is a baso-lateral integral cell membrane determinant of apparent molecular mass 38kDa, expressed on some normal epithelia, namely colon, small intestine, breast, uterus, prostate and sweat gland (Spurr et al., 1986; Mooi et al., 1987). It is also expressed on many carcinomas, including those of stomach and lung, the normal epithelium in these organs being negative for AUAl (Spurr et al., 1986). Although its activity is not restricted to tumours, this MAb is effective in various in-vivo applications for tumour localization and therapy, including binding studies in human xenograft tumours in nude mice (Epenetos et al., 1982; Pervez et al., 1988a,b), and immunoscintigraphy and radiotherapy in patients (Epenetos, 1985; Epenetos et al., 1986, 1987; Pectasides et al., 1986). We now report further characterization and purification leading to identification of the AUAl antigen with KSA (Perez and Walker, 1989; Strnad et al., 1989), a member of a group of MAb-defined epithelial/ tumour-associated glycoproteins having similar properties including molecular structure and tissue distribution (Herlyn et al., 1979; Varki et al., 1984; Edwards et al., 1986; Girardet et al., 1986; Gottlinger et al., 1986; Mattes et al., 1987; Momburg et al., 1987). Previous preliminary evidence suggested that this antigen is also the one recognized by LD- 1 and 17.1A MAbs (Girardet et al., 1986; Strnad et al., 1989). We also describe the use of the polymerase chain reaction (PCR) to map the gene encoding this antigen to chromosome 2, the same assignment previously made by us for the gene encoding the antigen defined by AUAl MAb (Spurr et al., 1986). MATERIAL AND METHODS

Labelling and immunoprecipitation Human colorectal cell lines LS174T (Tom et al., 1976) or Lovo (Stragand et al., 1980), were surface-labelled by lactoperoxidase-catalysed iodination with lzSI (Owen et al., 1981). In some cases this followed incubation in culture for 6 or 24 hr in the presence of 2mg/ml tunicamycin. Labelled cells were lysed in 1 0 m Tris pH7.4 containing 1% NP40, lm EDTA, 1 5 0 m NaC1, lm PMSF and 1 0 m iodoacetamide. Indirect immunoprecipitationusing protein NSepharose beads was carried out (Johnstone and Thorpe, 1988). Immunoprecipitates were analysed by SDS PAGE and autoradiography (Laemmli, 1970). Pur@cation of antigen Antigen was isolated from Lovo cells ( lo9), Lovo xenograft tumours and normal human colonic mucosa. Tissue was homogenized using a Waring blender in a lysis buffer consisting

