current Genetics
Curr Genet (1992)22:85-91
9 Springer-Verlag 1992
Original articles Functional elements of the promoter region of the Aspergillus oryzae glaA gene encoding glucoamylase Yoji Hata 1, ,, Katsuhiko Kitamoto 2, Katsuya Gomi 2, Chieko Kumagai 2, and Gakuzo Tamura 1 1 Research Institute of Brewing Resources Co., Ltd., 1-54-18, Takinogawa, Kita-ku, Tokyo 114, Japan 2 National Research Institute of Brewing, 2-6-30, Takinogawa, Kita-ku, Tokyo 114, Japan Received January 9/March 24, 1992
Summary. Analysis was made of the promoter region of the Aspergillus oryzae glaA gene encoding glucoamylase. Northern blots using a glucoamylase cDNA as a probe indicated that the amount of mRNA corresponding to the glaA gene increased when expression was induced by starch or maltose. The promoter region of the glaA gene was fused to the Escherichia coli uidA gene, encoding /~-glucuronidase (GUS), and the resultant plasmid was introduced into A. oryzae. Expression of GUS protein in the A. oryzae transformants was induced by maltose, indicating that the glaA-GUS gene was regulated at the level of transcription in the presence of maltose. The nucleotide sequence 1.1 kb upstream of the glaA coding region was determined. A comparison of the nucleotide sequence of the A. oryzae glaA promoter, with those of A. oryzae amyB, encoding s-amylase, and A. niger glaA showed two regions with similar sequences. Deletion and site-specific mutation analysis of these homologous regions indicated that both are essential for direct high-level expression when grown on maltose. Key words: Glucoamylase - Aspergillus oryzae regulation - Upstream sequence
Gene
Introduction Recently, attention has been directed to filamentous fungi of the genus Aspergillus as hosts for heterologous gene expression and foreign protein production (Christensen et al. 1988; Ward et al. 1990). Development of recombinant D N A techniques in these fungi has made possible the analysis of fungal gene regulation at the molecular level. Detailed analysis of both transcription activation and transcription initiation has been carried out for several genes in Aspergillus nidulans (Hamer and Timberlake * Present address: Research Institute, Gekkeikan Sake Co. Ltd., 24, Shimotoba-koyanagi-cho, Fushimi-ku, Kyoto 612, Japan Correspondence to.
K. Kitamoto
1987; Punt et al. 1990). In A. niger, regulation of the glaA gene, encoding glucoamylase, was investigated at the molecular level (Fowler et al. 1990). Deletion analysis of the A. niger glaA promoter showed two important regions: one required for high-level expression and the other for the initiation of transcription. In the presence of starch or malto-oligosaccharides, A. oryzae, which is a important microorganism for the production of Japanese fermented foods, secretes vast quantifies of glucan hydrolases, such as s-amylase and glucoamylase. The production of these hydrolases is repressed in the presence of glucose. The authors have cloned and sequenced the amyB gene, encoding s-amylase (Tada et al. 1989), and the glaA gene, encoding glucoamylase (Hata et al. 1991 a, b). To elucidate the mechanism for starch induction of the expression of these genes, a fusion gene of the amyB promoter and the Escheriehia coli uidA, encoding r GUS, (Jefferson et al. 1987) was constructed and expressed in A. oryzae. A functional GUS protein was produced in A. oryzae transformants and its expression was shown to be controlled by the amyB promoter (Tada et al. 1991 b). Deletion analysis of the promoter region of the amyB gene indicated two elements in the Y-flanking region to be required for high-level expression using maltose as a carbon source (Tada et al. 1991 a). The production of glucoamylase in A. oryzae is also induced by starch or maltose and repressed by glucose. The production of c~-amylase is regulated at the level of transcription (Tada et al. 1991 a,b), while the region of regulation for glucoamylase production remains to be elucidated. Both amyB and glaA genes may be regulated in a similar manner with respect to starch induction; the same element(s) responsible for starch induction may function in both promoter regions. In the present study Northern blot analysis of the glaA gene and nucleotide sequence analysis of the glaA promoter region in A. oryzae were carried out. A comparative study of the sequences of the promoter regions with amyB of A. oryzae and glaA of A. niger was made, and deletion analysis of the A. oryzae glaA promoter was
86 c o n d u c t e d using E. coli uidA as a r e p o r t e r gene. F u n c t i o n a l elements o f the p r o m o t e r r e g i o n o f the glaA gene are discussed.
