Australian Dental Journal
The official journal of the Australian Dental Association
Australian Dental Journal 2015; 60: 503–510 doi: 10.1111/adj.12257
Full-mouth scaling and root planing combined with azithromycin to treat peri-implantitis K Gomi,* Y Matsushima,* Y Ujiie,* S Shirakawa,* T Nagano,* M Kanazashi,* A Yashima* *Department of Periodontology, School of Dental Medicine, Tsurumi University, Japan.
ABSTRACT Background: Full-mouth scaling and root planing combined with azithromycin is clinically and bacteriologically effective for the treatment of chronic periodontitis. This study aimed to investigate the clinical and bacteriological effects of this combination treatment in patients with peri-implantitis. Methods: Twenty adult patients with both chronic periodontitis and peri-implantitis were randomly divided into two groups (10: test, 10: control). All patients underwent full-mouth scaling and root planing but the test group received azithromycin for 3 days before the procedure. The probing depth, bleeding on probing, and the gingival index were assessed clinically. Bacterial samples were obtained before treatment at 1 week and 1, 3, 6, 9 and 12 months after treatment. Quantitative and qualitative analyses were performed using the polymerase chain reaction Invader method. Results: All clinical parameters showed better improvement in both periodontitis and peri-implantitis in the test group. Periodontal bacteria were more effectively reduced in the test group, but gradually increased around implants 6 months after treatment and natural teeth 9 months after treatment. Conclusions: Full-mouth scaling and root planing combined with azithromycin was temporarily useful for the treatment of peri-implantitis. Clinical improvements were maintained for about 9 months but periodontal bacteria increased again 6 months after treatment. Keywords: Azithromycin, microbiota, peri-implantitis, periodontitis. Abbreviations and acronyms:: AZM = azithromycin; BOP = bleeding on probing; CIST = cumulative interceptive supportive therapy; FMD = full-mouth disinfection; FM-SRP = full-mouth scaling and root planing; PCR = polymerase chain reaction; PD = pocket depth; SRP = scaling and root planing. (Accepted for publication 24 November 2014.)
INTRODUCTION In recent years, the popularity of dental implants has increased rapidly. Implants are performed to replace damaged and missing teeth, in many cases as a result of periodontal disease. However, periodontal pathogens present in periodontal pockets can be transmitted to the peri-implant region, resulting in peri-implantitis.1 This is a particular risk in patients with chronic periodontitis.2 Mombelli and Lang3 proposed cumulative interceptive supportive therapy (CIST) as a guideline for treating implants affected by peri-implant disease. In this therapy, treatment is classified into classes A, B, C or D, according to the extent of progression of peri-implant disease. The classification is based on the depth of peri-implant pockets (pocket depth; PD), the presence of bleeding on probing (BOP) and the extent of bone resorption. Specific treatment is recommended for each class (Fig. 1). © 2015 Australian Dental Association
Chen and Darby4 also presented a detailed recommendation for the maintenance, care and treatment of peri-implant mucositis and peri-implantitis in their review. However, even with careful adherence to treatment regimens, the control of bacteria around dental implants is difficult. There is evidence to suggest that even regenerative surgery may not control peri-implantitis.5 One study reported that bacterial colonization occurred within 30 minutes of implant placement,6 and another found that colonies of periodontal pathogens around implants were nearly identical to those around natural teeth within 7 days of implantation.7 Periodontal bacteria form a biofilm in the pocket around the implant, resulting in peri-implantitis and potential failure of the implant. Therefore, the biofilm must be mechanically destroyed as part of the treatment of peri-implantitis. Disinfection with materials that do not affect the integrity of the 503
K Gomi et al.
