JOURNAL OF VIROLOGY, OCt. 1990, p. 4625-4631

Vol. 64, No. 10

0022-538X/90/104625-07$02.00/0 Copyright © 1990, American Society for Microbiology

Functional Analysis of the Internal Translation Initiation Site of Foot-and-Mouth Disease Virus RAINER KUHN, NORBERT LUZ, AND EWALD BECK*

Zentrum fur Molekulare Biologie Heidelberg, University of Heidelberg, D-6900 Heidelberg, Federal Republic of Germany Received 19 March 1990/Accepted 29 June 1990

Mutagenesis of the large untranslated sequence at the 5' end of the genome of foot-and-mouth disease virus revealed that a region of approximately 450 nucleotides preceding the open reading frame of the viral polyprotein is involved in the regulation of translation initiation at two internal start sites. Variations in two domains of this region reduced the translation efficiency up to 10-fold, whereas an intermediate segment seemed to be less essential. A pyrimidine-rich sequence preceding the start codon was most sensitive in that conversion of single pyrimidine residues to purines decreased the translation efficiency strongly. The data are in agreement with a recently proposed general structural model for the internal ribosome entry site of the cardiovirusaphthovirus subgroup of picornaviruses (E. V. Pilipenko, V. M. Blinov, B. K. Chernov, T. M. Dmitrieva, and V. I. Agol, Nucleic Acids Res. 17:5701-5711, 1989). They suggest, however, that this model represents only a core structure for the internal entry of ribosomes and that foot-and-mouth disease virus and other members of the picornaviruses need additional regulatory RNA elements for efficient translation initiation. respects from that of the other members of this virus family, it seemed important to characterize the regions of the FMDV RNA involved in efficient translation initiation in more detail. Besides its obvious importance to an understanding of FMDV polyprotein translation, this experimental approach may also improve the general characterization of structural elements involved in the interaction of eucaryotic mRNAs with the translation machinery. It appears likely that not only the structural similarities between the different viral RNAs but also their subtle differences may aid in the development of a more general concept of eucaryotic protein translation.

Initiation of eucaryotic protein synthesis is generally believed to follow the rules of the ribosomal scanning model (12). This hypothesis suggests that binding of the ribosomal 40S subunit to the m7G cap structure at the 5' terminus of the mRNA is followed by scanning of the ribosome until translation initiates at the most proximal initiation codon in a favorable context. Although this model may explain translational initiation of most cellular mRNAs, there are several examples that may not follow these rules, most prominently the picornavirus mRNAs (9, 10, 25, 26, 38). Picornaviruses contain a single-stranded RNA genome of positive polarity. In contrast to cellular mRNAs, picornavirus RNA is not conventionally capped but contains a small protein (VPg) covalently linked to the 5' terminus of the genomic RNA (17). This protein is removed in the cytoplasm (1), and the polysomal RNA initiates with a uridyl 5'monophosphate (22). In addition, picornavirus RNAs have very long 5' untranslated regions (5'UTRs) containing many (e.g., 10 in the case of foot-and-mouth disease virus [FMDV] 01K), normally unutilized AUG codons preceding the actual translation start site. In the case of cardio- and aphthoviruses, there is also a poly(C) tract in the 5'UTR, but deletion of the poly(C) tract of FMDV has been shown to have no effect on translational efficiency in vitro (36). For several members of the picornavirus family, it has been shown that translation initiation is not facilitated by ribosomal scanning but most likely by direct binding of the ribosomal subunit to an internal ribosomal entry site (9, 10) or ribosomal landing pad (27). Given that a relatively long segment of the 5'UTR is required for efficient internal translation initiation and that this segment contains highly conserved secondary or tertiary structures, it appears likely that the internal ribosomal entry site consists of a structural RNA element. In the case of FMDV, localization of the putative ribosomal entry site has been derived only from sequence homology to other picornaviruses (30). Since the length and the primary sequence of the 5'UTR of FMDV differ in many *

MATERIALS AND METHODS Construction of plasmids pSP434 to -438 and pSV434 to -438. To obtain a clone of FMDV 01K cDNA containing the essential region for translation initiation, plasmids pFMDV 3214c and pFMDV 2735 (7) were fused via a KpnI site in position 668, yielding a continuous genomic fragment from the end of the poly(C) tract to the middle of the structural protein-coding region. A 1.0-kilobase MboII fragment containing the FMDV genome from poly(C) up to position 927 and some 150 nucleotides of vector sequences at the 5' end was isolated from this clone and partially digested, with exonuclease BAL 31 (Boehringer Mannheim GmbH, Mannheim, Federal Republic of Germany). After addition of BglII linkers, the shortened fragments were subcloned in pSP64 (20) and characterized by nucleotide sequence analysis. Several appropriate deletion mutants were fused via BglII linker fragments to an AUG-deletion mutant of the TnS neomycin phosphotransferase (neo) gene of plasmid pKml09/90 (32). neo fusions containing different parts of the translational start region of FMDV were inserted either into the vector pSP64 or into the simian virus 40 (SV40) shuttle vector p297-3. The latter vector is a derivative of pBR322 containing the SV40 early region with an artificial BglII site downstream from the promoter (kindly provided by P. Gruss). The 5' end of the FMDV sequence is position 94 (synthetic BglII site) in all SV40 vector constructions or position 176 (natural Hindlll site) in the SP6 vector constructions. The 3' end of the neo cassette used in all fusions