Materials and methods
Strains, plasmids and media. A. oryzae wild-type strain RIB 40 was used for total RNA preparation. A. oryzae M-2-3, an arginine auxotroph (argB), was used as a recipient strain for transformation (Gomi et al. 1987). E. coli HB101 and JM109 (Yanisch-Perron et al. 1985) were used for cloning and nucleotide sequencing. Recombinant plasmids were constructed from pUC118 (Vieira and Messing 1987), pSa123 (Gomi et al. 1987), and pMTAG1 (Tada et al. 1991 b). CD, Czapek-Dox, medium consisted of 0.3% NaNO3,0.2% KC1, 0.1% KHzPO 4, 0.05% MgSO,. 7H20, 0.001% FeSO4.7H20, and 2% glucose. The modified CD medium was supplemented with 1% polypeptone.
Isolation of total RNA. A. oryzae RIB40 was grown in the modified CD medium containing 2% glucose with shaking for 72h at 30~ Full-grown mycelia were collected with a G1 glass filter, washed with 50 mM of phosphate buffer (pH 6.0) and divided into two parts, each of which was transferred into the same buffer containing either 3% starch or 3% glucose and incubated with shaking at 30 ~ After 2 or 4 h incubation, the mycelia were collected with the glass filter and immediately disrupted with liquid nitrogen for RNA preparation. Total RNAs were prepared according to the procedure described by Cathala et al. (1983).
Northern blot analysis. About 20 gg of total RNA was electrophoresed on a 1.5% agarose MOPS-formaldehyde gel at 100 V for 3.5 h (Sambrook et al. 1989) and then transferred to a nylon membrane, Hybond-N (Amersham Buckinghamshire, UK). The 2.1-kb fragment of the glucoamylase cDNA (Hata et al. 1991 a) was labeled with [~_a2p] dCTP by the random hexanucleotide-primer method (Amersham Buckinghamshire, UK) and used as a probe. Pre-hybridization and hybridization were conducted at 42 ~ in a solution containing 6 x SSC, 5 x Denhardt's solution, 0.1% SDS, 50% formamide and 100 gg/ml of salmon sperm DNA.
Enzyme assay. A. oryzae transformants were grown in modified CD medium containing 2% carbon with shaking for 3 days at 30 ~ The mycelia were disrupted by grinding in liquid nitrogen and resuspended in the extraction buffer containing 50 mM Na2HPO 4 NaHzPO4(pH7.0), 10mM EDTA, 0.1% Triton X-100, 0.1% Sarkosyl, and 10 mM/%mercaptoethanol. The cell-free extract was prepared by high-speed centrifugation (13 000 g). /~-glucuronidase activity and protein concentration were measured by the methods of Jefferson et al. (1986) and Lowry et al. (1951), respectively. Polymerase chain reaction (PCR). PCR amplification was carried out on 100 ng of template DNA in 100 p~l containing 10 mM TrisHC1 (pH 8.3), 50 mM KC1, 1.5 mM MgC12, 0.01% gelatin, 10 mM each of dATP, dCTP, dGTP, dTTP, 50 pmole of each primer and 0.5 U of Thermus aquaticus (Taq) DNA polymerase (Takara Shuzo, Japan). PCR was conducted in 25 cycles with first denaturation at 94 ~ for 1 min, annealing at 55 ~ for 1 min, and extension at 72 ~ for 3 min.
Construction of glaA promoter deletion mutants. Deletion mutants in the glaA promoter were constructed by PCR using synthesized oligonucleotide primers. In sequential deletion (Del 1-Del 6 in Fig. 5 A), upstream primers were designed to correspond to the 5'-part of the nucleotide sequence of each deletion fragment, and a downstream primer was held in common for each deletion and contained the anti-sense nucleotide sequence between - 4 9 and - 6 1 of the glaA promoter. To generate EcoRI and BamHI sites at both ends of amplified DNA fragments, additional sequences, (5'CTGAATTC) and (5'-CTGGATCC), were added to the 5'-end of
each upstream and downstream primer, respectively. The synthesized DNAs containing each truncated glaA promoter were purified by agarose-gel electrophoresis and digested with BamHI and EcoRI. Site-specific and aberrant deletions (Del7-Dell0 in Fig. 5 B) were obtained by the combination PCR method (Higuchi 1989). In Del7, outer primers were used as the upstream primer as for Del 1 with a downstream primer in common with Del 1-6. Inner primers designed for the specific deletion of 19 bp between - 2 2 7 and - 2 0 9 were used as follows: inner sense primer, 5=(-236) GTCCAACTAACTTCCGGAAATTTAACCTG(--200)-3'; anti-sense primer, 5 ' - ( - 20 I)TCCGGAAGTTAGTTGGACTATTTTCTCTA (-247)-Y, where nucleotide bases corresponding to - 2 2 8 and -208 just outside the deletion sequence ( - 2 2 7 to -209) are indicated by bold characters and underlines, respectively. In other deletions, primers were designed in the same manner. Site-specific deletions in the amplified DNA fragment were confirmed by nucleotide sequencing analysis. Oligomer DNAs were synthesized by phosphoamidide methods (Caruthers 1982) using a DNA synthesizer (Applied Biosystems, Foster City, CA, USA Model 381 A).