Fig. 1 Schematic diagram of the classification system of cumulative interceptive supportive therapy (CIST).2
implant, such as laser irradiation or irrigation with chlorhexidine solution, may be combined with mechanical debridement of the biofilm. The most commonly used indices to evaluate periodontitis are PD and BOP, and these indices are also used to evaluate peri-implantitis. It has also been reported that the microbial flora in peri-implant sulci is similar to that in periodontal pockets7 and that some bacteria spread from natural teeth to dental implants.8 Therefore, in addition to the standard indices, microbiological evaluation is also important to evaluate the status of dental implants and the development of peri-implantitis. In 1995, Quirynen et al.9 introduced the concept of one-stage full-mouth disinfection (FMD) using a combination of mechanical plaque control (scaling and root planing; SRP) and chlorhexidine, performed twice in 24 hours, to rapidly remove periodontopathic bacteria from the oral cavity. A number of studies have confirmed the effectiveness of the FMD approach.10,11 Conversely, other studies failed to demonstrate any statistically significant difference between FMD and conventional therapy.12,13 In addition, there have been reports of pyrexia following FMD, probably as a result of large numbers of bacteria entering the bloodstream during the procedure.14 Harrera et al. investigated the use of systemic antibacterial therapy to treat periodontitis, with and without mechanical debridement.15 They concluded that systemic antibiotics for periodontal therapy should be used in combination with mechanical debridement. To optimize the treatment outcome, they recommended that antibiotics should be commenced on the day debridement is completed, and that debridement should be of high quality and completed within a short time, preferably less than 1 week.15 Therefore, combining mechanical plaque control with antibacterial plaque control could be more effective than 504
mechanical plaque control alone, especially for patients with severe periodontitis. We have previously reported that one-stage fullmouth SRP (FM-SRP) combined with systemically administered azithromycin (AZM) is clinically and bacteriologically useful for the treatment of chronic periodontitis.16 This method achieved similar results to FMD as described by Quirynen et al.,9 but with the advantage that it did not cause pyrexia. AZM has a long half-life and good tissue penetration.17 Furthermore, AZM is preferentially taken up by phagocytes and therefore targets infected tissues. Compared with earlier macrolides, AZM has stronger antibiotic effects against Gram-negative microorganisms. AZM can be retained in inflamed gingiva for more than a week and is therefore effective against periodontal disease-related bacteria.17 Moreover, AZM could have a triple role in the management of periodontal diseases, reducing or eradicating periodontopathogens, suppressing inflammation, and encouraging healing through persistence at low levels in macrophages and fibroblasts in periodontal tissues.18 Given the effectiveness of FM-SRP to treat periodontitis, it was hypothesized that the same approach could be effective against peri-implantitis. Therefore, the aim of the present study was to evaluate the clinical and bacteriological efficacy of FM-SRP combined with AZM to treat peri-implantitis. MATERIALS AND METHODS Study subjects and setting Study subjects were recruited from patients with both chronic periodontitis and peri-implantitis referred to the Department of Periodontics, Tsurumi University Dental Hospital, between September 2011 and March 2013. Ethical approval was obtained from the Ethics © 2015 Australian Dental Association
