Biochimica et Biophysica Acta, 1090 (1991) 204-210 © 1991 Elsevier Science Publishers B.V. All rights reserved 0167-4781/91/$03.50 ADONIS 016747819108219L
204
BBAEXP 92294
Functional analysis of the promoter of the gene encoding the acidic ribosomal protein L45 in yeast Leon S. Kraakman, Willem H. Mager, Johan J. Grootjans and Rudi J. Planta Department of Biochemistry and Molecular Biology, Vrije Unh~rsiteit, Amsterdam (The Netherlands) (Received 7 March 1991)
Key words: Ribosomal protein gene; Transcription activation; ABFI; (Yeast)
The gene encoding the acidic ribosomal protein IA5 in yeast is expressed coordinately with other rp-genes. The promoter region of this gene harbours binding sites for CPI and ABFI. We demonstrate that the CPl-site is not involved in the transcription activation of the IA$-gene. Rather, the ABFl-sitc, though deviating from the consensus sequence (RTARY3N3ACG), appears to he essential for efficient transcription. Replacement of this site by a consensus RAPl-binding site (an RPG box) did not alter the transcriptional yield of the IA$-gene. An additional transcription activating region is present downstream of the ABFl-site. The relevant nucleotide sequence, which is repeated in the IAS-gene promoter, gives rise to complex formation with a yeast protein extract in a bandshift assay. The results indicate that the IAS.gene promoter has a complex architecture.
Introduction Ribosomal protein genes (rp-genes) in yeast can be considered as housekeeping genes that display a constitutive transcription at steady state growth conditions leading to roughly equal amounts of. nRNA. The rate of rp-gene transcription, however, is accurately adjusted to altering needs for protein biosynthetic capacity upon changes in physiologicai circumstances. During such conditions the balance in cellular rp-mRNAs is maintained which indicates a coordinate regulation of transcription [1,2]. Transcription activation of yeast rp-genes is mediated through two abundant trans-acting proteins, RAPI [3] and ABF1 [4-6]. Most rp-genes carry one or two RAPl-responsive sites, the so-called RPG-boxes [7], which act as upstream transcription activation sequences for these genes [8,9]. A minority of rp-genes studied so far harbour an ABFl-responsive site in their 5' flanking region [10-12]. Both RAP1 and ABF1 are multifunctional DNA binding factors (see Ref. 2 for a review). Apart from
being transcription activators these proteins can also act as transcriptional repressors [13-15], telomere binding factors [14-16] or ARS-associated proteins [14]. It is not yet clear how the control of transcription of yeast rp-genes is coordinated by these two distinct DNA binding factors. This paper deals with the promoter region of the gene encoding the acidic ribosomal protein LA5 [17]. In view of the coordinate control of rp-gene expression in yeast, an analysis of the regulation of expression of this gene is particularly relevant since acidic r-proteins like LA5, in contrast with all other r-proteins, occur in a free cytoplasmic pool [18,19]. Therefore, its coordinate production with other ribosomal constituents seems not to be compulsary. We show by competition bandshift assays, that the promotor region of the gene for L45 contains the binding sequence for several factors: CP1 [20], ABFI and additional proteins. We examined the involvement of these sites in transcription activation of the IA5-gene. A preliminary account of part of the present results has been given in a recent review
[21. Materials and Methods
Abbreviation: rp-gene(s), ribosomal protein sends).
Recombinant plasmids
Correspondence: RJ. Planta, Biodgmisch Laboratorium, Vrije Universiteit, De Boelelaan 1083, 1081 HV Amsterdam, The Netherlands.
Plasmid pRVEA5 carries an EcoRl-generated DNA fragment cgntaining the IA5-gene [17]. This plasmid was kindly provided by Prof. Dr. J.P.G. Ballesta
205 O' S' 10' 1S' 20' 30' 60"120'
(Madrid). Plasmid pEMBLYe23R is a multicopy Escherichia co~i-yeast shuttle vector [21].
Exonudease I!1 treatment Piasmid pRVEA5, cut with Bcll, was treated with exonuclcase I!I (50 U//~g DNA) followed by blunt-end ligation using T4 ligase. The positions of the deletions were determined by sequencing according to Sanger et al. [22]. The deletion mutants from pRVE45 were c l o n e d as EcoRI-Hindlll f r a g m e n t s in the pEMBLYe23R vector (see Fig. 3A).
Preparation and Northern analysis of RNA R N A was isolated from yeast cells, broken with glass beads, essentially as described by Bromley et al. [23]. Samples containing 10/~g of total cellular R N A were fractionated on 1.5% agarose gels after denaturation in 1 M glyoxal and 50% dimethy|sulfoxide [24]. The gels were blotted onto nylon filters (Hybond, Amersham). S10-, $33- and IAS-gene-specific oligonucleotides, as indicated in the text, were labelled by phosphorylation using T4 polynucleotide kinase.
Preparation of S100 extracts Yeast cells were grown until an A~0n m = 0.7 was reached. Cells were broken with glass beads in a buffer containing 0.2 M Tris-HCl (pH 8.0), 0.01 M MgCI 2, 0.01 M ED'I'A, 10% (v/v) glycerol, 0.1 M KCI, 0.5 mM D T r , 1.0 mM phenylmethyisulfonyl fluoride. After removal of the glass heads the extract was centrifuged for 1 h at 100000 x g and the supernatant was frozen at - 2 0 ° C until use.
Band shift assay This assay was performed as described by Huet et ai. [25]. The D N A fragments or oligonucleotides that were used as probes are described in the legends of Figs. 2 and 6 and in Table !.
Medium upshift The yeast strain BJ 2168 (a, leu2, ura3-52, trpl, prcl-407, prbl-l122, pep4-3) was grown in a medium containing 0.67% yeast nitrogen base, 0.04% yeast extract, 0.04% glucose and 2% ethanol supplemented with 40 m g / l leucine, 20 rag/! uracil and 60 m g / I tryptophan until A ~ o m = 0 . 7 was reached. Then 0.1 volume of 20% glucose was added and rapidly mixed. Samples were taken at 0, 5, 10, 15, 20, 30, 60 and 120 rain after the medium upshift. Ceils were immediately frozen in liquid nitrogen and stored at - 2 0 ° C until use. Results and Discussion In yeast, the expression of ribosomal protein (rp-) genes is coordinately controlled to ensure the balanced
nO t~
Fig. I. Effect of a medium upshifl on the transcriptionalactivityof the S10-, $33- and IAS-genes.RNA was isolatedfrom cells growing on ethanol as well as 5, 10, 15, 20, 30, 60 and 120 rain after gluo~e addition. For Northern analysisoligomersencompassingnucleotides 541 to 575 of the Si0-gene, 21 to 53 of the IA5-geneand 1 to 34 of the S33-genewere used as probes. The Sl0-gene is RAPl-regulated whether the S33-geneis ABFI-regulated.
equimolar production of the ribosomal proteins in a cell growth-dependent fashion. This regulation has been shown to take place primarily at the level of transcription, through the action of two abundant transcription-activating factors, RAPI and ABFI [2]. The acidic ribosomal protein IA5 is exceptional in the sense that it is present also in a free cytoplasmic pool [18,19]. In principle, therefore, there seems to be no need for a strict coordination of the synthesis of this ribosomal constituent with that of the other n'bosomal proteins. The Northern analysis presented in Fig. 1, however, clearly shows that transcription of the ~A5gene is regulated coordinately with other (both RAP1and ABFl-regulated) rp-genes.