Transformation experiments. The transformation of E. eoli and A. oryzae was performed according to Hanahan (1983) and Gomi et al. (1987), respectively.
DNA sequencing. Detetion series were generated from unidirectional inserts of the glaA promoter region using a kilo-deletion kit (Takara Shuzo). The nucleotide sequence was identified by the dideoxy chain-termination method of Sanger et al. (1977). Both strands were completely analyzed by overlapping sequences.
Results
Northern blot analysis o f the glaA gene T h e results for N o r t h e r n b l o t analysis using the gluc o a m y l a s e c D N A as a p r o b e are i l l u s t r a t e d in Fig. 1. E t h i d i u m b r o m i d e staining s h o w e d essentially the s a m e a m o u n t s o f R N A to be p r e s e n t in each sample. A s indic a t e d in p a n e l B o f Fig. 1, the 2.1-kb t r a n s c r i p t for the glaA gene was p r e v a l e n t in the R N A e x t r a c t f r o m starchi n c u b a t e d mycelia, a n d its signal was denser at 4 h (lane 2) t h a n at 2 h (lane 3). A faint signal c o u l d be seen w h e n i n c u b a t e d in glucose (lane 1). T h e a m o u n t s o f m R N A c o r r e s p o n d i n g to the glaA gene are thus m u c h less in the presence o f glucose b u t increase within a few h o u r s in the presence o f starch. N o r t h e r n b l o t analysis using m a l t o s e as a n i n d u c e r also s h o w e d the a m o u n t o f glaA m R N A to i n c r e a s e within a few h o u r s ( d a t a n o t shown). T h e e x p r e s s i o n o f the glaA gene is thus cont r o l l e d at the t r a n s c r i p t i o n a l level in the presence o f starch or maltose.
Construction o f the glaA promoter-GUS fusion gene To clarify the i n d u c t i o n m e c h a n i s m ofglaA expression, a fusion gene o f the glaA p r o m o t e r with the E. eoli uidA gene, e n c o d i n g / % g l u c u r o n i d a s e , was c o n s t r u c t e d . C o n s t r u c t i o n o f the p l a s m i d for the e x p r e s s i o n o f the uidA gene in A. oryzae is s h o w n in Fig. 2. T a d a et al. (1991 a , b ) f o u n d the fusion gene i n v o l v i n g the a m y B p r o m o t e r a n d the G U S gene to direct the e x p r e s s i o n o f f u n c t i o n a l G U S p r o t e i n in A. oryzae. T h e e x p r e s s i o n p l a s m i d , p M T A G I - M , c o n t a i n i n g the a m y B p r o m o t e r - G U S fu-
87 amyBpmmoter
pMTA 1-M pGAPG1
E
/
e/ ' ( -1107~
TArA-boxB ATG /Jim nununulauauaa uuuuuumaull~n nllmnnnuu [ ' ] - - ' - - ~ - - I
-617
-~
~
If glaA promoter
-10 uidA
B ATG I,,,,,~ -49 -10 uk'~,/
TATA-box
~
pBR327
uidA
pGAPG 1
~B/Bg amyB-terminator
1 0 . 9 kb
B/Bg
S"
argB
Sm
met
S B/Bg Fig. 1. Northern blot analysis of glaA gene transcription. Left panel, ethidium bromide staining of the agarose gel. Lane 1, total RNA from mycelia after 4 h of glucose incubation. Lanes 2 and 3, total RNA after 2 h and 4 h of maltose incubation, respectively. Right panel, autoradiogram after hybridization with a2P-labeled glucoamylase cDNA
sion gene, was digested with EcoRI and B a m H I to remove the amyB promoter. The 1059-bp D N A fragment of the glaA p r o m o t e r region ( - 1107 to - 49) was synthesized with P C R to generate EcoRI and B a m H I sites at 5'and 3'-ends, respectively. The amplified D N A fragment was inserted into the gap between the EcoRI and B a m H I site of p M T A G 1 - M to yield p G A P G 1 . Nucleotide sequencing analysis of the D N A fragment amplified in vitro confirmed that no mutation had been introduced by the PCR. The resultant plasmid, p G A P G 1 , contained the A. nidulans argB gene for complementation of auxotrophy of the host strain, M-2-3, and the A. oryzae met gene for homologous integration at the met locus in the host genome.