Corresponding author. 4625

4626

KUHN ET AL.

is an artificial BamHI site introduced 33 nucleotides downstream from the neo open reading frame (E. Beck, unpublished). Construction of deletion and insertion mutants of the 5'UTR. DNA of plasmid pSP436 was linearized by limited DNase I digestion in the presence of Mn2" as described previously (19). The cleaved DNA ends were filled in with Escherichia coli DNA polymerase I, fused to synthetic EcoRI adaptors and recircularized, which resulted in the insertion of a 32-base-pair fragment. The position of the new EcoRI site within the 5'UTR of the different clones was determined by nucleotide sequence analysis. In addition to simple adaptor insertions, deletions of up to 90 nucleotides were found in many mutants. Construction of plasmids pSP440-1 to pSP440-29 and pSV440-1 to pSV440-29. A synthetic EcoRI linker 5'-d(GG AATTCC)-3' was inserted into the NaeI site at position 772 of the FMDV sequence in plasmid pSP436. The region between this EcoRI site and the HindIll site in front of the neo gene was replaced by a synthetic DNA fragment that was constructed by using two sets of complementary oligonucleotides containing different base exchanges. Two 32mers were synthesized for the plus strand: 01 [5'-d(CACCTG TGGTTGTATAACCACTGAACACATGG)-3'] and 02 [5'-d(C ACCTTTCCTCTTATAACCACTGAACACATGA)-3']. A 42mer was constructed for the minus strand [03; 5'-d(TGCGAT

AAAACAGTCAGTTGTATCCATGTGTTCAGTGGTTAT)-

3']. Mixtures of two bases were incorporated in the indicated positions. Boldface nucleotides differ from the wild-type sequence. Plus- and minus-strand oligonucleotides, which overlap by 19 nucleotides, were annealed, the singlestranded regions were converted to double strand with reverse transcriptase, and the fragments were ligated between the filled-in EcoRI and HindlIl sites of plasmid pSP436. Individual mutants were characterized by nucleotide sequence analysis. Some of the resulting point mutants were inserted into vector pSV297-3. Translation in rabbit reticulocyte lysate. In vitro transcription of the linearized DNA templates with SP6 RNA polymerase was performed essentially as described previously (20). Samples (0.5 to 2 ,ug) of RNA were translated in 20 ,ul of rabbit reticulocyte lysate (Amersham Corp., Arlington Heights, Ill.) in the presence of 10 ,uCi of [35S]methionine (>1,000 Ci/mmol; Amersham Corp.). Translation products were analyzed by sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE) (16) and fluorography. The expression of P10 and the neo fusion proteins was quantified by densitometric analysis of the autoradiographs. The neo translation efficiency was calculated in relation to the expression of P10. All values are based on at least three independent assays. Expression of neo in BHK-21 cells. Transfection of BHK-21 cells was performed as described previously (11). The calcium phosphate precipitates were formed by using mixtures of 10 ,ug of mutant DNA and 5 ,ug of DNA of plasmid pSV2-CAT (8), each in a volume of 500 ,ul. After 48 to 72 h of incubation, the cells were harvested (approximately 106 cells per plate) and suspended in 200 RI of 10 mM Tris hydrochloride-10 mM MgCI2-25 mM NH4Cl-0.6 mM ,-mercaptoethanol (pH 7.4). Protein extracts were obtained by sonication and separation from cellular debris by centrifugation. A 50-.lI sample of each extract was separated by nondenaturing PAGE (21). The neo-specific enzymatic activity was determined by in situ phosphorylation of kanamycin with [_y-32P]ATP as described previously (33). Chloram-