In front of the L45.gene both a CPl-site and an ABFl-site are present In order to identify trans-acting factors binding in the upstream region of the gene encoding the acidic ribosomal protein IAS, a band shift assay was carried out. Incubation of an SI00 yeast protein extract with an IAS-promoter fragment gives rise to a prominent protein-DNA complex and in addition a second, slower migrating, weak complex (Fig. 2A, lane 2). A competition assay using a RAP1 binding oligomer had hardly an effect on the formation of both complexes (Fig. 2A, lane 3; see also lanes 8 and 9). Obviously, no functional binding sites for RAPI are present in the IAS-promoter. Further competition assays revealed that the formation of the weak complex was prevented .by using a molar excess of an oligomer either encmnpassing the binding site for the abundant centromere-binding protein factor CPI or the responsive site for the multifuuctional protein A B F I (Fig. 2A, lanes 4 i,nd 5). Furthermore, the formation of the most proyn~ent complex was reduced by competition with the CPl-oligo and, to a much lesser extent, by the ABFl-oligomer. These data indicate that the prominent protein-DNA coat-
1
|
$
4
S
6
IIAPl ,qmF1¢Pl
ABF1
2 ~I~
~1 4
i
I
10
11 12
IIAPl AlWlCP1
t.~ 1
?
UBACPI S
g
"/
i ms
UB S3$ Fig. 2. Band shift assay using the upstream DNA region of the L45-gene. (A) The probe containing the upstream region of the IAS-gene was a 0.9 kb Pstl-Hindlll fragment derived from plasmid pRVE45. An SI00 protein extract was incubated with the PstiH/ndlll fragment (lanes 1-6) and with the Pstl-Hindlll fragment lacking the CPl-binding site (lanes 7-12) except for lanes I and 7 where no protein was added. Competitions were carried out in a 100-fold molar excess with the RAPl-binding oligomer (lanes 3 and 9), ABFl-binding oligomer (lanes 4 and 10), CPI-binding olisomer (lanes 5 and 11) and unlabelled probe (lanes 6 and 12). (B) Oligomers containing the putative ABFl-site in the IAS-gene promoter (lanes 1-4) and the ABFl-site in the S33-gene promoter (lanes 5-8), respectively (see Table I), were incubated in the presence of Sl00 protein extract (except for lanes I and 5). C ~ o e t i t i o n s were performed: with a 30-fold molar excess of ABFI-S33 (lane 4) and with a 30-fold molar excess of ABFI-IA5 (lane 8). Lanes 3 and 7: autocompetitions.
plex resulted mainly from a strong binding of CP1 and for a minor part from binding of ABF1. The second, slower migrating complex resulted from the simultaneous binding of CP1 and ABF1. In order to distinguish the complexes due to the binding of CP1 and ABF1, respectively, which obviously migrate in a similar way, we constructed an LAS-promoter fragment lacking the CPl-site by site-directed mutagenesis. This mutation could be made by cutting the fragment with Bcll and subsequently performing an Sl-nuclease treatment. On the basis of sequence determination we selected a fragment which contains a deletion of 10 nucleotides near the BclI-site, encompassing the entire CPl-binding site. Incubation of a yeast protein extract with this mutated IAS-promoter fragment gave rise to only one complex, migrating at the same distance as the strong complex of the original promoter fragment (Fig. 2A, lane 8). This complex was indeed shown to be due to an ABF1-DNA interaction because formation could only be completely prevented by competition with an excess of ABFl-oligomer (Fig. 2A, lane 10) and not try
the oligomers encompassing either a RAPl-binding site or a CPl-binding site (Fig. 2A, lanes 9 and 11). Inspection of the upstream sequence of the LA5-gene did reveal the occurrence of a potential ABFl-binding site located at -232 but the pertinent nucleotide motif deviates from the consensus ABFl-site [26]. It contains the sequence RTARY3N3ACG instead of RTCRY3N3 ACG. To determine whether this element represents a genuine binding site for ABF1 in vitro, an oligonucleotide encompassing nucleotides -234 to -205 was used in a band shift analysis. The results presented in Fig. 2B prove that the motif present in the IA5-promoter, though deviating from the consensus ABFl-site, is sufficient to bind ABF1 in vitro (Fig. 2B, lane 2). A competition experiment indicated that its affinity for binding ABF1, however, is lower than that of the consensus ABFl-site present in the S33-gene promoter (cf. Fig. 2B, lanes 2 with 6 and 4 with 8).
ABFI, and not CP1, is involved in transcription activation of the L45-gene In order to investigate the possible functional role of the two different protein-binding sites in the transcription-activation of the L45-gene, we undertook a detailed deletion analysis of the IAS-gene promoter. This analysis also aimed at identifying putative additional regulatory sites. The deletion fragments were obtained by treatment of BclI.digested DNA with exonuclease III as described in Materials and Methods. The gene-proximal endpoints of the various deletions are indicated in the map depicted in Fig. 3A. The positions and structure of the binding sites for the putative trans-acting factors CP1 and ABF1 are also indicated in this figure together with the general consensus sequence for their respective binding sites. The EcoRI-HindIII fragments of the respective mutants were cloned in a multicopy vector and subsequently introduced into yeast. Northern analysis was performed to estimate the IA5-mRNA levels in the yeast transformants (see Fig. 3C). The results of the Northern analysis were quantified by laser scanning densitometry and the data obtained are presented in Fig. 3B. Analysis of the levels of the transcripts derived ~om the L45-gene preceded by 375 bp of upstream sequence clearly demonstrates the overproduction of L45-mRNA (Fig. 3C, cf. lanes 1 and 2 with lanes 15 and 16) illustrating the transcriptionally active state of this gene. The relative increase of the mRNA levels is about a factor 10, which is slightly lower than the estimated increase in the copy number of this gene (about 15 copies; results not shown). This result is consistent with the outcome of previous gene-dosage experiments performed with other rp-genes showing that the increase in rp-mRNA levels does not entirely parallel the increase in gene copy number [1].
207 U p s t r e a m o f - 375 n o important c/s-acting e l e m e n t s are located since N o r t h e r n analysis showed that the transcript levels for the construct with the c o m p l e t e u p s t r e a m region (up to the EcoRl-site at - 1 8 0 0 ) are the same as the level o f the transcripts derived from the deletion mutants ( A - 375) a n d (A - 3 1 0 ) (result not shown). In the next transformant that was tested, the CP1 binding e l e m e n t (A - 2 7 9 ) has b e e n deleted. Because o f the high protein binding affinity o f this element, it was s u p p o s e d t o be a potential c/s-acting e l e m e n t involved in transcription o f the L45-gene. Removal o f this binding site, however, did not affect the transcription o f the L45-gene, see Fig. 3C: t h e transcript levels
A E
&$76a~110 P 8 BC
A-ft9 b-~M&316
o f the CP1 deletion mutant (A - 279) and the transformant with an intact C P I site (A - 310) are virtually the same (cf. lanes 1 - 4 with lanes 5 and 6, and panel B). Therefore, the protein CPI appears not to be involved in the transcription activation o f the plasmid-encoded L45-gene. Since the CP1 protein is apparently not involved in transcription activation, the question arises about the possible functional role o f this high affinity binding site. C P l - b i n d i n g sites usually constitute a functional part (a C D E l - e l e m e n t [28]) o f a centromerie region. However, in the IA5-gene p r o m o t e r the two o t h e r centromeric elements, C D E I I and 11I, are clearly absent. A n o t h e r possibility is that CP1 d o e s contribute to
~-19S~-177
11
F1
I II
F1
l
H
I
I
..........i:i!ii::.iii:.ii:::iii:-iii,i
+,I
aTctcQTa
l
CiT~N,~a
II 5".lmlellm
1.461II~ llvll If,,. 100~
4-110
~-~
l~
D A-846 ~1~
~
c~
-~4
c
1
2
3
4
$
$
7
8
9 10 11 12 13 1 4 1 S 16
SlO L45 A~375 -310 -279 -283 -248 -196 -177 Y Fig. 3. Effect of promoter deletions on LAS-mRNAlevels. (A) Map of the upstream DNA region of the L45-gene. The boxes indicate the putative bindipg sites for CPI and ABFI and additional lacto~ (see text). The general consensus sequence of the binding sites is ind.;~ted bekyw the boxes as well as the actual sequence in the L45-promnter (R = A,G; Y = C,T; N = A,C,G,T). The arrows indicate the mientation of the binding sites. The 3' ends of the exonnelease ill deletions are given at the toO of the figure (A - 279. - 263, - 245, - 193, - 177). The first two mutants (d--375, --310) are no Exoill deletion mutants but lack the upstream region from the EcoRi site to the Pstl (d-375) or Sacl (d -310) site. Ti = transcription initiation site [17]. Bc = Bali, E = EcoRL H = H/ndlll, S = Snei. (B) Relative promoter grength as dednoed from L45-mRNAlevels. RNA and DNA were isolated from the same aliqunts of the various yeast cultures, all ~ at the same absmbance. The aatoradiogrnms showing the results of Northern hybridizatioa( F ~ 3 0 or Soathem h~klization were analyzed demitometrka~ ~ an LKB laser scanner. The numbers are calculated relative to the w,lues measured for untransfotmed cells and f~r oells transfmmed with Ye23R vector without insert. The c o r r ~ mW numbers of the recombinant plasmids were determined by Southern ~ t i ~ a . The copy number did not differ much between the various transformants and was estimated to be 15, e~ept for d - 193 in which case the number appeared to he about 20 (results not shown). The arrows indicate the length of the promoter fragments of the varioas deletion mmant~ The conespumiing L45-mRNA levels are summarized at the right. (C) Trama:riptimud activityof the L45-genecan3d~ various parts of the promoter region. For each construct two independent tnnsformants were tested. For Nov,hem ~ L45-and Sl0-l~ae specific oliSm,ers were used (see l e ~ n d to Fig. 1). Y = Ye23R without insert.