Expression o f the fusion gene in A. oryzae transformants A. oryzae M-2-3 was transformed with pSa123 or p G A P G 1 linearized by SmaI digestion, pSa123, consisting of pBR327 and the argB gene, was used as a G U S negative plasmid. Six independent transformants selected at r a n d o m were grown in 10 ml of the modified C D medium, containing 2% maltose or 2% glucose as a carbon source, with shaking at 30 ~ The cell-free extract prepared from each culture was assayed for its ability to hydrolyze p-nitrophenyl glucuronide for G U S activity. A functional G U S protein was produced by transformants with p G A P G 1 . N o G U S activity could be detected in the transformants with pSa123 as a negative control
Fig. 2. Construction of the plasmid, pGAPG1, consisting of the
glaA promoter and the /7-glucuronidase (GUS) coding region. pMTAG1 (10.6 kb) contained pBR327, the met gene, argB gene, uidA gene and the amyB promoter region (Tada et al. 1991 a). At - 8 0 in the amyB promoter region of pMTAGI, a single nucleotide replacement (G to C) was made by site-directed mutagenesis to create a BamHI restriction site, yielding pMTAG1-M, pMTAGI-M was digested with BamHI and EeoRI to remove a region between - 8 4 to -617 of the amyB promoter including the TATA box. The DNA fragment of the glaA promoter (-1107 to -49) was inserted into the gap between the EcoRI and BamHI sites of pMTAG1-M. The resultant plasmid, pGAPG1, contained 1059 bp of the glaA promoter region (-1107 to -49), followed by 74 bp of the amyB promoter region (-83 to - 10) including transcription start points (tsp), and 23 bp of the 5'-untranslated sequence of the uidA gene. Abbreviations: B, BamHI; Bg, BglII; E, EeoRI; S, SalI; Sm, Sinai; argB, ornithine carbamoyltransferase-encoding gene from A. nidulans; met, the gene from A. oryzae for complementation of methione axotrophy of A. oryzae (Iimura et al. 1987)
(Table 1). Although G U S activity was variable in transformants with p G A P G 1 when using maltose as a carbon source (408-3470 U/rag-protein), the maltose-glucose ratios (GUS activity ratios of maltose-cultured to glucose-cultured mycelia) of transformants were almost the same. F o r determination of the copy number of the fusion gene and the integration site in the transformant genomes, genomic Southern blot analysis was conducted (Fig. 3). Genomic D N A s f r o m the transformants were digested with B a m H I and subjected to Southern blot analysis using the 3.5-kb met gene as a probe. The met gene in the host strain was identified as a 3.5-kb B a m H I fragment. By homologous integration of the transformation plasmid at the met locus as a single copy, the signal could be changed f r o m a single band (3.5 kb) to two bands (4.4 kb and 9.5 kb). In none of the transformants did the 3.5-kb signal disappear but much denser signals corresponding to the size of the transformation vector (10.9 kb) were observed. The transformation plasmids
88
are thus shown not to be integrated at the met locus of the host genome but at non-homologous sites.