~ PH 7.4, 0.5%NP40, 1 0 m iodoacetamide and of 1 0 m Tris lm PMSF. The homogenate was passed through a fine-mesh sieve to remove fat and fibrous material before centrifuging at 2,500 g for 20 min to remove nuclei and insoluble material. The supernatant was then applied to an AUAl affinity column which had been prepared by coupling protein A affinitypurified AUA 1 immunoglobulin to Sepharose 4B (Pharmacia, Uppsala, Sweden) according to the manufacturer’s instructions. The affinity column was washed with 10 column volumes of the lysis buffer described above containing 1~ NaCl followed by 10 column volumes of lysis buffer containing 0 . 1 5 ~NaCl and 0.5% sodium deoxycholate. Specifically bound proteins were eluted with 3 10-ml volumes of 0.5% sodium deoxycholate with 50m diethylamine, PH 11.0. Eluates were neutralized with 1~ ammoniun acetate and dialysed into 0.2%sodium deoxycholate, pH8.0. All procedures were carried out at 4°C. Purification was monitored using SDS PAGE and Western blotting (Towbin et al., 1979). Preparation of polyclonal antiserum Affinity-purified AUA 1 antigen was subjected to preparative SDS PAGE. Thin strips cut from the edges of the gel stained with Coomassie blue identified the region containing the 40and 42-kDa bands which was cut out, homogenized in PBS to a fine slurry and boiled with 0.05% 2-mercaptoethanol for 5 min. After dialysis into PBS, this material was used to immunize rabbits. Approximately 50mg of antigen were given S.C. in several sites at monthly intervals. Priming took place in Freund’s complete adjuvant and subsequent booster preparations were made in Freund’s incomplete adjuvant. Serum was taken before and 8 days after each immunization and was analysed by reaction with partially purified human colonic mucosa using Western blotting. Peptide sequence analysis Affinity-purified antigen was subjected to SDS PAGE and electrolytically transferred to a polyvinylidene membrane. After staining with Coomassie blue, the 40- and 42-kDa bands were cut out and sequenced directly on an Applied Biosciences (Berkeley, CA) Sequencer (Matsudaira, 1987). Chromosome mapping PCR (Saiki et al., 1988) was carried out on DNA from human, mouse, rat, hamster and a panel of inter-species hybrids containing representatives of all human chromosomes (Table I) using a Cetus Perkin Elmer (Berkeley, CA) PCR thermal cycler. Aliquots (100 pl) of lOmTris/HCl ~ ~ 8 . 3 , 5 0 m KCI, 3 . 5 m MgCl,, O.lmg/ml gelatin, 2 0 0 m each d N T P , lOpM e a c h o l i g o n u c l e o t i d e p r i m e r , A , 5’-ATACTAGGACTGACGCTACTCTCGCCCGAG,and B , 5’-TTGCCGCAGCTCAGGAAGAATGTGTCTGTG,2 units Amplitaq (Cetus) and 500ng template DNA were overlaid with

’To whom reprint requests should be sent. Received October 24, 1989 and in revised form November 30, 1989.

563

IDENTIFICATION OF T H E A U A l A N T I G E N

TABLE 1- THE PRESENCE ( + ) OR ABSENCE ( - ) OF THE LISTED HUMAN CHROMOSOME IN THE PANEL OF INTER-SPECIES HYBRIDS 1-1 1 IS INDICATED. THE BOXED COLUMN LABELLED PCR INDICATES THE HYBRIDS IN WHICH SPECIFIC PCR PRODUCT WAS DETECTED SHOWING CONCORDANCE WITH CHROMOSOME 2 Hybrid

1 FglO 2MOG34A4 3 CTP412A2 4 3W4C15 5 F4SC113C112 6 SIR74ii 7 DUR 4.3 8 CTP34B4 9TWIN 19D12

Human chromosome 1

2

3

4

5

6

7

8

9

10

12

11

14

13

15

16

17

18

19

20

21

22

PCR

x

-

+

-

+

+ -

+ +

mineral oil and subjected to 30 temperature cycles of 92°C for 1 min, 72°C for 2.5 min and 55°C for 2.5 min followed by a 7-min extension of 70°C. Then, 10-cl.1 aliquots of PCR product were separated on a 3% agarose gel, subjected to Southern (1975) blotting and probed with a 32P y A T P - l a b e l l e d o l i g o n u c l e o t i d e of s e q u e n c e 5 ' GAGCAAAACCTGAAGGGGCCCTCCAGAACA, complementary to that within the predicted amplified region. This 30mer oligonucleotide was also used in direct dideoxy-chain termination DNA sequencing of the human PCR product (Sanger et al., 1977).