208 1 2 3 4
$10 L45
Cpl+ c p l Fig. 4. L45-mRNA levelsin the CPl-disraption mutant [29] (lanes 3 and 4) as comparedwith tic correspondingwild-type(lanes 1 and 2). For this Northern analysisIAS- and Sl0-genespecificoligomerswere used(seelegendto Fig. !). the transcriptional enhancement of the L45-gcne, but only in the chromosomal context and not for the plasmid-contained copy of the IAS-gene. To test this possibility we could make use of a recently isolated yeast mutant carrying a CPl-gene disruption (kindly provided by Dr. R. Davis, Stanford) [29]. Northern analysis, however, did not reveal a change in the cellular level of L45-mRNA (see Fig. 4). Therefore, we conclude that CP1 is not involved in transcription activation of the IA5-gene.
Northern analysis of mutants carrying deletions extending further downstream of the CPl-site demonstrated the ABFl-responsive element to be the major transcription activating element of the IA5-gene. Deletions up to the 5' border of the ABFl-site (A - 245) had no effect on the efficiency of transcription of the L45-gene (Fig. 3C, cf. lanes 1-4 with lanes 7 and 8, and 9 and 10, see also panel 13). However, as soon as the ABFl-site was deleted ( d - 193) a severe decline in the IA5-mRNA level was detected (Fig. 3C, cf. lanes 9 and 10 with lanes 11 and 12, see also panel 13). The remaining LA5-mRNA level was still slightly higher than the level due to transcription of the genomic copy (Fig. 3C, cf. lanes 11 and 12 with lanes 15 and 16, see also panel B). As indicated in Fig. 3B, the deletion of the ABFl-site decreased the level of transcription with a factor 3-4. We conclude from these results that the presence of the ABFl-site, though its sequence deviates from the consensus sequence, is essential for effident transcription of the L45-gene. The functional role in transcription of a similar ABFl-site deviating from the consensus sequence (RTARY3N3ACG) has recently been described for the L2B rp-gene by Bozzoni et al. [12]. The level of expression of the L2B-gene is lower than that of the L2A-gene probably because the latter gene harbours an ABFl-respousive element that fully matches the consensus sequence. The residual transcription activity observed after deleting the ABFl-site is abolished by a deletion up to position - 1 7 7 (Fig. 3C, lanes 13 and 14). Obviously a second, weak, cb-acting element has been removed by this deletion (see below).
In the L45-gene promoter a RAPl-binding site contributes equally well to transcription activation as the ABFl-site Since the ABFl-binding site present in the LA5-gene promoter deviates from the consensus sequence and displays a relatively low affinity for the protein in vitro we wished to examine whether transcription of the LAS-gene could be increased by replacing this site by a consensus RPG-box, which represents a strong binding site for RAP1. To this end an RAPl-binding oligomer was inserted at several positions, making use of the deletions discussed above (see Fig. 5). The results of the Northern analysis presented in Fig. 5 demonstrate that approximately equal amounts of IAS-mRNAs are present in the various corresponding transformants. Therefore, in the context of the LAS-gene promoter the ABFl-site is as effective as a transcriptional activator as a consensus RAPl-binding site. The LAS-transcript levels are not influenced by the position of the RAP1binding site (cf. lanes 3 and 4 with lanes 7 and 8, and 9 and 10). In addition, the observed levels seem to be independent of the presence of the presumed weak activating region between - 193 and - 177 (cf. lanes 1 and 2 with lanes 5 and 6 for the ABFl-site and 3 and 4 with 7 and 8 for the RAPl-site). We conclude from these data that the ABFl-site in the IA5-gene promoter can act as an efficient cis-element for transcription activation in vivo. Evidence for the presence of additional promotor binding factors As indicated above (Fig. 3C) deletion of the ABF1site from the IA5-gene promoter revealed the presence of an additional transcription activating DNA region
1 2 3 4 S 6 ? 8 910
oli0omer
-
RAP1ABF1 RAP1 RAP1
11 12
-
inserted at -245 -193 -177 -177 -245 -177 Fig. 5. Transcriptional activity, of the L45-gene carrying RAPl-binding sites inserted in the promoter region. Two ofigomers having sticky Sphl and Pstl ends were used. One contains the ABFl-site as occurring in the L45-promoter ( e n c o ~ i n g nudeotides -234 to -205), and the other ~mtaim an RAPl-binding site matching the consensus sequence (ACACC~ATACATIT). The oligomers were inserted in the Sphl (at -1800 in the polylinker)+ Pstl (at -375) sites (see F'~. 3) of various deletion mutants. The ABFl-oligo was inserted in the d - 177. The RAPl.oligo was inserted in d -245, in d - 193 and in d - 177. For each construct two indel~ndent transformants were tested. For Northern ~ of L45-mRNA and, as a control, the S10-mRNA, the same pmhes were used as in Fig.