Full-mouth SRP with azithromycin for peri-implantitis Committee of Tsurumi University, School of Dental Medicine. The study was conducted in accordance with the 2008 revision of the Declaration of Helsinki. All subjects provided written informed consent before participation in the study. The target sample size was calculated based on our previous studies.16,19 Eligible patients included adult males and females with dental implants inserted more than 3 years previously, peri-implantitis of CIST class C or D (radiographic evidence of bone loss around the implants) and coexisting chronic periodontitis. Exclusion criteria included systemic or topical antibiotic treatment in the preceding 3 months, allergy to macrolide antibiotics, systemic illness or medication associated with periodontal manifestations and current smoking or a history of smoking within 5 years prior to the study. In total, 20 patients (9 males and 11 females) were recruited for the study. The average age was 67.6 5.3 years (range 55–78 years). Experimental design To avoid technical differences, all clinical procedures were performed by one dentist, and handling of bacterial samples, including plaque collection, was carried out by a single researcher. After recruitment to the study, all patients visited the clinic two or three times for oral hygiene instructions. Depending on individual needs, patients were instructed in the use of interproximal cleaning aids such as floss and interdental brushes, and supragingival scaling was carried out. After these instructional visits, the patients were randomly allocated to a test group (n = 10) or a control group (n = 10). All patients underwent full-mouth clinical examinations and bacterial sampling 2 weeks after supragingival scaling (baseline). The characteristics of patients in the test and control groups are presented in Table 1. Test group The 10 patients in the test group included 5 males and 5 females. The average age was 68.4 5.2 years (range 57–78 years). In the test group, FM-SRP was performed in conjunction with systemically adminis-
tered AZM (Zithromax 500 mg; Pfizer, La Jolla, CA, USA). AZM was commenced 3 days before FM-SRP, at a dose of 500 mg/day (total dose 1500 mg). FM-SRP was performed under local anaesthesia using metal curettes (LM-Instruments Oy, Helsinki, Finland) for natural teeth, and plastic curettes (ImplacareTM; Hu-Friedy, Chicago, IL, USA) and a plastic ultrasonic scaler (ENAC; Osada, Inc., Tokyo, Japan) with an IM point tip (Osada, Inc.) for implants. FM-SRP was completed in a single visit with an average treatment time of 100 minutes. Clinical parameters were recorded and samples for microbiological analysis were collected at baseline, at 1 week and at 1, 3, 6, 9 and 12 months after FM-SRP. Control group The 10 patients in the control group included 4 males and 6 females. The average age was 66.7 5.3 years (range 55–72 years). In the control group, FM-SRP without AZM was performed over four to six visits (average 4.8 0.9) within 5 weeks. As for the test group, FM-SRP was performed under local anaesthesia using the same instruments as described above. Clinical parameters were recorded and samples for microbiological analysis were collected at baseline, at 1 week, and at 1, 3, 6, 9 and 12 months after FM-SRP. Clinical assessment The PD and the percentage of BOP were determined at six sites on each natural tooth and implant (mesiobuccal, buccal, distobuccal, mesiolingual, lingual and distolingual) according to our previous study,19 using a manual periodontal probe (LMInstrument Oy). BOP was scored positive if bleeding was visible within 30 seconds after probing. The gingival index (GI) was evaluated using the L€ oe and Silness method.20 Microbiological assessment Throughout the study, bacterial samples were collected with sterile paper points (#40; Pierce, Tokyo,
Table 1. Patient characteristics at baseline Age (years; mean SD) (range)
Males: Females (n)
Test
68.4 3.5 (57 – 78)
5:5
Natural Implant
13.8 3.3 7.6 3.5
Control
66.7 5.3 (55 – 72)
4:6
Natural Implant
15.8 3.0 6.9 3.3
Treatment group
Number of residual teeth or implants (y)
Implanted period (y) (range) 7.7 4.5 (3 – 13) 6.4 3.4 (3 – 10)
There were no significant differences between the test and control groups at baseline. © 2015 Australian Dental Association
505