Table 1. GUS activity of transformants
Transformant"
GUS activity b (U/mg-protein) Glucose
Maltose
Maltose/glucose r
TF-I TF-2 TF-3 TF-4 TF-5 TF-6
258 75 45 55 25 408
3470 1400 829 719 408 2911
13.5 18.6 18.4 13.1 16.1 7.1
pSa123 d
nd~
nd
-
Effects of malto-oligosaccharides on GUS expression
" Six independent transformants with pGAPG1 were tested for GUS activity b Each transformant was cultivated in 10 ml of the modified CD medium containing 2% glucose or 2% maltose Ratio of GUS activities grown on maltose versus glucose d Control transformant with pSa123 as a control GUS-negative plasmid ~ Not detected (
Curr Genet (1992)22:85-91
9 Springer-Verlag 1992
Original articles Functional elements of the promoter region of the Aspergillus oryzae glaA gene encoding glucoamylase Yoji Hata 1, ,, Katsuhiko Kitamoto 2, Katsuya Gomi 2, Chieko Kumagai 2, and Gakuzo Tamura 1 1 Research Institute of Brewing Resources Co., Ltd., 1-54-18, Takinogawa, Kita-ku, Tokyo 114, Japan 2 National Research Institute of Brewing, 2-6-30, Takinogawa, Kita-ku, Tokyo 114, Japan Received January 9/March 24, 1992
Summary. Analysis was made of the promoter region of the Aspergillus oryzae glaA gene encoding glucoamylase. Northern blots using a glucoamylase cDNA as a probe indicated that the amount of mRNA corresponding to the glaA gene increased when expression was induced by starch or maltose. The promoter region of the glaA gene was fused to the Escherichia coli uidA gene, encoding /~-glucuronidase (GUS), and the resultant plasmid was introduced into A. oryzae. Expression of GUS protein in the A. oryzae transformants was induced by maltose, indicating that the glaA-GUS gene was regulated at the level of transcription in the presence of maltose. The nucleotide sequence 1.1 kb upstream of the glaA coding region was determined. A comparison of the nucleotide sequence of the A. oryzae glaA promoter, with those of A. oryzae amyB, encoding s-amylase, and A. niger glaA showed two regions with similar sequences. Deletion and site-specific mutation analysis of these homologous regions indicated that both are essential for direct high-level expression when grown on maltose. Key words: Glucoamylase - Aspergillus oryzae regulation - Upstream sequence
Gene
Introduction Recently, attention has been directed to filamentous fungi of the genus Aspergillus as hosts for heterologous gene expression and foreign protein production (Christensen et al. 1988; Ward et al. 1990). Development of recombinant D N A techniques in these fungi has made possible the analysis of fungal gene regulation at the molecular level. Detailed analysis of both transcription activation and transcription initiation has been carried out for several genes in Aspergillus nidulans (Hamer and Timberlake * Present address: Research Institute, Gekkeikan Sake Co. Ltd., 24, Shimotoba-koyanagi-cho, Fushimi-ku, Kyoto 612, Japan Correspondence to.
K. Kitamoto
1987; Punt et al. 1990). In A. niger, regulation of the glaA gene, encoding glucoamylase, was investigated at the molecular level (Fowler et al. 1990). Deletion analysis of the A. niger glaA promoter showed two important regions: one required for high-level expression and the other for the initiation of transcription. In the presence of starch or malto-oligosaccharides, A. oryzae, which is a important microorganism for the production of Japanese fermented foods, secretes vast quantifies of glucan hydrolases, such as s-amylase and glucoamylase. The production of these hydrolases is repressed in the presence of glucose. The authors have cloned and sequenced the amyB gene, encoding s-amylase (Tada et al. 1989), and the glaA gene, encoding glucoamylase (Hata et al. 1991 a, b). To elucidate the mechanism for starch induction of the expression of these genes, a fusion gene of the amyB promoter and the Escheriehia coli uidA, encoding r GUS, (Jefferson et al. 1987) was constructed and expressed in A. oryzae. A functional GUS protein was produced in A. oryzae transformants and its expression was shown to be controlled by the amyB promoter (Tada et al. 1991 b). Deletion analysis of the promoter region of the amyB gene indicated two elements in the Y-flanking region to be required for high-level expression using maltose as a carbon source (Tada et al. 1991 a). The production of glucoamylase in A. oryzae is also induced by starch or maltose and repressed by glucose. The production of c~-amylase is regulated at the level of transcription (Tada et al. 1991 a,b), while the region of regulation for glucoamylase production remains to be elucidated. Both amyB and glaA genes may be regulated in a similar manner with respect to starch induction; the same element(s) responsible for starch induction may function in both promoter regions. In the present study Northern blot analysis of the glaA gene and nucleotide sequence analysis of the glaA promoter region in A. oryzae were carried out. A comparative study of the sequences of the promoter regions with amyB of A. oryzae and glaA of A. niger was made, and deletion analysis of the A. oryzae glaA promoter was
86 c o n d u c t e d using E. coli uidA as a r e p o r t e r gene. F u n c t i o n a l elements o f the p r o m o t e r r e g i o n o f the glaA gene are discussed.