B

A

-92

1

C *I

-92 -92

-46

-30

I

1

2

3

4

-67

-46 -30

'1

-30

-21

-21

-21

RESULTS AND DISCUSSION

Analysis of glycosylation status has confirmed AUAl as one of a group of MAbs defining integral membrane cell-surface epithelial/tumour-associated antigens of similar molecular mass and tissue distribution. Immunoprecipitation with AUAl from surface-labelled LS 174T cell lysates under non-reducing conditions revealed a doublet, a major component of 42kDa and a minor component of 40kDa. Under reducing conditions a single band of approximately 38kDa was seen. Following a 6-hr incubation in culture in the presence of tunicamycin, an inhibitor of N-linked sugar synthesis, immunoprecipitation revealed another band, of approximately 35kDa under nonreducing conditions and 30kDa under reducing conditions (Fig. la), which became the predominant bands when incubation with tunicamycin was increased to 24hr. This indicates that the antigen defined by AUAl is a glycoprotein containing 2 or 3 asparagine-linked carbohydrate side-chains. Normal human colonic mucosa was used for purification of this molecule. Approximately lOmg were obtained from log of tissue. Pure antigen was also isolated from Lovo cells (lo9) and Lovo xenograft tumours. However, yields from these sources were smaller. When affinity-purified material was analysed by SDS PAGE followed by silver staining, 2 closely associated bands of approximately 40-42kDa were revealed, resembling those seen in immunoprecipitation. Both bands were immunoreactive with AUAl in Western blotting (Fig. lb). In some preparations, a minor band of 2lkDa was also seen on stained gels and Western blots. This was assumed to be a product cleaved during purification as it was never seen in immunoprecipitation. In addition, several closely associated bands at approximately 200kDa were seen. In the immunostaining of Western blots these bands reacted with the antimouse serum when the first-step AUAl incubation had been omitted and were therefore attributed to aggregates of mouse immunoglobulin that had leached from the affinity column during specific alkaline elution. When the rabbit polyclonal antibody raised against purified

-am-

1 2

, 1

2

FIGURE1 - (a) Immunoprecipitation from '251-labelled LS 174T cell lysates with monoclonal antibody AUAl under non-reducing conditions, lanes 1 and 2; under reducing conditions, lanes 3 and 4; following incubation in culture for 6hr with 2mg/ml tunicamycin, lanes 2 and 4. (b) SDS PAGE, lane 1, and Western blotting, lane 2, of AUAl antigen purified from human colonic mucosa, both under non-reducing conditions. Enzyme-linked immunostaining of the blot was carried out by incubation with AUAl MAb supernatant, then with HRP/rabbit anti-mouse serum (Dako, Copenhagen, Denmark), diluted 1:200, followed by substrate 4-chloro-naphthol. ( c ) Western blotting of partially purified human colonic mucosa probed with AUAl MAb, lane 1, and rabbit antiserum raised against purified AUAl antigen, lane 2, both under non-reducing conditions. Detection of MAb binding was carried out as in (b). Detection of polyclonal serum binding was made by subsequent incubation with HRP/swine anti-rabbit serum (Dako), diluted 1:200, followed by substrate.

AUAl antigen was reacted with partially purified human colon mucosa in Western blotting under non-reducing conditions, in addition to the 40- to 42-kDa doublet, an extra band of about 66kDa and 2 minor bands of about 50 and 80kDa were revealed (Fig. lc). These extra, higher-molecular-weight bands may be due to multimeric forms of the antigen not detected by the MAb. None of these bands, nor the 40-42kDa doublet reacted with a pre-immunization rabbit serum. Under reducing conditions the MAb was not reactive in Western blotting, implying that binding depends on a conformational epitope. The polyclonal antibody was also non-reactive in Western blotting under reducing conditions, although the method of antigen preparation had been selected as one likely to produce antibodies to dissociated, reduced material (Rodgers et al., 1989). N-terminal amino acid sequence analysis was carried out on both the 40- and 42-kDa band materials. Results for each,

564

DURBIN ET AL.