K Gomi et al. Japan) from the four deepest periodontal pockets per mouth (two from natural teeth and two from implants) identified at baseline. After sampling, the paper points were placed in 1 ml of sterilized distilled water, mixed well on a vortex mixer (Vortex-Genie 2; Scientific Industries, Bohemia, NY, USA) and treated with an ultrasonic device (Branson 2510; Sigma-Aldrich, Yamato, Japan) at 100 W for 10 minutes. The supernatant was stored at 4 °C until analysis. The microbial samples were boiled at 99 °C for 10 minutes using a heat block (Dry Thermo Unit DTU-1B; Taitec, Saitama, Japan) and then kept at 20 °C. The presence of five periodontopathic bacteria, Aggregatibacter actinomycetemcomitans, Prevotella intermedia, Porphyromonas gingivalis, Tannerella forsythia and Treponema denticola, was determined in each of the subgingival samples using the polymerase chain reaction (PCR) Invader method (BML Inc., Tokyo, Japan).21 All bacterial tests were carried out by a specialized biomedical laboratory (BML Inc., Tokyo, Japan). Briefly, bacterial DNA was purified using a nucleic acid purification system (MagNA pure LC; Roche Diagnostics KK, Basel, Switzerland). It was then added to 15 ml of reaction mixture containing primers for each species (Table 2), 50 mM deoxynucleotide triphosphate, 700 nM primary probe, 70 nM Invader oligo, 2.5 U PCR enzyme (AmpliTaq DNA Polymerase Stoffel fragment; Applied Biosystems, Foster City, CA,
USA) and an Invader core reagent kit (Cleavase XI Invader core reagent kit; Third Wave Technologies, Madison, WI, USA), which consisted of fluorescence resonance energy transfer mix and enzyme/MgCl2 solution. The reaction mixture was preheated at 95 °C for 2 minutes, and a two-step PCR reaction was carried out for 35 cycles (95 °C for 1 second and 63 °C for 1 minute) in a real-time PCR system (LightCycler 480; Roche Diagnostics, Basel, Switzerland). The fluorescence values of carboxyfluorescein (FAM; wavelength/ bandwidth excitation 485/20 nm, emission 530/25 nm) were measured at the end of the incubation/extension step at 63 °C for each cycle. The standard curves for quantitation were constructed by dilutions of plasmids, including the amplified regions. Statistical analysis The data were analysed with the subject as the unit. The mean and SD of each clinical parameter were calculated for each patient and compared to determine differences between the test and control groups. Improvements within groups from baseline to posttreatment were analysed using an unpaired t-test. The level of significance was set at 0.05. All statistical analyses were carried out using a statistical software package (StatView for Windows Version 5.0; SAS Institute, Cary, NC, USA).
Table 2. Details of the primers and Invader probe used in the polymerase chain reaction (PCR) Invader method Target
Sequence(50 -30 )
Region
A. actinomycetemcomitans F-primer R-primer P-probe I-oligo
TAGCATGCCAAMTTGACGTTAAAT GATTTCACACCTCACTTAAAGGTCC CGCGCCGAGGCCTTTACGCCCAGTTATT ACACCTCACTTAAAGGTCCGCCTACGTGCT
nt469-nt488 nt609-nt585
P. gingivalis F-primer R-primer P-probe I-oligo
GCGCTCAACGTTCAGCCT CACGAATTCCGCCTGCC CGCGCCGAGGGGCAGTTTCAACGGC GCCGCCGCTGAACTCAAGCCCT
nt615-nt632 nt682-nt666
P. intermedia F-primer R-primer P-probe I-oligo
CGTATCCAACCTTCCCTCCA CCGATGAATCTTTGGTCCACGT CGCGCCGAGGACGGCCTAATACCCG CCTCCACTCGGGGATACCCCGTTGAAAGT
nt91-nt110 nt192-nt171
T. forsythia F-primer R-primer P-probe I-oligo
TGAAAGTTTGTCGCTTAACGATAAAA TCGTGCTTCAGTGTCAGTTATACCT CGCGCCGAGGCATTCCGCCTACTTCATC CGTGATCTCTATGCATTTCACCGCTACACCACGT
nt563-nt588 nt724-nt700
T. denticola F-primer R-primer P-probe I-oligo
CTTCCGCAATGGACGAAAGT CAAAGAAGCATTCCCTCTTCTTCTTA CGCGCCGAGGGTAAAATTCTTTTGCAGATGAAG GCCGTGTGAATGAAGAAGGCCGAAAGGTTT
nt539-nt560 nt646-nt624
F-primer = forward primer; R-primer = reverse primer; P-probe = primary probe; I-oligo = Invader oligo. 506
© 2015 Australian Dental Association
© 2015 Australian Dental Association
The official journal of the Australian Dental Association
Australian Dental Journal 2015; 60: 503–510 doi: 10.1111/adj.12257
Full-mouth scaling and root planing combined with azithromycin to treat peri-implantitis K Gomi,* Y Matsushima,* Y Ujiie,* S Shirakawa,* T Nagano,* M Kanazashi,* A Yashima* *Department of Periodontology, School of Dental Medicine, Tsurumi University, Japan.