Materials and methods
Strains, plasmids and media. A. oryzae wild-type strain RIB 40 was used for total RNA preparation. A. oryzae M-2-3, an arginine auxotroph (argB), was used as a recipient strain for transformation (Gomi et al. 1987). E. coli HB101 and JM109 (Yanisch-Perron et al. 1985) were used for cloning and nucleotide sequencing. Recombinant plasmids were constructed from pUC118 (Vieira and Messing 1987), pSa123 (Gomi et al. 1987), and pMTAG1 (Tada et al. 1991 b). CD, Czapek-Dox, medium consisted of 0.3% NaNO3,0.2% KC1, 0.1% KHzPO 4, 0.05% MgSO,. 7H20, 0.001% FeSO4.7H20, and 2% glucose. The modified CD medium was supplemented with 1% polypeptone.
Isolation of total RNA. A. oryzae RIB40 was grown in the modified CD medium containing 2% glucose with shaking for 72h at 30~ Full-grown mycelia were collected with a G1 glass filter, washed with 50 mM of phosphate buffer (pH 6.0) and divided into two parts, each of which was transferred into the same buffer containing either 3% starch or 3% glucose and incubated with shaking at 30 ~ After 2 or 4 h incubation, the mycelia were collected with the glass filter and immediately disrupted with liquid nitrogen for RNA preparation. Total RNAs were prepared according to the procedure described by Cathala et al. (1983).
Northern blot analysis. About 20 gg of total RNA was electrophoresed on a 1.5% agarose MOPS-formaldehyde gel at 100 V for 3.5 h (Sambrook et al. 1989) and then transferred to a nylon membrane, Hybond-N (Amersham Buckinghamshire, UK). The 2.1-kb fragment of the glucoamylase cDNA (Hata et al. 1991 a) was labeled with [~_a2p] dCTP by the random hexanucleotide-primer method (Amersham Buckinghamshire, UK) and used as a probe. Pre-hybridization and hybridization were conducted at 42 ~ in a solution containing 6 x SSC, 5 x Denhardt's solution, 0.1% SDS, 50% formamide and 100 gg/ml of salmon sperm DNA.
Enzyme assay. A. oryzae transformants were grown in modified CD medium containing 2% carbon with shaking for 3 days at 30 ~ The mycelia were disrupted by grinding in liquid nitrogen and resuspended in the extraction buffer containing 50 mM Na2HPO 4 NaHzPO4(pH7.0), 10mM EDTA, 0.1% Triton X-100, 0.1% Sarkosyl, and 10 mM/%mercaptoethanol. The cell-free extract was prepared by high-speed centrifugation (13 000 g). /~-glucuronidase activity and protein concentration were measured by the methods of Jefferson et al. (1986) and Lowry et al. (1951), respectively. Polymerase chain reaction (PCR). PCR amplification was carried out on 100 ng of template DNA in 100 p~l containing 10 mM TrisHC1 (pH 8.3), 50 mM KC1, 1.5 mM MgC12, 0.01% gelatin, 10 mM each of dATP, dCTP, dGTP, dTTP, 50 pmole of each primer and 0.5 U of Thermus aquaticus (Taq) DNA polymerase (Takara Shuzo, Japan). PCR was conducted in 25 cycles with first denaturation at 94 ~ for 1 min, annealing at 55 ~ for 1 min, and extension at 72 ~ for 3 min.
Construction of glaA promoter deletion mutants. Deletion mutants in the glaA promoter were constructed by PCR using synthesized oligonucleotide primers. In sequential deletion (Del 1-Del 6 in Fig. 5 A), upstream primers were designed to correspond to the 5'-part of the nucleotide sequence of each deletion fragment, and a downstream primer was held in common for each deletion and contained the anti-sense nucleotide sequence between - 4 9 and - 6 1 of the glaA promoter. To generate EcoRI and BamHI sites at both ends of amplified DNA fragments, additional sequences, (5'CTGAATTC) and (5'-CTGGATCC), were added to the 5'-end of
each upstream and downstream primer, respectively. The synthesized DNAs containing each truncated glaA promoter were purified by agarose-gel electrophoresis and digested with BamHI and EcoRI. Site-specific and aberrant deletions (Del7-Dell0 in Fig. 5 B) were obtained by the combination PCR method (Higuchi 1989). In Del7, outer primers were used as the upstream primer as for Del 1 with a downstream primer in common with Del 1-6. Inner primers designed for the specific deletion of 19 bp between - 2 2 7 and - 2 0 9 were used as follows: inner sense primer, 5=(-236) GTCCAACTAACTTCCGGAAATTTAACCTG(--200)-3'; anti-sense primer, 5 ' - ( - 20 I)TCCGGAAGTTAGTTGGACTATTTTCTCTA (-247)-Y, where nucleotide bases corresponding to - 2 2 8 and -208 just outside the deletion sequence ( - 2 2 7 to -209) are indicated by bold characters and underlines, respectively. In other deletions, primers were designed in the same manner. Site-specific deletions in the amplified DNA fragment were confirmed by nucleotide sequencing analysis. Oligomer DNAs were synthesized by phosphoamidide methods (Caruthers 1982) using a DNA synthesizer (Applied Biosystems, Foster City, CA, USA Model 381 A).