J. VIROL.

phenicol acetyltransferase (CAT) assays were performed with another 50-pI sample of the extracts as described previously (35). RESULTS Fusion of the neo gene to the 5'UTR of FMDV. Translation of the FMDV polyprotein initiates at two start codons, located in a distance of 84 nucleotides (2, 37), in contrast to the other members of the picornavirus family. In strain 01K, which was used in our studies, these two translational start sites correspond to AUG codons 11 and 12 in the 1,300nucleotides-long 5'UTR of the viral RNA. These two initiation sites result in two different N-terminal processing products of the viral polyprotein, the L and L' proteases (39). To analyze the influence of this dual initiation on translation efficiency, an FMDV cDNA clone containing the viral genome downstream from the poly(C) tract was truncated at different positions near the two translational start sites of the polyprotein, giving rise to deletion mutants containing both, one, or none of these two initiation sites. The truncated 5'UTRs were fused with the open reading frame of the neo gene of transposon TnS (3) (Fig. 1) and inserted into the vector pSP64. The neo gene appeared to be a more appropriate indicator for translational activity than the authentic viral gene products, since their quantitative analysis is complicated by the rapid autoproteolytic processing of the viral polyprotein. Besides providing stable translation products, these constructs could be tested in a sensitive enzymatic assay, since short N-terminal fusions with the neo gene retain in general high levels of phosphotransferase activity (32). RNA derived from these plasmids was translated in rabbit reticulocyte lysates in the presence of [35S]methionine. Figure 1C shows an autoradiograph of the electrophoretically separated translation products. In clone 434, the viral 5'UTR stops immediately in front of the dual polyprotein start site. As expected, the neo gene was not expressed in this construction. In mutant 438, the neo gene is fused to AUG 10 of the FMDV 5'UTR, which is localized some 150 nucleotides upstream from the first polyprotein start site in the viral RNA and precedes an obviously unused short open reading frame of 57 nucleotides. The neo gene fused to this codon was expressed at a very low level. In contrast, fusion to AUG codons 11 and 12, representing the natural start sites of the polyprotein, led to considerable protein expression. Clone 436 produced a single 29-kilodalton protein, whereas mutant 437, containing both FMDV start codons, expressed two proteins of 29 and 33 kilodaltons. Analogous to the translation of viral RNA in vitro (39), the protein starting at AUG 12 was produced in higher amounts. This does not reflect the situation in FMDV-infected BHK-21 cells. In these cells, the larger L protease predominates (unpublished observation), indicating that AUG codon 11 represents the major start site of the polyprotein. The differences in usage of the two start codons in rabbit reticulocyte lysates and in BHK-21 cells suggest that RNA secondary structure may not be the only factor guiding the ribosomes to the correct initiation site; additional components, which may occur in different amounts in these cell systems, may be involved in this process. Since the neo gene was efficiently expressed from AUG 11, we used plasmid 436 for mutational analysis of the untranslated region. Mutagenesis of the 5'UTR. To identify the contribution of different parts of the 5'UTR to translational efficiency, we mutagenized the whole region by random insertion of adap-

VOL. 64, 1990

. _ ~ ~.

_- ~ ~ ~ ~ ~ ~r VP-

5 untranslsted

---_

'odinC

74

region

Z

polyC

'%

C.7

2C

434 438 436 437

B

1

r :2 POLyrle2-i

4627

resi3oo

-

J.Kpn: s1 -indM- Nciel lo"

?~~~~~4

_;:2< C

INTERNAL TRANSLATION INITIATION SITE OF FMDV

>,A

7 89

10

1

7 89

10

1

x

12

6~lC8CCC0c .23C

,4

1 . 0C

--.7 ,,--

.-

1 6C C

Z.37 .) I

,-,-o-.-

,

,,

63

.n _ 7,7

neo

,

/

n- .11I

436

---

i

.7,7 77,.777, n e ci -7,

II

,

.., 7 .7. .

n e o-

777,71

".

"

,

"

7

.. 77

1

434

3

43B

FIG. 1. Expression of different FMDV-neo fusions in a rabbit reticulocyte lysate. (A) The genome of FMDV (strain 01K), with the genome-linked protein (VPg) at the 5' end of the RNA, the poly(C) tract (C0), the polyprotein-coding region, and the poly(A) tail (An) at the 3' end. The anterior part of the genome is shown below in more detail. Open reading frames are boxed, and the AUG codons (numbered) are indicated by open triangles. Start codons used in vivo or in vitro are marked with filled triangles. Restriction sites referred to in the text are indicated. Numbering of the nucleotides is according to the published FMDV 01K sequence (7). (B) Schematic depiction of the FMDV-neo fusions 434, 436, 437, and 438. The 5' and 3' ends of the FMDV portions are indicated. (C) Autoradiograph of the in vitro translation products of these mutants after separation by SDS-PAGE.