ABSTRACT Background: Full-mouth scaling and root planing combined with azithromycin is clinically and bacteriologically effective for the treatment of chronic periodontitis. This study aimed to investigate the clinical and bacteriological effects of this combination treatment in patients with peri-implantitis. Methods: Twenty adult patients with both chronic periodontitis and peri-implantitis were randomly divided into two groups (10: test, 10: control). All patients underwent full-mouth scaling and root planing but the test group received azithromycin for 3 days before the procedure. The probing depth, bleeding on probing, and the gingival index were assessed clinically. Bacterial samples were obtained before treatment at 1 week and 1, 3, 6, 9 and 12 months after treatment. Quantitative and qualitative analyses were performed using the polymerase chain reaction Invader method. Results: All clinical parameters showed better improvement in both periodontitis and peri-implantitis in the test group. Periodontal bacteria were more effectively reduced in the test group, but gradually increased around implants 6 months after treatment and natural teeth 9 months after treatment. Conclusions: Full-mouth scaling and root planing combined with azithromycin was temporarily useful for the treatment of peri-implantitis. Clinical improvements were maintained for about 9 months but periodontal bacteria increased again 6 months after treatment. Keywords: Azithromycin, microbiota, peri-implantitis, periodontitis. Abbreviations and acronyms:: AZM = azithromycin; BOP = bleeding on probing; CIST = cumulative interceptive supportive therapy; FMD = full-mouth disinfection; FM-SRP = full-mouth scaling and root planing; PCR = polymerase chain reaction; PD = pocket depth; SRP = scaling and root planing. (Accepted for publication 24 November 2014.)
INTRODUCTION In recent years, the popularity of dental implants has increased rapidly. Implants are performed to replace damaged and missing teeth, in many cases as a result of periodontal disease. However, periodontal pathogens present in periodontal pockets can be transmitted to the peri-implant region, resulting in peri-implantitis.1 This is a particular risk in patients with chronic periodontitis.2 Mombelli and Lang3 proposed cumulative interceptive supportive therapy (CIST) as a guideline for treating implants affected by peri-implant disease. In this therapy, treatment is classified into classes A, B, C or D, according to the extent of progression of peri-implant disease. The classification is based on the depth of peri-implant pockets (pocket depth; PD), the presence of bleeding on probing (BOP) and the extent of bone resorption. Specific treatment is recommended for each class (Fig. 1). © 2015 Australian Dental Association
Chen and Darby4 also presented a detailed recommendation for the maintenance, care and treatment of peri-implant mucositis and peri-implantitis in their review. However, even with careful adherence to treatment regimens, the control of bacteria around dental implants is difficult. There is evidence to suggest that even regenerative surgery may not control peri-implantitis.5 One study reported that bacterial colonization occurred within 30 minutes of implant placement,6 and another found that colonies of periodontal pathogens around implants were nearly identical to those around natural teeth within 7 days of implantation.7 Periodontal bacteria form a biofilm in the pocket around the implant, resulting in peri-implantitis and potential failure of the implant. Therefore, the biofilm must be mechanically destroyed as part of the treatment of peri-implantitis. Disinfection with materials that do not affect the integrity of the 503
K Gomi et al.