derived separately, identified the same 17 amino acid sequence, Ala-Lys-Pro-Glu-Gly-Ala-Leu-Gln-Asn-AsnAsp-Gly-Leu-Tyr-Asp-Pro-Asp.This peptide sequence is identical to part of a cDNA-derived peptide sequence reported for - 1.0 the epithelial/adenocarcinoma-associated glycoprotein KSA (Strnad et al., 1989; Perez and Walker, 1989). This region, -0.5 N-terminal residues 82-99, which was also identified on amino acid analysis of purified KSA (Sportsman et al., 1988; Perez and Walker, 1989), is preceded by a characteristic Arg-Arg proteolytic cleavage site, and appears to be the beginning of the mature protein sequence. H M K Ha 1 2 3 4 5 6 7 8 9 10 11 We therefore conclude from the data presented above that AUA 1 and KS 1/4 appear to define the same antigen. The posFIGURE 2 - Chromosomal assignment using PCR. Amplified prodsibility that these antibodies recognize an epitope shared by ucts (10-k.1 aliquots) from target DNA, H: human, M: mouse, R: rat related but distinct molecules seems unlikely, since antibody Ha: hamster and 1-1 1: a panel of inter-species hybrids detected by affinity-purified material gave an identical peptide sequence. Southern blot hybridization with a 3zP yATP-labelled oligonucleotide complementary within the specific primed region. Kilobase A Furthermore, both MAbs define a glycoprotein complex seen probe marker positions are indicated. See Table I for the human chromosome as one identical doublet of around 40-42kDa in Western blot- content of the hybrids. ting. We have previously assigned the gene encoding the AUAl antigen to chromosome 2 using analysis of antigen expression chosen pair of oligo-primers spans a cDNA region of 253bp. in a set of humadmouse hybrids containing varying combina- Since the region amplified from genomic DNA consists of tions of human chromosomes (Spurr et al., 1986). Mapping by approximately 600bp, we predict that this will include 1 or 2 amplification of gene-specific target DNA using oligo-primers introns. Further DNA sequencing of this PCR product and taken from the KSA sequence should confirm this assignment. other products primed with oligonucleotide pairs selected to When a 30mer oligonucleotide of sequence complementary amplify regions including intron sequences will provide gene within the predicted amplified region was used to probe PCR organization data for this molecule. products on Southern blots, it hybridized to a band from human genomic DNA of about 600bp. It also hybridized to a PCR product amplified from inter-species hybrids which contained ACKNOWLEDGEMENTS chromosome 2 . No specific product was detected in DNA amWe thank Dr. D. Melville and staff at the I.C.R.F. unit at St. plified from any other hybrid parent, mouse, rat or hamster, nor from any hybrid not containing chromosome 2 (Fig. 2). Mark's Hospital for help in providing human colon tissue. We Direct DNA sequencing of the human PCR product provided also thank Mr. R. Brown and Miss K. Perks for peptide sefurther confirmation of its specificity, identifying the region, quence analysis, Mr. I. Goldsmith for oligonucleotide synthe5'-GGGCTTTATGATCCTGACTGCGATGAGAGCGGG, sis and Dr. N.K. Spurr for providing a panel of hybrids for identical to nucleotides 436-468 of the KSA sequence. The chromosome mapping. REFERENCES