Transformation experiments. The transformation of E. eoli and A. oryzae was performed according to Hanahan (1983) and Gomi et al. (1987), respectively.
DNA sequencing. Detetion series were generated from unidirectional inserts of the glaA promoter region using a kilo-deletion kit (Takara Shuzo). The nucleotide sequence was identified by the dideoxy chain-termination method of Sanger et al. (1977). Both strands were completely analyzed by overlapping sequences.
Results
Northern blot analysis o f the glaA gene T h e results for N o r t h e r n b l o t analysis using the gluc o a m y l a s e c D N A as a p r o b e are i l l u s t r a t e d in Fig. 1. E t h i d i u m b r o m i d e staining s h o w e d essentially the s a m e a m o u n t s o f R N A to be p r e s e n t in each sample. A s indic a t e d in p a n e l B o f Fig. 1, the 2.1-kb t r a n s c r i p t for the glaA gene was p r e v a l e n t in the R N A e x t r a c t f r o m starchi n c u b a t e d mycelia, a n d its signal was denser at 4 h (lane 2) t h a n at 2 h (lane 3). A faint signal c o u l d be seen w h e n i n c u b a t e d in glucose (lane 1). T h e a m o u n t s o f m R N A c o r r e s p o n d i n g to the glaA gene are thus m u c h less in the presence o f glucose b u t increase within a few h o u r s in the presence o f starch. N o r t h e r n b l o t analysis using m a l t o s e as a n i n d u c e r also s h o w e d the a m o u n t o f glaA m R N A to i n c r e a s e within a few h o u r s ( d a t a n o t shown). T h e e x p r e s s i o n o f the glaA gene is thus cont r o l l e d at the t r a n s c r i p t i o n a l level in the presence o f starch or maltose.
Construction o f the glaA promoter-GUS fusion gene To clarify the i n d u c t i o n m e c h a n i s m ofglaA expression, a fusion gene o f the glaA p r o m o t e r with the E. eoli uidA gene, e n c o d i n g / % g l u c u r o n i d a s e , was c o n s t r u c t e d . C o n s t r u c t i o n o f the p l a s m i d for the e x p r e s s i o n o f the uidA gene in A. oryzae is s h o w n in Fig. 2. T a d a et al. (1991 a , b ) f o u n d the fusion gene i n v o l v i n g the a m y B p r o m o t e r a n d the G U S gene to direct the e x p r e s s i o n o f f u n c t i o n a l G U S p r o t e i n in A. oryzae. T h e e x p r e s s i o n p l a s m i d , p M T A G I - M , c o n t a i n i n g the a m y B p r o m o t e r - G U S fu-
87 amyBpmmoter
pMTA 1-M pGAPG1
E
/
e/ ' ( -1107~
TArA-boxB ATG /Jim nununulauauaa uuuuuumaull~n nllmnnnuu [ ' ] - - ' - - ~ - - I
-617
-~
~
If glaA promoter
-10 uidA
B ATG I,,,,,~ -49 -10 uk'~,/
TATA-box
~
pBR327
uidA
pGAPG 1
~B/Bg amyB-terminator
1 0 . 9 kb
B/Bg
S"
argB
Sm
met
S B/Bg Fig. 1. Northern blot analysis of glaA gene transcription. Left panel, ethidium bromide staining of the agarose gel. Lane 1, total RNA from mycelia after 4 h of glucose incubation. Lanes 2 and 3, total RNA after 2 h and 4 h of maltose incubation, respectively. Right panel, autoradiogram after hybridization with a2P-labeled glucoamylase cDNA
sion gene, was digested with EcoRI and B a m H I to remove the amyB promoter. The 1059-bp D N A fragment of the glaA p r o m o t e r region ( - 1107 to - 49) was synthesized with P C R to generate EcoRI and B a m H I sites at 5'and 3'-ends, respectively. The amplified D N A fragment was inserted into the gap between the EcoRI and B a m H I site of p M T A G 1 - M to yield p G A P G 1 . Nucleotide sequencing analysis of the D N A fragment amplified in vitro confirmed that no mutation had been introduced by the PCR. The resultant plasmid, p G A P G 1 , contained the A. nidulans argB gene for complementation of auxotrophy of the host strain, M-2-3, and the A. oryzae met gene for homologous integration at the met locus in the host genome.