Fig. 1 Schematic diagram of the classification system of cumulative interceptive supportive therapy (CIST).2
implant, such as laser irradiation or irrigation with chlorhexidine solution, may be combined with mechanical debridement of the biofilm. The most commonly used indices to evaluate periodontitis are PD and BOP, and these indices are also used to evaluate peri-implantitis. It has also been reported that the microbial flora in peri-implant sulci is similar to that in periodontal pockets7 and that some bacteria spread from natural teeth to dental implants.8 Therefore, in addition to the standard indices, microbiological evaluation is also important to evaluate the status of dental implants and the development of peri-implantitis. In 1995, Quirynen et al.9 introduced the concept of one-stage full-mouth disinfection (FMD) using a combination of mechanical plaque control (scaling and root planing; SRP) and chlorhexidine, performed twice in 24 hours, to rapidly remove periodontopathic bacteria from the oral cavity. A number of studies have confirmed the effectiveness of the FMD approach.10,11 Conversely, other studies failed to demonstrate any statistically significant difference between FMD and conventional therapy.12,13 In addition, there have been reports of pyrexia following FMD, probably as a result of large numbers of bacteria entering the bloodstream during the procedure.14 Harrera et al. investigated the use of systemic antibacterial therapy to treat periodontitis, with and without mechanical debridement.15 They concluded that systemic antibiotics for periodontal therapy should be used in combination with mechanical debridement. To optimize the treatment outcome, they recommended that antibiotics should be commenced on the day debridement is completed, and that debridement should be of high quality and completed within a short time, preferably less than 1 week.15 Therefore, combining mechanical plaque control with antibacterial plaque control could be more effective than 504
mechanical plaque control alone, especially for patients with severe periodontitis. We have previously reported that one-stage fullmouth SRP (FM-SRP) combined with systemically administered azithromycin (AZM) is clinically and bacteriologically useful for the treatment of chronic periodontitis.16 This method achieved similar results to FMD as described by Quirynen et al.,9 but with the advantage that it did not cause pyrexia. AZM has a long half-life and good tissue penetration.17 Furthermore, AZM is preferentially taken up by phagocytes and therefore targets infected tissues. Compared with earlier macrolides, AZM has stronger antibiotic effects against Gram-negative microorganisms. AZM can be retained in inflamed gingiva for more than a week and is therefore effective against periodontal disease-related bacteria.17 Moreover, AZM could have a triple role in the management of periodontal diseases, reducing or eradicating periodontopathogens, suppressing inflammation, and encouraging healing through persistence at low levels in macrophages and fibroblasts in periodontal tissues.18 Given the effectiveness of FM-SRP to treat periodontitis, it was hypothesized that the same approach could be effective against peri-implantitis. Therefore, the aim of the present study was to evaluate the clinical and bacteriological efficacy of FM-SRP combined with AZM to treat peri-implantitis. MATERIALS AND METHODS Study subjects and setting Study subjects were recruited from patients with both chronic periodontitis and peri-implantitis referred to the Department of Periodontics, Tsurumi University Dental Hospital, between September 2011 and March 2013. Ethical approval was obtained from the Ethics © 2015 Australian Dental Association