tor fragments into the DNase I-cleaved plasmid DNA (see Materials and Methods). Two types of clones were obtained, one derived from a single hit of the endonuclease, leading to the insertion of a 32-base-pair dimer of the EcoRI adaptor into specific sites of the sequence (with small deletions of up to three nucleotides in some cases), and another type derived from double or multiple cleavages by the DNase, leaving more extended deletions in the 5'UTR, flanked by EcoRI adaptors at both sites. All mutant plasmids were analyzed by nucleotide sequence analysis, and appropriate clones were used for in vitro transcription and translation in rabbit reticulocyte lysates. Several typical examples are shown in Fig. 2. The efficiency of neo gene expression varied considerably in these mutants; some constructs gave almost normal levels of neo expression, whereas in others the translation was all but abolished. As an internal standard for translation efficiency, we made use of the fact that the first AUG codon in these RNAs precedes an open reading frame for a 10-kDa polypeptide (P10; Fig. 1), which is expressed in vitro at a low but constant rate (40). The influence of mutations in different parts of the 5'UTR on expression of the neo fusion is summarized in Fig. 3. Changes of the nucleotide sequence in the first third of the region analyzed (up to position 360) had little or no effect. In contrast, variations in a stretch of approximately 300 nucleotides in the middle part of the region (nucleotides 360 to 660) reduced the translation efficiency up to 90%. The following sequence of approximately 90 nucleotides (positions 660 to 750) was less sensitive for insertions or deletions, whereas variations in the remaining sequence up to the start codon (nucleotides 750 to 804) affected the translation rate strongly again. In this region, translation was inhibited the closer the mutations were located to the start codon. The in vitro-synthesized RNAs used in these translation

assays contained a hydroxyl group at the 5' terminus. To test the influence of the 5' structure of the RNAs on translation efficiency, synthetic cap nucleotides (m7GpppG) were added to several different mutants. Using same amounts of RNA, expression of the gene product encoded by the first open reading frame (P10) was enhanced approximately sixfold. However, the amounts of expressed neo gene product re-

A

2

1

3

4

somm

5

7

6

-M.-

ONO

8

9

10

-~

K

lo

-

neo

-

Pic

-

B tH 200

300

400

plo ~~ 2

600

500

~ 3

~

~ 4

K

~~I 5

700

80o

H

i 2

I

ne

10

7

864

FIG. 2. (A) In vitro translation of deletion and insertion mutants in the 5'UTR. RNAs synthesized with SP6 RNA polymerase were translated in a rabbit reticulocyte lysate in the presence of [35S]methionine. The translation products were analyzed by SDSPAGE and autoradiography. Lane K corresponds to the wild-type 436. Positions of neo and P10 proteins are indicated. (B) Locations of the individual mutations. The P10 open reading frame and the neo fusion and restriction sites for Hindlll (H) and KpnI (K) are indicated. Deletions are shown by lines; inserted EcoRI adaptor fragments are marked by dots. Note that the deleted regions are replaced by 32-base-pair EcoRI adaptor sequences.

4628

J. VIROL.

KUHN ET AL.

100-

50-

II

200

300

Ii

I

,,o 04(0

!

600

I

1, 700::::::K

) D~~ ~t -Dat) DD D> D> DOr DO DO D DDr Do 1"~ ~ ~ ~ ~ ~~~~~~~~~~~~~~~~~~~~4-

800

D)

FIG. 3. Translation efficiency of 5'UTR deletion and insertion mutants. The translation efficiency as determined in a rabbit reticulocyte lysate of different mutants (A, deletion of indicated nucleotide sequences; P, insertion of EcoRI adaptors only) is plotted on the sequence in the approximate position of the mutation sites. Vertical bars indicate the value (as a percentage) of neo expression of the mutants in relation to the original clone 436. Deletions and adaptor insertions are indicated as in Fig. 2.

mained constant in comparison with the noi ncapped transcripts (data not shown). Effect of single base exchanges near the tranislational start site. A sequence of 10 to 11 pyrimidine nuclec tides is found preceding the two translation initiation codonsi of all FMDV strains and can also be observed in less cons erved form in most other picornaviruses. Two mutants in whvich the pyrimidine regions were deleted (A735-781 and A740-803; Fig. 3) showed very low levels of translation activit3y (10 and 2%, respectively). To analyze the contribution of this sequence to translation initiation more specifically, indi' vidual pyrimidine residues were converted into purines byy site-directed mutagenesis. For easier performance of the miutagenesis, an EcoRI cleavage site was constructed in positiion 776 of the FMDV sequence, leading to four additional1 nucleotides, which reduced the translation efficiency b)y 50% (clone 440-29; Fig. 4). The sequence between this E,coRI site and the Hindlll site in front of the neo gene, conta ining the start codon and the pyrimidine-rich region, was replaced by translation efficiency

mutant

436 440-29

-

100%

81o GAGGCCGGAATTCA!I!TAACCACTGAACACEI I%ATA 50% *G- 100% 440-8 G- 50% G 440-1 15% *G G 440-13 - 12% G-G 440-25 5% G-GG-G 440-7 770

Eco

RI

-ranslation tl440-29, whsch

FIG. 4; Effect of single base exchanges near the I site. The nucleotide sequence corresponds to clon4 differs from the wild-type clone 436 (top line) by four additional nucleotides (creating an EcoRI site). The pyrimidine region and the start codon are boxed. Only nucleotides differing fro)m the sequence of clone 440-29 are shown for the individual mutants. The translation efficiency (neo expression) in rabbit reticulocyte lyssates relative to clone 436 is given on the right.