209 TABLE l Oligonucleotides used in bandshift assays
Sequence of the oligonucleotidesthat were used as probes or competitors in Figs. 2 and 6. The ABFl-bindingoligomerencompasses nucleotides - 175 to - 143 of the upstream regionof the S33-gene [7],whereasthe ABFl-bindingoligomerfrom the L45-genepromoter comprises nucleotides -205 to -234. The CPl-bindingoligomer is identicalto the CDE! oligomeras described by Brainand Kornberg [20]. The RAPt-bindingoligomer contains a consensusRPG-box. The two oligomerslocated in the promoter region of the LA5-gene encompass nucleotides - 195 to - 168 and - 140 to - 112. Underlined nucleotidesindicatea regionof homologybetweenthe oligonudeotides from the promoterof the IA5*gene. ABFI ( - 143/ -
GTGCGTGGTCACTCTAGACGGCCGCGTCTGTAC
175)
ABFI-L45 ( - 205/- 235) CPI RAPt i.45 ( - t68/ - 195) L45 ( - 112/ - 140)
ATTTTTCTGCTTGGTAACTTTACACGATC¢ AATTAAAATAGATCACGTGATCTATTTT ACACCCATACATTTGCATG CAGATACCGAGAAAATTTGGAAAAAGAAA TACGTAAAGTAATAGTTTAGAGTAAGTCC
between - 1 9 3 and -177. Obviously this element is capable of (weakly) enhancing the transcription activity independently of ABF1. In addition, we noticed that a nneleotide element showing homology with this region occurs between - 1 4 0 and - 1 1 2 (see Table 1). We examined whether these DNA regions might harbour binding sites for additional protein factors. To this end
1 2 3 4 5 6 7 8 9 1 0
at
i f " "t'Ill
,,
synthetic oligonucleotides spanning the respective sequences (see Table l) were used as probes in a bandshift assay. As shown in Fig. 6 these oligonucleotides are able to form specific protein-DNA complexes using a yeast S100 extract fractionated on heparin-sepharose. In addition, competition experiments demonstrated that both sequences recognize similar protein factors (result not shown). Probably the two complexes formed with both oligomers are due to the binding of distinct proteins since these proteins fractionate differently on heparin-sepharose (Fig. 6, lanes 1 to 10). We speculate that the proteins binding to the DNA region between 193 and - 177 are respons~le for the observed transcription activating effect of this element. The presence of the potential protein binding site(s) in the DNA region between - 1 4 0 and - 1 1 2 might explain why insertion of the ABFl-site at - 177 (Fig. 5, lanes 5 and 6) restores a fully active L45-gene promoter. The results suggest a combined action of ABFI and additional DNA-binding factors in the activation of transcription of the L45-gene. A similar protnoter architecture consisting of a binding site for an abundant factor and additional sites for weak activators has been prc~ posed recently by Buchman and Kornberg [27]. The promoter for the DEDl-gene contains an ABFl-binding site and a T-rich element, located 40 nucleotides downstream of it. in an heterologous environment of /acZ promoter fusion constructs both the ABFl-site and the T-rich element individually were shown to be weak transcription activating elements. However, the combination of ABFl-site and T.rich element creates a strong transcription activating promoter [27]. In condnsion, the results support a model in which the ABFI site, deviating from the consensus sequence and with a relatively low binding affinity in vitro, can act as an efftcient c/s-element for transcription activation of the IA5-gene in vivo. Poss~ly, the two binding sites for additional protein factors are involved in the transcription activation of the IA5 gene, e.g., by rendering the local chromatin structure accessible for the action of ABFI. We are currently investigating whether a similar array of protein binding sites as observed for the 1045gene is also present in other rlPgene promoters harbouring an ABFl-site. ~
L4SH~aee)
Ls,SH4~a12)
Fig. 6. Band shift assay using oligomersfrom the upstream DNA regionof rite L45-gene.Proteinfractionswere obtainedby elutinga heparin-seldmmsecolumnusin.ga KCIgradientfrom 175 to 325 raM. Five ~ heparin-~mose fractiouswere incubated~th an oligomerencoml~sing n,__,c!eot_ides - 195 to - 168 (lanes 1-5) and an oligomerencompassing- 140 to - 112 of the ul~treamregionof the L45-gene(lanes6-10) [17].The respectivesequencesare givenin Table !.
t
S
The authors are indebted to Dr. J.P.G. Ballesta (Madrid) for providing the L45 clone, to Dr. R.W. Davis (Stanford) for providing the CPl-disruption mutant and to Mrs. P.G. Brink for preparing the typescript. This work was supported in part by the Nether* lands Foundation for Chemical Research (S.O.N.) with financial aid from the Netherlands Organization for Scientific Research (N.W.O.).
210
References 1 Planta, R.J. and Mager, W.H. (1988) in Genetics of Tra~,~at|on (Tuite, M.F., Picard, M. and Bolotin-Fukuhara, M., eds.), NATO ASi series H, VoL 14, pp. 117-129, Springer-Vedag. 2 Mailer, W.H. and Plant& R~I. (1990) Biochim. Biophys. Acta 1050, 351-355. 3 Shore, D. and Nasmyth, IL (1987) Cell 51,720-732. 4 Rhode, P.R., Sweder, ILS., Oegema, K.F. and Campbell, J.L. (1989) Genes Dee. 3, 1926-1939. 5 Hairier, H., Kavety, B., Vandekerckhove, J., Kiefer, F. and Gallwitz, D. (1989) EMBO J. 8, 4265-4272. 6 Diffley, J.F.X. and Stillman, B. (1989) Science 246, 1034-1038. 7 Leer, R.J., Van Raamsdonk-Duia, M.M.C., Mager, W.H. and Planta, RJ. (1985) Curr. Genet. 9, 273-277. 8 Rotenberg, H.O. and Woolford, J.L. (1986) Mol. Cell. Biol. 6, 674-687. 9 Woudt, LP., Mager, W.H., Nieuwint, R.T.M., Wassenaar, G.M., Van der Kuyl, A.C., Murre, J.J., Hoekman, M., Brockhoff, P. and Planta, RJ. (1987) Nucleic Acids Res. 15, 6037-6048. 10 Herruer, M.H., Mager, W.H., Doorenbosch, M.M., Wessels, P.L.M., Wassenaar, G.M. and Planta, RJ. (1989) Nucleic Acids. Res. 17, 7427-7439. 11 Hamil, K.G., Ham, H.G. and Fried, H.M. (1988) Moi. Cell. Biol. 8, 4328-4341. 12 Seta, I.D., Ciafr6, S., Marck, C., Santoro, B., Presatti, C., Sentenac, A. and Bozzoni, i. (1990) Mol. Cell. Biol. 10, 2437-2441. 13 Brand, A.H., Micklen, G. and Nasmyth, IC (1987) Cell 51, 709719. 14 Buchman, A.R., Kimmerb/, W3., Rine, J. and Kornber~ R.D. (1988) Mol. Cell. BioL 8, 210-225.
15 Bu~ilman, A.R., Lue, N.F. and Kornberg, R.D. (1988) Mol. Cell. tliol. 8, 5086-5099. 16 Berman, J., Tachinaba, C.Y. and "lye, B.K. (1986) Proc. Natl. Acad. Sci. USA 83, 3713-3717. 17 Remacha, M., S~¢nz-Robles, M.T., Vilella, M.D. and Ballesta, J.P.G. (1988) J. Biol. Chem. 263, 9094-9101. 18 Zinker, S. (1980) Biochim. Biophys. Acta 606, 76-82. 19 Mitsui, IL, Nakagawa, T. and Tsurdgi, K. (1988) J. Biochem. 104, 908-911. 20 Brain, RJ. and Komberg, R.D. (1987) Mol. Cell. Biol. 7, 403-409. 21 Baldari, C. and Cesareni, G. (1985) Genc 35, 27-32. 22 Sanger, F.,Niclden, S. and Ceelsen, A.R. (1979) Proc. Natl. Acad. Sci. USA 74, 5463-5467. 23 Bromley, S., Hereford, L. and Rosbash, M. (1982) MoL Cell. Biol. 2, 1205-1211. 24 McMaster, S.IL and Cannichael, G.G. (1977) Proc. Natl. Acad. Sci. USA 74, 4835-4838. 25 Huet, J., Cottrelle, P., Cool, M., Vignais, M-L, Thiele, D , Marck, C., Buhler, .LM., Sentenac, A. and Fromageot, P. (1985) EMBO J. 4, 3539-3547. 26 Dorsman, J.C., Doorenbosch, M.M., Maurer, C.T.C, De Winde, J.H., Mager, W.H., Planta, R.J. and Grivell, LA. (1989) Nucleic Acids Res. 17, 4917-4923. 27 Buchman, A.R. and Kornberg, R.D. (1990) Mol. Cell. Biol. 10, 887-897. 28 Baker, R.E., Fitzgerald-Hayes, M and O'Brien, T.C. (1989) J. Biol. Chem. 264, 10843-10850. 29 Cai, M. and Davis, R.W. (1990) Cell 61,437-446.