Expression o f the fusion gene in A. oryzae transformants A. oryzae M-2-3 was transformed with pSa123 or p G A P G 1 linearized by SmaI digestion, pSa123, consisting of pBR327 and the argB gene, was used as a G U S negative plasmid. Six independent transformants selected at r a n d o m were grown in 10 ml of the modified C D medium, containing 2% maltose or 2% glucose as a carbon source, with shaking at 30 ~ The cell-free extract prepared from each culture was assayed for its ability to hydrolyze p-nitrophenyl glucuronide for G U S activity. A functional G U S protein was produced by transformants with p G A P G 1 . N o G U S activity could be detected in the transformants with pSa123 as a negative control
Fig. 2. Construction of the plasmid, pGAPG1, consisting of the
glaA promoter and the /7-glucuronidase (GUS) coding region. pMTAG1 (10.6 kb) contained pBR327, the met gene, argB gene, uidA gene and the amyB promoter region (Tada et al. 1991 a). At - 8 0 in the amyB promoter region of pMTAGI, a single nucleotide replacement (G to C) was made by site-directed mutagenesis to create a BamHI restriction site, yielding pMTAG1-M, pMTAGI-M was digested with BamHI and EeoRI to remove a region between - 8 4 to -617 of the amyB promoter including the TATA box. The DNA fragment of the glaA promoter (-1107 to -49) was inserted into the gap between the EcoRI and BamHI sites of pMTAG1-M. The resultant plasmid, pGAPG1, contained 1059 bp of the glaA promoter region (-1107 to -49), followed by 74 bp of the amyB promoter region (-83 to - 10) including transcription start points (tsp), and 23 bp of the 5'-untranslated sequence of the uidA gene. Abbreviations: B, BamHI; Bg, BglII; E, EeoRI; S, SalI; Sm, Sinai; argB, ornithine carbamoyltransferase-encoding gene from A. nidulans; met, the gene from A. oryzae for complementation of methione axotrophy of A. oryzae (Iimura et al. 1987)
(Table 1). Although G U S activity was variable in transformants with p G A P G 1 when using maltose as a carbon source (408-3470 U/rag-protein), the maltose-glucose ratios (GUS activity ratios of maltose-cultured to glucose-cultured mycelia) of transformants were almost the same. F o r determination of the copy number of the fusion gene and the integration site in the transformant genomes, genomic Southern blot analysis was conducted (Fig. 3). Genomic D N A s f r o m the transformants were digested with B a m H I and subjected to Southern blot analysis using the 3.5-kb met gene as a probe. The met gene in the host strain was identified as a 3.5-kb B a m H I fragment. By homologous integration of the transformation plasmid at the met locus as a single copy, the signal could be changed f r o m a single band (3.5 kb) to two bands (4.4 kb and 9.5 kb). In none of the transformants did the 3.5-kb signal disappear but much denser signals corresponding to the size of the transformation vector (10.9 kb) were observed. The transformation plasmids
88
are thus shown not to be integrated at the met locus of the host genome but at non-homologous sites.
Table 1. GUS activity of transformants
Transformant"
GUS activity b (U/mg-protein) Glucose
Maltose
Maltose/glucose r
TF-I TF-2 TF-3 TF-4 TF-5 TF-6
258 75 45 55 25 408
3470 1400 829 719 408 2911
13.5 18.6 18.4 13.1 16.1 7.1
pSa123 d
nd~
nd
-
Effects of malto-oligosaccharides on GUS expression
" Six independent transformants with pGAPG1 were tested for GUS activity b Each transformant was cultivated in 10 ml of the modified CD medium containing 2% glucose or 2% maltose Ratio of GUS activities grown on maltose versus glucose d Control transformant with pSa123 as a control GUS-negative plasmid ~ Not detected (