start

synthetic oligonucleotides carrying one or several base exchanges. By using the same approach, in some of the constructions the adenosyl residue following the AUG codon was replaced by guanosine (clone 440-8), which corresponds to the most frequent nucleotide observed in this position in eucaryotic translation start sites (13, 14). This exchange enhanced the translation efficiency by a factor of 2 and thereby neutralized the negative effect of the EcoRI linker insertion. Single pyrimidine-purine exchanges in the pyrimidine region (clones 440-1 and 440-13) reduced expression of the neo gene to levels of 50 and 15%, respectively. The exchange of two nucleotides (clone 440-25) or four nucleotides (clone 440-7) within this region by guanosine reduced the translation rate to very low levels of 12 and 5%, respectively. The reduction of translation efficiency by point mutations in the pyrimidine tract was observed only for RNAs containing the complete 5'UTR downstream from poly(C). If the 5' end of the RNA was truncated up to position 742, thus placing the start codon for the neo fusion as the first AUG on the RNA, the translation efficiency was not significantly affected by the point tnutations. The different translation efficiencies of the mutants were not due to different stabilities of the respective RNAs in the rabbit reticulocyte lysate. Incubation of the radiolabeled RNAs in the lysate for 1 h under translation conditions did not lead to significant degradation, as determined by denaturing gel electrophoresis (data not shown). Translation efficiency in vivo. To determine whether the effects of the mutations in the 5'UTR observed in rabbit reticulocyte lysates would be similar in vivo, several FMDVneo inserts were transferred from the pSP64 plasmid into the SV40 shuttle vector p297-3 and transiently expressed in transfected BHK-21 cells. After separation of the cell lysates by nondenaturing PAGE, the amount of the neo gene product was measured by in situ phosphorylation of kanamycin (Fig. SA). As a measure of transfection efficiency, the cells were cotransfected with plasmid pSV2-CAT (8), and the enzymatic activity of the expressed acetyltransferase (35) was determined (Fig. SB). The in vivo phosphotransferase

4629

INTERNAL TRANSLATION INITIATION SITE OF FMDV

VOL. 64, 1990

3C

A 3

2

4

5

6

7

8

0 40

B

340

1

2

3

4

5

6

7

370

8 Translation efficiency:

3-ac CM 1 - ac. CM

FIG. 5. Translation efficiency of 5'UTR mutants in vivo. BHK-21 cells were cotransfected with different mutants shown in Fig. 4 inserted into the SV40 vector p297-3 together with plasmid pSV2-CAT and lysed after 60 h. (A) The neo activity in the lysates was determined by in situ phosphorylation of kanamycin after separation of the proteins by native PAGE (see Materials and Methods). (B) As a control for transfection efficiency, CAT assays were performed with the same extracts. Different combinations of mutant and control plasmids were used for transfection: lanes 1 and 1', no plasmid; lanes 2 and 2', pSV440-8 and pSV2-CAT; lanes 3 and 3', pSV440-25 and pSV2-CAT; lanes 4 and 4', pSV440-7 and pSV2-CAT; lanes 5 and 5', pSV434 (no AUG) and pSV2-CAT; lanes 6 and 6', pSV436 (wild type) and pSV2-CAT; lanes 7 and 7', pSV436 only; lanes 8 and 8', pSV2-CAT only. Positions of neomycin phosphotransferase (neo) on the gel and of chloramphenicol (CM) and the reaction products 3-acetylchloramphenicol (3-ac. CM) and 1-acetylchloramphenicol (1-ac. CM) on the chromatogram are indicated.

values were analogous to the translation efficiencies measured in rabbit reticulocyte lysates. Mutant 440-8 (Fig. 5A, lane 2), carrying the EcoRI site in front of the pyrimidine region and a guanosyl residue behind the AUG codon, showed an expression rate comparable to the rate for wildtype clone 436 (lane 6), whereas the double mutant 440-25 (lane 3) and the quadruple mutant 440-7 (lane 4) had strongly reduced neo activity. Analogous assays with deletion mutants in the 5'UTR further upstream revealed a similar congruence with the in vitro results described above (data not shown). DISCUSSION FMDV contains the longest 5'UTR of all picornaviruses, and its translation initiation site appears to be relatively

-= 70-100O F---l- 40-701

- 15-40S

8-151

_

2-8S

FIG. 6. Influence of different regions of the internal ribosomal entry site on translational efficiency. The secondary structure is schematically drawn according to the model proposed by Pilipenko et al. (30). Numbering of the hairpins is analogous to the numbering in this reference (C, constant subdomains; V, variable subdomains). Numbers at the base line refer to positions in the published FMDV 01K sequence (7). The effect on the translation efficiency of mutations in different parts of this structure is marked as indicated.