204
BBAEXP 92294
Functional analysis of the promoter of the gene encoding the acidic ribosomal protein L45 in yeast Leon S. Kraakman, Willem H. Mager, Johan J. Grootjans and Rudi J. Planta Department of Biochemistry and Molecular Biology, Vrije Unh~rsiteit, Amsterdam (The Netherlands) (Received 7 March 1991)
Key words: Ribosomal protein gene; Transcription activation; ABFI; (Yeast)
The gene encoding the acidic ribosomal protein IA5 in yeast is expressed coordinately with other rp-genes. The promoter region of this gene harbours binding sites for CPI and ABFI. We demonstrate that the CPl-site is not involved in the transcription activation of the IA$-gene. Rather, the ABFl-sitc, though deviating from the consensus sequence (RTARY3N3ACG), appears to he essential for efficient transcription. Replacement of this site by a consensus RAPl-binding site (an RPG box) did not alter the transcriptional yield of the IA$-gene. An additional transcription activating region is present downstream of the ABFl-site. The relevant nucleotide sequence, which is repeated in the IAS-gene promoter, gives rise to complex formation with a yeast protein extract in a bandshift assay. The results indicate that the IAS.gene promoter has a complex architecture.
Introduction Ribosomal protein genes (rp-genes) in yeast can be considered as housekeeping genes that display a constitutive transcription at steady state growth conditions leading to roughly equal amounts of. nRNA. The rate of rp-gene transcription, however, is accurately adjusted to altering needs for protein biosynthetic capacity upon changes in physiologicai circumstances. During such conditions the balance in cellular rp-mRNAs is maintained which indicates a coordinate regulation of transcription [1,2]. Transcription activation of yeast rp-genes is mediated through two abundant trans-acting proteins, RAPI [3] and ABF1 [4-6]. Most rp-genes carry one or two RAPl-responsive sites, the so-called RPG-boxes [7], which act as upstream transcription activation sequences for these genes [8,9]. A minority of rp-genes studied so far harbour an ABFl-responsive site in their 5' flanking region [10-12]. Both RAP1 and ABF1 are multifunctional DNA binding factors (see Ref. 2 for a review). Apart from
being transcription activators these proteins can also act as transcriptional repressors [13-15], telomere binding factors [14-16] or ARS-associated proteins [14]. It is not yet clear how the control of transcription of yeast rp-genes is coordinated by these two distinct DNA binding factors. This paper deals with the promoter region of the gene encoding the acidic ribosomal protein LA5 [17]. In view of the coordinate control of rp-gene expression in yeast, an analysis of the regulation of expression of this gene is particularly relevant since acidic r-proteins like LA5, in contrast with all other r-proteins, occur in a free cytoplasmic pool [18,19]. Therefore, its coordinate production with other ribosomal constituents seems not to be compulsary. We show by competition bandshift assays, that the promotor region of the gene for L45 contains the binding sequence for several factors: CP1 [20], ABFI and additional proteins. We examined the involvement of these sites in transcription activation of the IA5-gene. A preliminary account of part of the present results has been given in a recent review
[21. Materials and Methods
Abbreviation: rp-gene(s), ribosomal protein sends).
Recombinant plasmids
Correspondence: RJ. Planta, Biodgmisch Laboratorium, Vrije Universiteit, De Boelelaan 1083, 1081 HV Amsterdam, The Netherlands.
Plasmid pRVEA5 carries an EcoRl-generated DNA fragment cgntaining the IA5-gene [17]. This plasmid was kindly provided by Prof. Dr. J.P.G. Ballesta
205 O' S' 10' 1S' 20' 30' 60"120'
(Madrid). Plasmid pEMBLYe23R is a multicopy Escherichia co~i-yeast shuttle vector [21].
Exonudease I!1 treatment Piasmid pRVEA5, cut with Bcll, was treated with exonuclcase I!I (50 U//~g DNA) followed by blunt-end ligation using T4 ligase. The positions of the deletions were determined by sequencing according to Sanger et al. [22]. The deletion mutants from pRVE45 were c l o n e d as EcoRI-Hindlll f r a g m e n t s in the pEMBLYe23R vector (see Fig. 3A).
Preparation and Northern analysis of RNA R N A was isolated from yeast cells, broken with glass beads, essentially as described by Bromley et al. [23]. Samples containing 10/~g of total cellular R N A were fractionated on 1.5% agarose gels after denaturation in 1 M glyoxal and 50% dimethy|sulfoxide [24]. The gels were blotted onto nylon filters (Hybond, Amersham). S10-, $33- and IAS-gene-specific oligonucleotides, as indicated in the text, were labelled by phosphorylation using T4 polynucleotide kinase.
Preparation of S100 extracts Yeast cells were grown until an A~0n m = 0.7 was reached. Cells were broken with glass beads in a buffer containing 0.2 M Tris-HCl (pH 8.0), 0.01 M MgCI 2, 0.01 M ED'I'A, 10% (v/v) glycerol, 0.1 M KCI, 0.5 mM D T r , 1.0 mM phenylmethyisulfonyl fluoride. After removal of the glass heads the extract was centrifuged for 1 h at 100000 x g and the supernatant was frozen at - 2 0 ° C until use.
Band shift assay This assay was performed as described by Huet et ai. [25]. The D N A fragments or oligonucleotides that were used as probes are described in the legends of Figs. 2 and 6 and in Table !.
Medium upshift The yeast strain BJ 2168 (a, leu2, ura3-52, trpl, prcl-407, prbl-l122, pep4-3) was grown in a medium containing 0.67% yeast nitrogen base, 0.04% yeast extract, 0.04% glucose and 2% ethanol supplemented with 40 m g / l leucine, 20 rag/! uracil and 60 m g / I tryptophan until A ~ o m = 0 . 7 was reached. Then 0.1 volume of 20% glucose was added and rapidly mixed. Samples were taken at 0, 5, 10, 15, 20, 30, 60 and 120 rain after the medium upshift. Ceils were immediately frozen in liquid nitrogen and stored at - 2 0 ° C until use. Results and Discussion In yeast, the expression of ribosomal protein (rp-) genes is coordinately controlled to ensure the balanced
nO t~
Fig. I. Effect of a medium upshifl on the transcriptionalactivityof the S10-, $33- and IAS-genes.RNA was isolatedfrom cells growing on ethanol as well as 5, 10, 15, 20, 30, 60 and 120 rain after gluo~e addition. For Northern analysisoligomersencompassingnucleotides 541 to 575 of the Si0-gene, 21 to 53 of the IA5-geneand 1 to 34 of the S33-genewere used as probes. The Sl0-gene is RAPl-regulated whether the S33-geneis ABFI-regulated.
equimolar production of the ribosomal proteins in a cell growth-dependent fashion. This regulation has been shown to take place primarily at the level of transcription, through the action of two abundant transcription-activating factors, RAPI and ABFI [2]. The acidic ribosomal protein IA5 is exceptional in the sense that it is present also in a free cytoplasmic pool [18,19]. In principle, therefore, there seems to be no need for a strict coordination of the synthesis of this ribosomal constituent with that of the other n'bosomal proteins. The Northern analysis presented in Fig. 1, however, clearly shows that transcription of the ~A5gene is regulated coordinately with other (both RAP1and ABFl-regulated) rp-genes.