Full-mouth SRP with azithromycin for peri-implantitis Committee of Tsurumi University, School of Dental Medicine. The study was conducted in accordance with the 2008 revision of the Declaration of Helsinki. All subjects provided written informed consent before participation in the study. The target sample size was calculated based on our previous studies.16,19 Eligible patients included adult males and females with dental implants inserted more than 3 years previously, peri-implantitis of CIST class C or D (radiographic evidence of bone loss around the implants) and coexisting chronic periodontitis. Exclusion criteria included systemic or topical antibiotic treatment in the preceding 3 months, allergy to macrolide antibiotics, systemic illness or medication associated with periodontal manifestations and current smoking or a history of smoking within 5 years prior to the study. In total, 20 patients (9 males and 11 females) were recruited for the study. The average age was 67.6 5.3 years (range 55–78 years). Experimental design To avoid technical differences, all clinical procedures were performed by one dentist, and handling of bacterial samples, including plaque collection, was carried out by a single researcher. After recruitment to the study, all patients visited the clinic two or three times for oral hygiene instructions. Depending on individual needs, patients were instructed in the use of interproximal cleaning aids such as floss and interdental brushes, and supragingival scaling was carried out. After these instructional visits, the patients were randomly allocated to a test group (n = 10) or a control group (n = 10). All patients underwent full-mouth clinical examinations and bacterial sampling 2 weeks after supragingival scaling (baseline). The characteristics of patients in the test and control groups are presented in Table 1. Test group The 10 patients in the test group included 5 males and 5 females. The average age was 68.4 5.2 years (range 57–78 years). In the test group, FM-SRP was performed in conjunction with systemically adminis-
tered AZM (Zithromax 500 mg; Pfizer, La Jolla, CA, USA). AZM was commenced 3 days before FM-SRP, at a dose of 500 mg/day (total dose 1500 mg). FM-SRP was performed under local anaesthesia using metal curettes (LM-Instruments Oy, Helsinki, Finland) for natural teeth, and plastic curettes (ImplacareTM; Hu-Friedy, Chicago, IL, USA) and a plastic ultrasonic scaler (ENAC; Osada, Inc., Tokyo, Japan) with an IM point tip (Osada, Inc.) for implants. FM-SRP was completed in a single visit with an average treatment time of 100 minutes. Clinical parameters were recorded and samples for microbiological analysis were collected at baseline, at 1 week and at 1, 3, 6, 9 and 12 months after FM-SRP. Control group The 10 patients in the control group included 4 males and 6 females. The average age was 66.7 5.3 years (range 55–72 years). In the control group, FM-SRP without AZM was performed over four to six visits (average 4.8 0.9) within 5 weeks. As for the test group, FM-SRP was performed under local anaesthesia using the same instruments as described above. Clinical parameters were recorded and samples for microbiological analysis were collected at baseline, at 1 week, and at 1, 3, 6, 9 and 12 months after FM-SRP. Clinical assessment The PD and the percentage of BOP were determined at six sites on each natural tooth and implant (mesiobuccal, buccal, distobuccal, mesiolingual, lingual and distolingual) according to our previous study,19 using a manual periodontal probe (LMInstrument Oy). BOP was scored positive if bleeding was visible within 30 seconds after probing. The gingival index (GI) was evaluated using the L€ oe and Silness method.20 Microbiological assessment Throughout the study, bacterial samples were collected with sterile paper points (#40; Pierce, Tokyo,
Table 1. Patient characteristics at baseline Age (years; mean SD) (range)
Males: Females (n)
Test
68.4 3.5 (57 – 78)
5:5
Natural Implant
13.8 3.3 7.6 3.5
Control
66.7 5.3 (55 – 72)
4:6
Natural Implant
15.8 3.0 6.9 3.3
Treatment group
Number of residual teeth or implants (y)
Implanted period (y) (range) 7.7 4.5 (3 – 13) 6.4 3.4 (3 – 10)