complex. Polyprotein synthesis initiates at two different sites (AUG 11 and 12), leading to two different amino-terminal gene products of the viral polyprotein, L and L' (39). According to our data, the region involved in the regulation of translation initiation extends approximately 450 nucleotides upstream from the start codon and is subdivided in two essential functional domains comprising the nucleotide sequence from positions 360 to 660 and the sequence from position 750 up to AUG 11 at position 805, respectively (Fig. 3). The intermediate region (positions 660 to 750) appears to be less sensitive for mutagenesis. Sequence comparison and computer-assisted folding of RNA structures suggest a similar secondary or tertiary structure of the internal translation initiation sites for all picornaviruses. Secondary-structure models have been proposed for individual members, e.g., FMDV (4), and for subgroups of the picornaviruses, e.g., the enterovirus-rhinovirus group (31, 34) and the cardiovirus-aphthovirus group (30). Two more recent models, one for the enterovirusrhinovirus group (31) and another for the cardiovirus-aphthovirus group (30), consist of several large conserved hairpin structures and contain extended regions of homologous nucleotide sequences within each group. Although the two models are similar in principle, there is no direct homology in the primary and secondary RNA structures between these two virus groups. A schematic drawing of the secondary-structure model proposed for the cardiovirusaphthovirus group (30), slightly modified to emphasize the specific features of FMDV, is shown in Fig. 6. The primary sequence of the internal translation initiation site of FMDV is approximately 40% homologous to the corresponding regions in encephalomyocarditis virus (5, 24) and Theiler's murine encephalomyelitis virus (23, 28, 29); however, the last 50 nucleotides preceding the start codon are unique to FMDV except for a pyrimidine motif of 10 to 11 nucleotides in front of the polyprotein start site. Modifications in this FMDV-specific region lead to a strong decrease of translation efficiency, and in particular the exchange of only a few nucleotides in the pyrimidine region abolished translation

4630

J. VIROL.

KUHN ET AL.

almost completely. The pyrimidine motif could represent an interaction site for a regulatory protein, since it is located in encephalomyocarditis virus and Theiler's murine encephalomyelitis virus in almost the same position. Experimental evidence in the encephalomyocarditis and poliovirus systems suggests that scanning from the 5' terminus does not occur but ribosomes bind directly to an internal entry site (10, 27). From our results, however, it appears likely that a local ribosomal scanning mechanism may be involved in recognition of the correct start codon. This would explain the variable distance of the start codon relative to the conserved hairpin domain in the different members of the virus family. It would also explain the translation initiation at two different start codons by FMDV. Deletions and insertions in the first domain of the putative ribosomal entry site influence the translation efficiency to different degrees. The inhibitory effect seems to depend more on the position of the respective mutation than on the actual size of the deletion or insertion. An approximate correlation of the effect of deletions and insertions with the proposed secondary-structure model of the ribosomal entry site (30) is shown in Fig. 6. Translation inhibition of up to 90% was measured for mutations in the middle part of this region, suggesting an essential role of the most conserved hairpin 3 in the internal ribosome entry. The effect of upstream mutations decreases with their distance from this central region. No effects have been observed with exchanges ahead of position 360. Modifications in an extended region in the second third of the putative ribosomal entry site (positions 660 to 750) reduce the translation efficiency up to 50% only. This obviously less important sector coincides with hairpin 4 in Fig. 6. In poliovirus, deletion of a fragment of 163 nucleotides in front of the translational start site is not lethal to viral replication (15). However, this fragment represents a repeat of a preceding sequence and is not part of the conserved structure of the putative ribosomal entry site as in the case of FMDV. It is not to be expected that deletion of this structural element in FMDV would lead to viable virus. A general picture of the internal translation start of picornaviruses emerging from the structural and functional data obtained so far would essentially consist of a central RNA core structure to which ribosomes have a strong affinity. Binding of ribosomes to this structure is most probably assisted by universal cellular factors (e.g., initiation factors) analogous to the binding of the 40S ribosomal subunit to the cap-binding protein complex. Accessory sequences may modulate the efficiency of translation initiation by the interaction with species- or tissue-specific factors which may enhance or limit, respectively, the expression of viral gene products in a particular tissue. A cellular 52-kilodalton protein described by Meerovitch et al. (18) which binds to the translational control region of poliovirus approximately 150 nucleotides in front of the start codon could belong to this category of factors. Recognition of the exact translation initiation point probably demands additional factors and may be facilitated by a canonical consensus sequence (13, 14). Multiple binding of cellular proteins to the 5'UTR of poliovirus has recently been demonstrated by del Angel et al. (6). Although many questions remain to be answered to confirm this model, the results obtained so far strongly suggest the existence of an alternative to the normal cap-dependent translation initiation. A more detailed analysis of the essential viral structural elements involved in this internal translation start and the characterization of cellular factors impli-