In front of the L45.gene both a CPl-site and an ABFl-site are present In order to identify trans-acting factors binding in the upstream region of the gene encoding the acidic ribosomal protein IAS, a band shift assay was carried out. Incubation of an SI00 yeast protein extract with an IAS-promoter fragment gives rise to a prominent protein-DNA complex and in addition a second, slower migrating, weak complex (Fig. 2A, lane 2). A competition assay using a RAP1 binding oligomer had hardly an effect on the formation of both complexes (Fig. 2A, lane 3; see also lanes 8 and 9). Obviously, no functional binding sites for RAPI are present in the IAS-promoter. Further competition assays revealed that the formation of the weak complex was prevented .by using a molar excess of an oligomer either encmnpassing the binding site for the abundant centromere-binding protein factor CPI or the responsive site for the multifuuctional protein A B F I (Fig. 2A, lanes 4 i,nd 5). Furthermore, the formation of the most proyn~ent complex was reduced by competition with the CPl-oligo and, to a much lesser extent, by the ABFl-oligomer. These data indicate that the prominent protein-DNA coat-
1
|
$
4
S
6
IIAPl ,qmF1¢Pl
ABF1
2 ~I~
~1 4
i
I
10
11 12
IIAPl AlWlCP1
t.~ 1
?
UBACPI S
g
"/
i ms
UB S3$ Fig. 2. Band shift assay using the upstream DNA region of the L45-gene. (A) The probe containing the upstream region of the IAS-gene was a 0.9 kb Pstl-Hindlll fragment derived from plasmid pRVE45. An SI00 protein extract was incubated with the PstiH/ndlll fragment (lanes 1-6) and with the Pstl-Hindlll fragment lacking the CPl-binding site (lanes 7-12) except for lanes I and 7 where no protein was added. Competitions were carried out in a 100-fold molar excess with the RAPl-binding oligomer (lanes 3 and 9), ABFl-binding oligomer (lanes 4 and 10), CPI-binding olisomer (lanes 5 and 11) and unlabelled probe (lanes 6 and 12). (B) Oligomers containing the putative ABFl-site in the IAS-gene promoter (lanes 1-4) and the ABFl-site in the S33-gene promoter (lanes 5-8), respectively (see Table I), were incubated in the presence of Sl00 protein extract (except for lanes I and 5). C ~ o e t i t i o n s were performed: with a 30-fold molar excess of ABFI-S33 (lane 4) and with a 30-fold molar excess of ABFI-IA5 (lane 8). Lanes 3 and 7: autocompetitions.
plex resulted mainly from a strong binding of CP1 and for a minor part from binding of ABF1. The second, slower migrating complex resulted from the simultaneous binding of CP1 and ABF1. In order to distinguish the complexes due to the binding of CP1 and ABF1, respectively, which obviously migrate in a similar way, we constructed an LAS-promoter fragment lacking the CPl-site by site-directed mutagenesis. This mutation could be made by cutting the fragment with Bcll and subsequently performing an Sl-nuclease treatment. On the basis of sequence determination we selected a fragment which contains a deletion of 10 nucleotides near the BclI-site, encompassing the entire CPl-binding site. Incubation of a yeast protein extract with this mutated IAS-promoter fragment gave rise to only one complex, migrating at the same distance as the strong complex of the original promoter fragment (Fig. 2A, lane 8). This complex was indeed shown to be due to an ABF1-DNA interaction because formation could only be completely prevented by competition with an excess of ABFl-oligomer (Fig. 2A, lane 10) and not try
the oligomers encompassing either a RAPl-binding site or a CPl-binding site (Fig. 2A, lanes 9 and 11). Inspection of the upstream sequence of the LA5-gene did reveal the occurrence of a potential ABFl-binding site located at -232 but the pertinent nucleotide motif deviates from the consensus ABFl-site [26]. It contains the sequence RTARY3N3ACG instead of RTCRY3N3 ACG. To determine whether this element represents a genuine binding site for ABF1 in vitro, an oligonucleotide encompassing nucleotides -234 to -205 was used in a band shift analysis. The results presented in Fig. 2B prove that the motif present in the IA5-promoter, though deviating from the consensus ABFl-site, is sufficient to bind ABF1 in vitro (Fig. 2B, lane 2). A competition experiment indicated that its affinity for binding ABF1, however, is lower than that of the consensus ABFl-site present in the S33-gene promoter (cf. Fig. 2B, lanes 2 with 6 and 4 with 8).
ABFI, and not CP1, is involved in transcription activation of the L45-gene In order to investigate the possible functional role of the two different protein-binding sites in the transcription-activation of the L45-gene, we undertook a detailed deletion analysis of the IAS-gene promoter. This analysis also aimed at identifying putative additional regulatory sites. The deletion fragments were obtained by treatment of BclI.digested DNA with exonuclease III as described in Materials and Methods. The gene-proximal endpoints of the various deletions are indicated in the map depicted in Fig. 3A. The positions and structure of the binding sites for the putative trans-acting factors CP1 and ABF1 are also indicated in this figure together with the general consensus sequence for their respective binding sites. The EcoRI-HindIII fragments of the respective mutants were cloned in a multicopy vector and subsequently introduced into yeast. Northern analysis was performed to estimate the IA5-mRNA levels in the yeast transformants (see Fig. 3C). The results of the Northern analysis were quantified by laser scanning densitometry and the data obtained are presented in Fig. 3B. Analysis of the levels of the transcripts derived ~om the L45-gene preceded by 375 bp of upstream sequence clearly demonstrates the overproduction of L45-mRNA (Fig. 3C, cf. lanes 1 and 2 with lanes 15 and 16) illustrating the transcriptionally active state of this gene. The relative increase of the mRNA levels is about a factor 10, which is slightly lower than the estimated increase in the copy number of this gene (about 15 copies; results not shown). This result is consistent with the outcome of previous gene-dosage experiments performed with other rp-genes showing that the increase in rp-mRNA levels does not entirely parallel the increase in gene copy number [1].
207 U p s t r e a m o f - 375 n o important c/s-acting e l e m e n t s are located since N o r t h e r n analysis showed that the transcript levels for the construct with the c o m p l e t e u p s t r e a m region (up to the EcoRl-site at - 1 8 0 0 ) are the same as the level o f the transcripts derived from the deletion mutants ( A - 375) a n d (A - 3 1 0 ) (result not shown). In the next transformant that was tested, the CP1 binding e l e m e n t (A - 2 7 9 ) has b e e n deleted. Because o f the high protein binding affinity o f this element, it was s u p p o s e d t o be a potential c/s-acting e l e m e n t involved in transcription o f the L45-gene. Removal o f this binding site, however, did not affect the transcription o f the L45-gene, see Fig. 3C: t h e transcript levels
A E
&$76a~110 P 8 BC
A-ft9 b-~M&316
o f the CP1 deletion mutant (A - 279) and the transformant with an intact C P I site (A - 310) are virtually the same (cf. lanes 1 - 4 with lanes 5 and 6, and panel B). Therefore, the protein CPI appears not to be involved in the transcription activation o f the plasmid-encoded L45-gene. Since the CP1 protein is apparently not involved in transcription activation, the question arises about the possible functional role o f this high affinity binding site. C P l - b i n d i n g sites usually constitute a functional part (a C D E l - e l e m e n t [28]) o f a centromerie region. However, in the IA5-gene p r o m o t e r the two o t h e r centromeric elements, C D E I I and 11I, are clearly absent. A n o t h e r possibility is that CP1 d o e s contribute to
~-19S~-177
11
F1
I II
F1
l
H
I
I
..........i:i!ii::.iii:.ii:::iii:-iii,i
+,I
aTctcQTa
l
CiT~N,~a
II 5".lmlellm
1.461II~ llvll If,,. 100~
4-110
~-~
l~
D A-846 ~1~
~
c~
-~4
c
1
2
3
4
$
$
7
8
9 10 11 12 13 1 4 1 S 16
SlO L45 A~375 -310 -279 -283 -248 -196 -177 Y Fig. 3. Effect of promoter deletions on LAS-mRNAlevels. (A) Map of the upstream DNA region of the L45-gene. The boxes indicate the putative bindipg sites for CPI and ABFI and additional lacto~ (see text). The general consensus sequence of the binding sites is ind.;~ted bekyw the boxes as well as the actual sequence in the L45-promnter (R = A,G; Y = C,T; N = A,C,G,T). The arrows indicate the mientation of the binding sites. The 3' ends of the exonnelease ill deletions are given at the toO of the figure (A - 279. - 263, - 245, - 193, - 177). The first two mutants (d--375, --310) are no Exoill deletion mutants but lack the upstream region from the EcoRi site to the Pstl (d-375) or Sacl (d -310) site. Ti = transcription initiation site [17]. Bc = Bali, E = EcoRL H = H/ndlll, S = Snei. (B) Relative promoter grength as dednoed from L45-mRNAlevels. RNA and DNA were isolated from the same aliqunts of the various yeast cultures, all ~ at the same absmbance. The aatoradiogrnms showing the results of Northern hybridizatioa( F ~ 3 0 or Soathem h~klization were analyzed demitometrka~ ~ an LKB laser scanner. The numbers are calculated relative to the w,lues measured for untransfotmed cells and f~r oells transfmmed with Ye23R vector without insert. The c o r r ~ mW numbers of the recombinant plasmids were determined by Southern ~ t i ~ a . The copy number did not differ much between the various transformants and was estimated to be 15, e~ept for d - 193 in which case the number appeared to he about 20 (results not shown). The arrows indicate the length of the promoter fragments of the varioas deletion mmant~ The conespumiing L45-mRNA levels are summarized at the right. (C) Trama:riptimud activityof the L45-genecan3d~ various parts of the promoter region. For each construct two independent tnnsformants were tested. For Nov,hem ~ L45-and Sl0-l~ae specific oliSm,ers were used (see l e ~ n d to Fig. 1). Y = Ye23R without insert.