EDWARDS, D.P., GRZYB,K.T., DRESSLER, L.G., MANSEL,R.E., ZARA, D.T., SLEDGE,G.W. and MCGUIRE,W.L., Monoclonal antibody identification and characterisation of a Mr 34,000 human epithelium-specific surface glycoprotein associated with human breast cancer. Cancer Res., 46, 1306-1317 (1986). EPENETOS, A.A., Clinical results with regional antibody-guided irradiation. Brit. J . Cancer, 52, 653 (1985). EPENETOS, A.A., MUNRO,A.J.R., STEWART,S., RAMPLING, R., LAMBERT, H.L., MCKENZIE,C.G., SOUTTER,P., RAHEMTULLA, A., G.B., SNOOK,D., COURTNEY-LUCK, N., HOOKER,G., SIVOLAPENKO, DHOKIA,B., KRAUSZ,T., TAYLOR-PAPADIMITRIOU, J., DURBIN,H. and BODMER,W.F., Antibody guided irradiation of advanced ovarian cancer with intraperitoneally administered radiolabelled monoclonal antibodies J . d i n . Oncol., 5, 1890-1899 (1987). EPENETOS, A.A., NIMMON, C.C., ARKLIE,J., ELLIOT,A.T., HAWKINS, L.A., KNOWLES, R.W., BRITTON, K.E. ~ ~ ~ B O D M W.F., E R Detection , of human cancer in an animal model using radio-labelled tumour associated monoclonal antibodies. Brit. J. Cancer, 46, 1-8 (1982). EPENETOS, A.A., SNOOK,D., DURBIN, H., JOHNSON, P.M. and TAYLORJ., Limitations of radio-labelled monoclonal antibodies PAPADIMITRIOU, for localisation of human neoplasms. Cancer Res., 46,3183-3191 (1986). GIRARDET, G., VARRA,A., SCHMIDT-KESSEN, A., SCHREYER, M., CARREL, S. and MACH,J.-P., Immunochemical characterisation of two antigens recognised by new monoclonal antibodies against human colon carcinoma. J . Imrnunol., 136, 1497-1503 (1986). GOTTLINGER, H.G., FUNKE,I., JOHNSON, J., GOKEL,J.F. and Reithmuller, G., Biochemical and epitope analysis of the 17-1A membrane antigen. Int. J. Cancer, 38, 47-53 (1986). HERLYN,M., STEPLEWSKI, Z., HERLYN,D. and KOPROWSKI, H., CO 17-1A and related monoclonal antibodies: their production and characterisation. Proc. nat. Acad. Sci. (Wash.)76, 1438-1442 (1979).

LAEMMLI, U.K., Cleavage of structural proteins during the assembly of the head of bacteriophage T4.Nature (Lord.), 227, 680-685 (1970). JOHNSTONE, A. and THORPE,R., Immunochernistry in practice, p. 234, Blackwell, Oxford (1988). MATSUDAIRA, P.T., Sequence from picomole quantities of proteins electroblotted onto polyvinylidene difluoride membranes. 1.b i d . Chern., 262, 10035-10038 (1987). MATTES,M.J., LOOK, K., FURUKAWA, K., PIERCE,V.K., OLD, L.J., LEWIS, J.L. and LLOYD,K.O., Mouse monoclonal antibodies to human epithelial differentiation antigens expressed on the surface of ovarian carcinoma ascites cells. Cancer Res., 47, 6741-6750 (1987). MOMBURG, F., MOLDENHAUER, G., HAMMERLING, G.J. and MOLLER,P., Immuno-histochemical study of the expression of a Mr 34,000 human epithelial-specific surface glycoprotein in normal and malignant tissues. Cancer Res., 47, 2883-2891 (1987). MOOI, W.J., KRAUSZ,T., KIRKLAND, S.C., CROSS,A. and Epenetos, A.A., Accessibility of antigenic sites recognised by AUAI, HMFGl and HMFG2 monoclonal antibodies: its influence on antibody binding of live cells. Int. J. biol. Markers, 2, 57-63 (1987). OWEN,M.J., KISSONERGHIS, A.M., LODISH,H.F. and CRUMPTON, M.J., Biosynthesis and maturation of HLA-DR antigens in vivo. J. bid. Chem., 256, 8987-8993 (1981). PECTASIDES, D., STEWART.S., COURTNEY-LUCK, N., RAMPLING,R., MUNRO,A.J., KRAUSZ,T . , DHOKIA,B., SNOOK,D., HOOKER,G., DURBIN,H., TAYLOR-PAPADIMITRIOU, J., BODMER,W.F. and EPENETOS, A.A., Antibody guided irradiation of malignant pleural and pericardial effusions. Brit. J . Cancer, 53, 727-732 (1986). PEREZ,M.S. and WALKER,L.E., Isolation and characterisation of a cDNA encoding the KS114 epithelial carcinoma marker. J. Imrnunol., 142,36623667 (1989).