cated in this process are in progress and may lead to a more general concept of eucaryotic translation initiation. ACKNOWLEDGMENTS We thank Hans-Georg Krausslich for critical reading of the

manuscript. This work was supported by grant BCT-381-5 from the Bundesministerium fur Forschung und Technologie. LITERATURE CITED 1. Ambros, V., R. F. Pettersson, and D. Baltimore. 1978. An enzymatic activity in uninfected cells that cleaves the linkage between poliovirion RNA and the 5' terminal protein. Cell 15:1439-1446. 2. Beck, E., S. Forss, K. Strebel, R. Cattaneo, and G. Feil. 1983. Structure of the FMDV translation initiation site and of the structural proteins. Nucleic Acids Res. 11:7873-7885. 3. Beck, E., G. Ludwig, E. A. Auerswald, B. Reiss, and H. Schaller. 1982. Nucleotide sequence and exact localization of the neomycin phosphotransferase gene from transposon Tn5. Gene 19: 327-336. 4. Clarke, B. E., A. L. Brown, K. M. Currey, S. E. Newton, D. J. Rowlands, and A. R. Carroll. 1987. Potential secondary and tertiary structure in the genomic RNA of foot and mouth disease virus. Nucleic Acids Res. 15:7067-7079. 5. Cohen, S. H., R. K. Naviaux, K. M. Vanden Brink, and G. W. Jordan. 1988. Comparison of the nucleotide sequences of diabetogenic and nondiabetogenic encephalomyocarditis virus. Virology 166:603-607. 6. del Angel, R. M., A. G. Papavassiliou, C. Fernandez-Tomas, S. J. Silverstein, and V. R. Racaniello. 1989. Cell proteins bind to multiple sites within the 5' untranslated region of poliovirus RNA. Proc. Natl. Acad. Sci. USA 86:8299-8303. 7. Forss, S., K. Strebel, E. Beck, and H. Schaller. 1984. Nucleotide sequence and genome organization of foot-and-mouth disease virus. Nucleic Acids Res. 12:6587-6601. 8. Gorman, C. M., L. F. Moffat, and B. H. Howard. 1982. Recombinant genomes which express chloramphenicol acetyltransferase in mammalian cells. Mol. Cell. Biol. 2:1044-1051. 9. Jang, S. K., M. V. Davies, R. J. Kaufman, and E. Wimmer. 1989. Initiation of protein synthesis by internal entry of ribosomes into the 5' nontranslated region of encephalomyocarditis virus RNA in vivo. J. Virol. 63:1651-1660. 10. Jang, S. K., H.-G. Krausslich, M. J. H. Nicklin, G. M. Duke, A. C. Palmenberg, and E. Wimmer. 1988. A segment of the 5' nontranslated region of encephalomyocarditis virus RNA directs internal entry of ribosomes during in vitro translation. J. Virol. 62:2636-2643. 11. Kingston, R. E. 1987. Calcium phosphate transfection, unit 9.1, p. 1-4. In F. M. Ausubel, R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl (ed.), Current protocols in molecular biology-1987. John Wiley & Sons, Inc., New York. 12. Kozak, M. 1978. How do eucaryotic ribosomes select initiation regions in messenger RNA? Cell 15:1109-1123. 13. Kozak, M. 1984. Compilation and analysis of sequences upstream from the translational start site in eukaryotic mRNAs. Nucleic Acids Res. 12:857-872. 14. Kozak, M. 1986. Point mutations define a sequence flanking the AUG initiator codon that modulate translation by eukaryotic ribosomes. Cell 44:283-292. 15. Kuge, S., and A. Nomoto. 1987. Construction of viable deletion and insertion mutants of the Sabin strain type 1 poliovirus: function of the 5' noncoding sequence in viral replication. J. Virol. 61:1478-1487. 16. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature (London)

227:680-685. 17. Lee, Y. F., A. Nomoto, B. M. Detjen, and E. Wimmer. 1977. The genome-linked protein of picornaviruses: a protein covalently linked to poliovirus genome RNA. Proc. Natl. Acad. Sci. USA 74:59-63.