208 1 2 3 4
$10 L45
Cpl+ c p l Fig. 4. L45-mRNA levelsin the CPl-disraption mutant [29] (lanes 3 and 4) as comparedwith tic correspondingwild-type(lanes 1 and 2). For this Northern analysisIAS- and Sl0-genespecificoligomerswere used(seelegendto Fig. !). the transcriptional enhancement of the L45-gcne, but only in the chromosomal context and not for the plasmid-contained copy of the IAS-gene. To test this possibility we could make use of a recently isolated yeast mutant carrying a CPl-gene disruption (kindly provided by Dr. R. Davis, Stanford) [29]. Northern analysis, however, did not reveal a change in the cellular level of L45-mRNA (see Fig. 4). Therefore, we conclude that CP1 is not involved in transcription activation of the IA5-gene.
Northern analysis of mutants carrying deletions extending further downstream of the CPl-site demonstrated the ABFl-responsive element to be the major transcription activating element of the IA5-gene. Deletions up to the 5' border of the ABFl-site (A - 245) had no effect on the efficiency of transcription of the L45-gene (Fig. 3C, cf. lanes 1-4 with lanes 7 and 8, and 9 and 10, see also panel 13). However, as soon as the ABFl-site was deleted ( d - 193) a severe decline in the IA5-mRNA level was detected (Fig. 3C, cf. lanes 9 and 10 with lanes 11 and 12, see also panel 13). The remaining LA5-mRNA level was still slightly higher than the level due to transcription of the genomic copy (Fig. 3C, cf. lanes 11 and 12 with lanes 15 and 16, see also panel B). As indicated in Fig. 3B, the deletion of the ABFl-site decreased the level of transcription with a factor 3-4. We conclude from these results that the presence of the ABFl-site, though its sequence deviates from the consensus sequence, is essential for effident transcription of the L45-gene. The functional role in transcription of a similar ABFl-site deviating from the consensus sequence (RTARY3N3ACG) has recently been described for the L2B rp-gene by Bozzoni et al. [12]. The level of expression of the L2B-gene is lower than that of the L2A-gene probably because the latter gene harbours an ABFl-respousive element that fully matches the consensus sequence. The residual transcription activity observed after deleting the ABFl-site is abolished by a deletion up to position - 1 7 7 (Fig. 3C, lanes 13 and 14). Obviously a second, weak, cb-acting element has been removed by this deletion (see below).
In the L45-gene promoter a RAPl-binding site contributes equally well to transcription activation as the ABFl-site Since the ABFl-binding site present in the LA5-gene promoter deviates from the consensus sequence and displays a relatively low affinity for the protein in vitro we wished to examine whether transcription of the LAS-gene could be increased by replacing this site by a consensus RPG-box, which represents a strong binding site for RAP1. To this end an RAPl-binding oligomer was inserted at several positions, making use of the deletions discussed above (see Fig. 5). The results of the Northern analysis presented in Fig. 5 demonstrate that approximately equal amounts of IAS-mRNAs are present in the various corresponding transformants. Therefore, in the context of the LAS-gene promoter the ABFl-site is as effective as a transcriptional activator as a consensus RAPl-binding site. The LAS-transcript levels are not influenced by the position of the RAP1binding site (cf. lanes 3 and 4 with lanes 7 and 8, and 9 and 10). In addition, the observed levels seem to be independent of the presence of the presumed weak activating region between - 193 and - 177 (cf. lanes 1 and 2 with lanes 5 and 6 for the ABFl-site and 3 and 4 with 7 and 8 for the RAPl-site). We conclude from these data that the ABFl-site in the IA5-gene promoter can act as an efficient cis-element for transcription activation in vivo. Evidence for the presence of additional promotor binding factors As indicated above (Fig. 3C) deletion of the ABF1site from the IA5-gene promoter revealed the presence of an additional transcription activating DNA region
1 2 3 4 S 6 ? 8 910
oli0omer
-
RAP1ABF1 RAP1 RAP1
11 12
-
inserted at -245 -193 -177 -177 -245 -177 Fig. 5. Transcriptional activity, of the L45-gene carrying RAPl-binding sites inserted in the promoter region. Two ofigomers having sticky Sphl and Pstl ends were used. One contains the ABFl-site as occurring in the L45-promoter ( e n c o ~ i n g nudeotides -234 to -205), and the other ~mtaim an RAPl-binding site matching the consensus sequence (ACACC~ATACATIT). The oligomers were inserted in the Sphl (at -1800 in the polylinker)+ Pstl (at -375) sites (see F'~. 3) of various deletion mutants. The ABFl-oligo was inserted in the d - 177. The RAPl.oligo was inserted in d -245, in d - 193 and in d - 177. For each construct two indel~ndent transformants were tested. For Northern ~ of L45-mRNA and, as a control, the S10-mRNA, the same pmhes were used as in Fig.