IDENTIFICATION OF THE AUAl ANTIGEN

565

PERVEZ,S., EPENETOS,A.A., Moo], W.J., EVANS,D.J., ROWLINSON, associated glycoprotein gp40. Biofechnol. appl. Biochem., 10, 536544 G., DHOKIA,B. and Krausz, T., Localisation of monoclonal antibody (1988). AUAl and its F(ab’), fragments in human tumour xenografts. An autora- SPURR,N.K., DURBIN,H., SHEER,D., PARKAR, M., BOBROW,M. and diographic and immunohistochemical study. Znf. J . Cancer, Suppl. 3, 23 BODMER, W.F., Characterisation and chromosomal assignment of a human (1988~). cell surface antigen defined by monoclonal antibody AUAl . Znt. J . CanPERVEZ,S., PAGANELLI, G., EPENETOS, A.A., Moor, W.J., EVANS,D.J. cer, 38, 631-636 (1986). and KRAUSZ,T., Localisation of biotinylated monoclonal antibody in nude STRACAND, J.J., BERGERAT, J.P., WHITE,R.A., HOKANSEN,J. and mice bearing subcutaneous and intraperitoneal human tumour xenografts. DREWINKO, B., Biological and cell kinetic properties of a human colon Znt. J . Cancer, Suppl. 3, 30 (19886). adenocarcinoma (Lovo) grown in athymic mice. Cancer Res., 40, 2846 ROWERS,I., D’AGOSTARO, G., VERA,S . and LETARTE,M., Several 2852 (1980). epitopes of p85 glycoprotein (CDw44) are dependent on intact disulphide STRNAD,J., HAMILTON, A.E., BEAVERS,L.S., GAMBOA,G.C., APELbonds. Isolation of cDNA clones requires a polyclonal antibody raised GREN,L.D., TABER,L.D., SPORTSMAN, J.R., BUMOL,T.F., SHARP,D. J. against the reduced protein. Biosci. Rep., 8, 4, 35%368 (1989). and GADSKI,R.A., Molecular cloning and characterisation of a human SAIKI,R.K., GELFAND, D.H., STOFFEL,H., SCHARF,S.J., HIGUCHI,R., adenocarcinomdepithelial cell surface antigen complementary DNA. CanHOM.G.T.. MULLIS.K.B. and EHRLICH. H.A.. Primer-directed enzvmat- cer Res., 49, 314-317 (1989). ic amplification of DNA with a thermostable DNA polymerase. Science, TOM,B.H., RUTZKY,L.P., JAKSTYS, M.M., OYASU,R., KAYE,C.I. and 239, 487491 (1988). KAHN,B.D., Human colonic adenocarcinoma cells 1. Establishment and SANGER,F., NICKLEN,S. and COULSON,A.R., DNA sequencing with description of a new line. In Vitro, 12, 180-191 (1976). chain-terminating inhibitors. Proc. nut. Acad. Sci. (Wash.), 74, 5463TOWBIN,H., STAEHLIN,T. and Gordon, J., Electrophoretic transfer of 5468 (1977). proteins from polyacrylamide gels to nitrocellulose sheets: procedure and SOUTHERN, E., Detection of specific sequences among DNA fragments some applications. Proc. naf.Acad. Sci. (Wash.),76, 43504354 (1979). separated by gel electrophoresis. J. mol. Biol., 98, 503-517 (1975). VARKI,N.M., REISFELD,R.A and WALKER,L.E., Antigens associated SPORTSMAN, J.R., TABER,L.D., SLISZ,M.C., APELGREN, L.D. and Bu- with a human adenocarcinoma defined by monoclonal antibodies. Cancer Res., 44,681-687 (1984). MOL, T.F., Isolation and characterisation of the human adenocarcinoma-