There were no significant differences between the test and control groups at baseline. © 2015 Australian Dental Association
505
K Gomi et al. Japan) from the four deepest periodontal pockets per mouth (two from natural teeth and two from implants) identified at baseline. After sampling, the paper points were placed in 1 ml of sterilized distilled water, mixed well on a vortex mixer (Vortex-Genie 2; Scientific Industries, Bohemia, NY, USA) and treated with an ultrasonic device (Branson 2510; Sigma-Aldrich, Yamato, Japan) at 100 W for 10 minutes. The supernatant was stored at 4 °C until analysis. The microbial samples were boiled at 99 °C for 10 minutes using a heat block (Dry Thermo Unit DTU-1B; Taitec, Saitama, Japan) and then kept at 20 °C. The presence of five periodontopathic bacteria, Aggregatibacter actinomycetemcomitans, Prevotella intermedia, Porphyromonas gingivalis, Tannerella forsythia and Treponema denticola, was determined in each of the subgingival samples using the polymerase chain reaction (PCR) Invader method (BML Inc., Tokyo, Japan).21 All bacterial tests were carried out by a specialized biomedical laboratory (BML Inc., Tokyo, Japan). Briefly, bacterial DNA was purified using a nucleic acid purification system (MagNA pure LC; Roche Diagnostics KK, Basel, Switzerland). It was then added to 15 ml of reaction mixture containing primers for each species (Table 2), 50 mM deoxynucleotide triphosphate, 700 nM primary probe, 70 nM Invader oligo, 2.5 U PCR enzyme (AmpliTaq DNA Polymerase Stoffel fragment; Applied Biosystems, Foster City, CA,
USA) and an Invader core reagent kit (Cleavase XI Invader core reagent kit; Third Wave Technologies, Madison, WI, USA), which consisted of fluorescence resonance energy transfer mix and enzyme/MgCl2 solution. The reaction mixture was preheated at 95 °C for 2 minutes, and a two-step PCR reaction was carried out for 35 cycles (95 °C for 1 second and 63 °C for 1 minute) in a real-time PCR system (LightCycler 480; Roche Diagnostics, Basel, Switzerland). The fluorescence values of carboxyfluorescein (FAM; wavelength/ bandwidth excitation 485/20 nm, emission 530/25 nm) were measured at the end of the incubation/extension step at 63 °C for each cycle. The standard curves for quantitation were constructed by dilutions of plasmids, including the amplified regions. Statistical analysis The data were analysed with the subject as the unit. The mean and SD of each clinical parameter were calculated for each patient and compared to determine differences between the test and control groups. Improvements within groups from baseline to posttreatment were analysed using an unpaired t-test. The level of significance was set at 0.05. All statistical analyses were carried out using a statistical software package (StatView for Windows Version 5.0; SAS Institute, Cary, NC, USA).
Table 2. Details of the primers and Invader probe used in the polymerase chain reaction (PCR) Invader method Target
Sequence(50 -30 )
Region
A. actinomycetemcomitans F-primer R-primer P-probe I-oligo
TAGCATGCCAAMTTGACGTTAAAT GATTTCACACCTCACTTAAAGGTCC CGCGCCGAGGCCTTTACGCCCAGTTATT ACACCTCACTTAAAGGTCCGCCTACGTGCT
nt469-nt488 nt609-nt585
P. gingivalis F-primer R-primer P-probe I-oligo
GCGCTCAACGTTCAGCCT CACGAATTCCGCCTGCC CGCGCCGAGGGGCAGTTTCAACGGC GCCGCCGCTGAACTCAAGCCCT
nt615-nt632 nt682-nt666
P. intermedia F-primer R-primer P-probe I-oligo
CGTATCCAACCTTCCCTCCA CCGATGAATCTTTGGTCCACGT CGCGCCGAGGACGGCCTAATACCCG CCTCCACTCGGGGATACCCCGTTGAAAGT
nt91-nt110 nt192-nt171
T. forsythia F-primer R-primer P-probe I-oligo
TGAAAGTTTGTCGCTTAACGATAAAA TCGTGCTTCAGTGTCAGTTATACCT CGCGCCGAGGCATTCCGCCTACTTCATC CGTGATCTCTATGCATTTCACCGCTACACCACGT
nt563-nt588 nt724-nt700
T. denticola F-primer R-primer P-probe I-oligo
CTTCCGCAATGGACGAAAGT CAAAGAAGCATTCCCTCTTCTTCTTA CGCGCCGAGGGTAAAATTCTTTTGCAGATGAAG GCCGTGTGAATGAAGAAGGCCGAAAGGTTT
nt539-nt560 nt646-nt624
F-primer = forward primer; R-primer = reverse primer; P-probe = primary probe; I-oligo = Invader oligo. 506
© 2015 Australian Dental Association
© 2015 Australian Dental Association