209 TABLE l Oligonucleotides used in bandshift assays
Sequence of the oligonucleotidesthat were used as probes or competitors in Figs. 2 and 6. The ABFl-bindingoligomerencompasses nucleotides - 175 to - 143 of the upstream regionof the S33-gene [7],whereasthe ABFl-bindingoligomerfrom the L45-genepromoter comprises nucleotides -205 to -234. The CPl-bindingoligomer is identicalto the CDE! oligomeras described by Brainand Kornberg [20]. The RAPt-bindingoligomer contains a consensusRPG-box. The two oligomerslocated in the promoter region of the LA5-gene encompass nucleotides - 195 to - 168 and - 140 to - 112. Underlined nucleotidesindicatea regionof homologybetweenthe oligonudeotides from the promoterof the IA5*gene. ABFI ( - 143/ -
GTGCGTGGTCACTCTAGACGGCCGCGTCTGTAC
175)
ABFI-L45 ( - 205/- 235) CPI RAPt i.45 ( - t68/ - 195) L45 ( - 112/ - 140)
ATTTTTCTGCTTGGTAACTTTACACGATC¢ AATTAAAATAGATCACGTGATCTATTTT ACACCCATACATTTGCATG CAGATACCGAGAAAATTTGGAAAAAGAAA TACGTAAAGTAATAGTTTAGAGTAAGTCC
between - 1 9 3 and -177. Obviously this element is capable of (weakly) enhancing the transcription activity independently of ABF1. In addition, we noticed that a nneleotide element showing homology with this region occurs between - 1 4 0 and - 1 1 2 (see Table 1). We examined whether these DNA regions might harbour binding sites for additional protein factors. To this end
1 2 3 4 5 6 7 8 9 1 0
at
i f " "t'Ill
,,
synthetic oligonucleotides spanning the respective sequences (see Table l) were used as probes in a bandshift assay. As shown in Fig. 6 these oligonucleotides are able to form specific protein-DNA complexes using a yeast S100 extract fractionated on heparin-sepharose. In addition, competition experiments demonstrated that both sequences recognize similar protein factors (result not shown). Probably the two complexes formed with both oligomers are due to the binding of distinct proteins since these proteins fractionate differently on heparin-sepharose (Fig. 6, lanes 1 to 10). We speculate that the proteins binding to the DNA region between 193 and - 177 are respons~le for the observed transcription activating effect of this element. The presence of the potential protein binding site(s) in the DNA region between - 1 4 0 and - 1 1 2 might explain why insertion of the ABFl-site at - 177 (Fig. 5, lanes 5 and 6) restores a fully active L45-gene promoter. The results suggest a combined action of ABFI and additional DNA-binding factors in the activation of transcription of the L45-gene. A similar protnoter architecture consisting of a binding site for an abundant factor and additional sites for weak activators has been prc~ posed recently by Buchman and Kornberg [27]. The promoter for the DEDl-gene contains an ABFl-binding site and a T-rich element, located 40 nucleotides downstream of it. in an heterologous environment of /acZ promoter fusion constructs both the ABFl-site and the T-rich element individually were shown to be weak transcription activating elements. However, the combination of ABFl-site and T.rich element creates a strong transcription activating promoter [27]. In condnsion, the results support a model in which the ABFI site, deviating from the consensus sequence and with a relatively low binding affinity in vitro, can act as an efftcient c/s-element for transcription activation of the IA5-gene in vivo. Poss~ly, the two binding sites for additional protein factors are involved in the transcription activation of the IA5 gene, e.g., by rendering the local chromatin structure accessible for the action of ABFI. We are currently investigating whether a similar array of protein binding sites as observed for the 1045gene is also present in other rlPgene promoters harbouring an ABFl-site. ~
L4SH~aee)
Ls,SH4~a12)
Fig. 6. Band shift assay using oligomersfrom the upstream DNA regionof rite L45-gene.Proteinfractionswere obtainedby elutinga heparin-seldmmsecolumnusin.ga KCIgradientfrom 175 to 325 raM. Five ~ heparin-~mose fractiouswere incubated~th an oligomerencoml~sing n,__,c!eot_ides - 195 to - 168 (lanes 1-5) and an oligomerencompassing- 140 to - 112 of the ul~treamregionof the L45-gene(lanes6-10) [17].The respectivesequencesare givenin Table !.
t
S
The authors are indebted to Dr. J.P.G. Ballesta (Madrid) for providing the L45 clone, to Dr. R.W. Davis (Stanford) for providing the CPl-disruption mutant and to Mrs. P.G. Brink for preparing the typescript. This work was supported in part by the Nether* lands Foundation for Chemical Research (S.O.N.) with financial aid from the Netherlands Organization for Scientific Research (N.W.O.).
210
References 1 Planta, R.J. and Mager, W.H. (1988) in Genetics of Tra~,~at|on (Tuite, M.F., Picard, M. and Bolotin-Fukuhara, M., eds.), NATO ASi series H, VoL 14, pp. 117-129, Springer-Vedag. 2 Mailer, W.H. and Plant& R~I. (1990) Biochim. Biophys. Acta 1050, 351-355. 3 Shore, D. and Nasmyth, IL (1987) Cell 51,720-732. 4 Rhode, P.R., Sweder, ILS., Oegema, K.F. and Campbell, J.L. (1989) Genes Dee. 3, 1926-1939. 5 Hairier, H., Kavety, B., Vandekerckhove, J., Kiefer, F. and Gallwitz, D. (1989) EMBO J. 8, 4265-4272. 6 Diffley, J.F.X. and Stillman, B. (1989) Science 246, 1034-1038. 7 Leer, R.J., Van Raamsdonk-Duia, M.M.C., Mager, W.H. and Planta, RJ. (1985) Curr. Genet. 9, 273-277. 8 Rotenberg, H.O. and Woolford, J.L. (1986) Mol. Cell. Biol. 6, 674-687. 9 Woudt, LP., Mager, W.H., Nieuwint, R.T.M., Wassenaar, G.M., Van der Kuyl, A.C., Murre, J.J., Hoekman, M., Brockhoff, P. and Planta, RJ. (1987) Nucleic Acids Res. 15, 6037-6048. 10 Herruer, M.H., Mager, W.H., Doorenbosch, M.M., Wessels, P.L.M., Wassenaar, G.M. and Planta, RJ. (1989) Nucleic Acids. Res. 17, 7427-7439. 11 Hamil, K.G., Ham, H.G. and Fried, H.M. (1988) Moi. Cell. Biol. 8, 4328-4341. 12 Seta, I.D., Ciafr6, S., Marck, C., Santoro, B., Presatti, C., Sentenac, A. and Bozzoni, i. (1990) Mol. Cell. Biol. 10, 2437-2441. 13 Brand, A.H., Micklen, G. and Nasmyth, IC (1987) Cell 51, 709719. 14 Buchman, A.R., Kimmerb/, W3., Rine, J. and Kornber~ R.D. (1988) Mol. Cell. BioL 8, 210-225.
15 Bu~ilman, A.R., Lue, N.F. and Kornberg, R.D. (1988) Mol. Cell. tliol. 8, 5086-5099. 16 Berman, J., Tachinaba, C.Y. and "lye, B.K. (1986) Proc. Natl. Acad. Sci. USA 83, 3713-3717. 17 Remacha, M., S~¢nz-Robles, M.T., Vilella, M.D. and Ballesta, J.P.G. (1988) J. Biol. Chem. 263, 9094-9101. 18 Zinker, S. (1980) Biochim. Biophys. Acta 606, 76-82. 19 Mitsui, IL, Nakagawa, T. and Tsurdgi, K. (1988) J. Biochem. 104, 908-911. 20 Brain, RJ. and Komberg, R.D. (1987) Mol. Cell. Biol. 7, 403-409. 21 Baldari, C. and Cesareni, G. (1985) Genc 35, 27-32. 22 Sanger, F.,Niclden, S. and Ceelsen, A.R. (1979) Proc. Natl. Acad. Sci. USA 74, 5463-5467. 23 Bromley, S., Hereford, L. and Rosbash, M. (1982) MoL Cell. Biol. 2, 1205-1211. 24 McMaster, S.IL and Cannichael, G.G. (1977) Proc. Natl. Acad. Sci. USA 74, 4835-4838. 25 Huet, J., Cottrelle, P., Cool, M., Vignais, M-L, Thiele, D , Marck, C., Buhler, .LM., Sentenac, A. and Fromageot, P. (1985) EMBO J. 4, 3539-3547. 26 Dorsman, J.C., Doorenbosch, M.M., Maurer, C.T.C, De Winde, J.H., Mager, W.H., Planta, R.J. and Grivell, LA. (1989) Nucleic Acids Res. 17, 4917-4923. 27 Buchman, A.R. and Kornberg, R.D. (1990) Mol. Cell. Biol. 10, 887-897. 28 Baker, R.E., Fitzgerald-Hayes, M and O'Brien, T.C. (1989) J. Biol. Chem. 264, 10843-10850. 29 Cai, M. and Davis, R.W. (1990) Cell 61,437-446.