VOL. 64, 1990

INTERNAL TRANSLATION INITIATION SITE OF FMDV

18. Meerovitch, K., J. Pelletier, and N. Sonenberg. 1989. A cellular protein that binds to the 5'-noncoding region of poliovirus RNA: implications for internal translation initiation. Genes Dev. 3:1026-1034. 19. Melgar, E., and D. A. Goldthwait. 1968. Deoxyribonucleic acid nucleases. II. The effects of metals on the mechanism of action of deoxyribonuclease I. J. Biol. Chem. 243:4409-4416. 20. Melton, D. A., P. A. Krieg, M. R. Rebagliati, T. Maniatis, K. Zinn, and M. R. Green. 1984. Efficient in vitro synthesis of biologically active RNA and RNA hybridization probes from plasmids containing a bacteriophage SP6 promoter. Nucleic Acids Res. 12:7035-7056. 21. Miskimins, W. K., M. P. Roberts, A. McClelland, and F. H. Ruddle. 1985. Use of a protein blotting procedure and a specific DNA probe to identify nuclear proteins that recognize the promoter region of the transferrin receptor gene. Proc. Natl. Acad. Sci. USA 82:6741-6744. 22. Nomoto, A., Y. F. Lee, and E. Wimmer. 1976. The 5' end of poliovirus mRNA is not capped with m7G(5')pppNp. Proc. Natl. Acad. Sci. USA 73:375-380. 23. Ohara, Y., S. Stein, J. Fu, L. Stillman, L. Klaman, and R. P. Roos. 1988. Molecular cloning and sequence determination of DA strain of Theiler's murine encephalomyelitis viruses. Virology 164:245-255. 24. Palmenberg, A. C., E. M. Kirby, M. R. Janda, N. L. Drake, G. M. Duke, K. F. Potratz, and M. S. Collett. 1984. The nucleotide and deduced amino acid sequences of the encephalomyocarditis viral polyprotein coding region. Nucleic Acids Res. 12:2969-2985. 25. Pelletier, J., G. Kaplan, V. R. Racaniello, and N. Sonenberg. 1988. Cap-independent translation of poliovirus mRNA is conferred by sequence elements within the 5' noncoding region. Mol. Cell. Biol. 8:1103-1112. 26. Pelletier, J., and N. Sonenberg. 1988. Internal initiation of translation of eukaryotic mRNA directed by a sequence derived from poliovirus RNA. Nature (London) 334:320-325. 27. Pelletier, J., and N. Sonenberg. 1989. Internal binding of eucaryotic ribosomes on poliovirus RNA: translation in HeLa cell extracts. J. Virol. 63:441 444. 28. Pevear, D. C., J. Borkowski, M. Calenoff, C. K. Oh, B. Ostrowski, and H. L. Lipton. 1988. Insights into Theiler's virus neurovirulence based on a genomic comparison of the neurovirulent GDVII and less virulent BeAn strains. Virology 165:1-12.

4631

29. Pevear, D. C., M. Calenoff, E. Rozhon, and H. L. Lipton. 1987. Analysis of the complete nucleotide sequence of the picornavirus Theiler's murine encephalomyelitis virus indicates that it is closely related to cardioviruses. J. Virol. 61:1507-1516. 30. Pilipenko, E. V., V. M. Blinov, B. K. Chernov, T. M. Dmitrieva, and V. I. Agol. 1989. Conservation of the secondary structure elements of the 5'-untranslated region of cardio- and aphthovirus RNAs. Nucleic Acids Res. 17:5701-5711. 31. Pilipenko, E. V., V. M. Blinov, L. I. Romanova, A. N. Sinyakov, S. V. Maslova, and V. I. Agol. 1989. Conserved structural domains in the 5'-untranslated region of picornaviral genomes: an analysis of the segment controlling translation and neurovirulence. Virology 168:201-209. 32. Reiss, B., R. Sprengel, and H. Schaller. 1984. Protein fusions with the kanamycin resistance gene from transposon Tn5. EMBO J. 3:3317-3322. 33. Reiss, B., R. Sprengel, H. Will, and H. Schaller. 1984. A new sensitive method for qualitative and quantitative assay of neomycin phosphotransferase in crude cell extracts. Gene 30:211218. 34. Rivera, V. M., J. D. Welsh, and J. V. Maizel, Jr. 1988. Comparative sequence analysis of the 5' noncoding region of the enteroviruses and rhinoviruses. Virology 165:42-50. 35. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 36. Sangar, D. V., D. N. Black, D. J. Rowlands, T. J. R. Harris, and F. Brown. 1980. Location of the initiation site for protein synthesis on foot-and-mouth disease virus RNA by in vitro translation of defined fragments of the RNA. J. Virol. 33:59-68. 37. Sangar, D. V., S. E. Newton, D. J. Rowlands, and B. E. Clarke. 1987. All foot and mouth disease virus serotypes initiate protein synthesis at two separate AUGs. Nucleic Acids Res. 15:33053315. 38. Shih, D. S., I.-W. Park, C. L. Evans, J. M. Jaynes, and A. C. Palmenberg. 1987. Effects of cDNA hybridization on translation of encephalomyocarditis virus RNA. J. Virol. 61:2033-2037. 39. Strebel, K., and E. Beck. 1986. A second protease of foot-andmouth disease virus. J. Virol. 58:893-899. 40. Strebel, K., E. Beck, K. Strohmaier, and H. Schaller. 1986. Characterization of foot-and-mouth disease virus gene products with antisera against bacterially synthesized fusion proteins. J. Virol. 57:983-991.