Mol Neurobiol DOI 10.1007/s12035-014-8724-7

Antisense Oligonucleotide Therapy for the Treatment of C9ORF72 ALS/FTD Diseases Giulietta Riboldi & Chiara Zanetta & Michela Ranieri & Monica Nizzardo & Chiara Simone & Francesca Magri & Nereo Bresolin & Giacomo P. Comi & Stefania Corti

Received: 1 December 2013 / Accepted: 28 April 2014 # Springer Science+Business Media New York 2014

Abstract Motor neuron disorders, and particularly amyotrophic lateral sclerosis (ALS), are fatal diseases that are due to the loss of motor neurons in the brain and spinal cord, with progressive paralysis and premature death. It has been recently shown that the most frequent genetic cause of ALS, frontotemporal dementia (FTD), and other neurological diseases is the expansion of a hexanucleotide repeat (GGGGCC) in the non-coding region of the C9ORF72 gene. The pathogenic mechanisms that produce cell death in the presence of this expansion are still unclear. One of the most likely hypotheses seems to be the gain-of-function that is achieved through the production of toxic RNA (able to sequester RNA-binding protein) and/or toxic proteins. In recent works, different authors have reported that antisense oligonucleotides complementary to the C9ORF72 RNA transcript sequence were able to significantly reduce RNA foci generated by the expanded RNA, in affected cells. Here, we summarize the recent findings that support the idea that the buildup of “toxic” RNA containing the GGGGCC repeat contributes to the death of motor neurons in ALS and also suggest that the use of antisense oligonucleotides targeting this transcript is a promising strategy for treating ALS/frontotemporal lobe dementia (FTLD) patients with the C9ORF72 repeat expansion. These data are particularly important, given the state of the art antisense technology, and they allow researchers to believe G. Riboldi : C. Zanetta : M. Ranieri : M. Nizzardo : C. Simone : F. Magri : N. Bresolin : G. P. Comi : S. Corti (*) Dino Ferrari Centre, Neuroscience Section, Department of Pathophysiology and Transplantation (DEPT), Neurology Unit, University of Milan, IRCCS Foundation Ca’ Granda Ospedale Maggiore Policlinico, Policlinico, via Francesco Sforza 35, 20122 Milan, Italy e-mail: [email protected] F. Magri : N. Bresolin IRCCS Eugenio Medea, Bosisio Parini, Lecco, Italy

that a clinical application of these discoveries will be possible soon. Keywords Amyotrophic lateral sclerosis . C9ORF72 gene . RNA foci . Antisense oligonucleotides . Repeat-associated non-ATG (RAN)-initiated translation peptides

Introduction Amyotrophic lateral sclerosis (ALS) and frontotemporal lobe dementia (FTLD) are two devastating neurodegenerative diseases, still incurable. ALS is a neurodegenerative disease that leads to progressive upper and lower motoneuron degeneration leading to death in a few years, in the most aggressive forms. FTLD is a broad spectrum of progressive dementia due mainly to subacute destruction of the frontal or temporal lobes. Over the last years, one of the main genetic discoveries has been the finding of the expansion of a GGGGCC hexanucleotide in first intron/promoter of the C9ORF72 gene as the most common genetic cause of both familial and sporadic ALS and FTLD in Caucasians [1–3]. This same expansion was also discovered in patients affected by other neurodegenerative diseases, such as Parkinson’s [4] and Alzheimer’s disease [5, 6], and very recently, it has also been reported in Huntington’s disease phenocopies [7]. In recent years, in the field of neurodegenerative disorders, an important continuum has been identified between ALS and FTLD, which frequently overlaps and/or coexists in same families and individuals, demonstrating a common genetic background, and they also show similar neuropathological findings [8, 9]. Many genes have been discovered in the last years to be responsible for ALS and FTLD, and some of them seem to play a role in the pathogenesis of both of diseases, such as DNA/RNA-binding protein TDP-43 (encoded by TARDBP), fused in sarcoma (FUS) gene, VCP [10–14], and ubiquilin 2

Mol Neurobiol

(UBQLN2) [15]. Both ALS and FTLD still lack an effective therapy, but the high frequency of the expansion of C9ORF72 hexanucleotide in many different neurodegenerative disorders seems to open the way up for the development of therapeutic strategies targeting this mutation. The establishment of an effective therapeutic paradigm for spinal muscular atrophy (SMA), a frequent genetic form of motor neuron disorder of infancy due to mutations in survival of motor neuron 1 (SMN1) gene, has recently seen a striking advancement. By manipulation of pre-messenger RNA (mRNA) splicing using antisense oligonucleotides (ASOs), defective transcripts from the SMN2 gene can be modified in order to make the gene able to transcribe the SMN protein and restore its function [16]. Several different oligonucleotide chemistries can be used for this purpose, and various strategies developed to facilitate increased delivery, efficiency, and prolonged therapeutic effects. A large number of in vitro and in vivo studies validated the applicability of this approach with impressive results, and an increasing number of preliminary clinical trials have either been completed or are ongoing for SMA [17]. This positive experience in the SMA field can outline the groundwork for the development of a similar approach for familial and sporadic ALS patients in which a gene has been identified as causative. Indeed, ISIS Pharmaceuticals proposed the use of oligonucleotide 333611 as a therapeutic strategy for people carrying mutations in superoxide dismutase 1 (SOD1) genes (which is responsible for 13 % of familial ALS (fALS)). This ASO has been tested in the SOD1 Gly93Ala rat model through cerebrospinal fluid delivery and in cultured human cells. The results, in terms of treated animal survival and SOD1 mRNA and protein reduction, were encouraging [18, 19]. ISIS 333611 has been recently translated in a clinical trial with ALS patients [20]. In this study, tolerability, safety, and pharmacokinetics of intrathecal administration of ISIS 333611 have been proven. This is the first clinical study of intrathecal delivery of an ASO. ISIS 333611 showed good tolerability after intrathecal administration [20]. Thus, ASO delivered to the central nervous system (CNS) could be a feasible treatment for genetic ALS and other neurological disorders. Very recently, it has been described that oligonucleotides complementary to the C9ORF72 RNA transcript sequence are able to suppress in vitro the formation of pathological RNA foci of C9ORF72 [21–23]. Here, we summarize these recent findings that support the idea that the buildup of “toxic” RNA containing the GGGGCC repeat contributes to the death of motor neurons in ALS and also suggest that ASOs targeting this transcript could be a strategy for treating ALS/FTLD patients with the C9ORF72 repeat expansion. This data is particularly important, given the fact that the current state of

the art of antisense technology field could very soon allow a clinical application of these discoveries.

C9ORF72 ALS/FTLD Disease Background C9ORF72 ALS/FTLD: a New Spectrum of Repeat Expansion Diseases The hexanucleotide GGGGCC repeat expansion in the noncoding region of the C9ORF72 gene seems to be the most frequent form of genetic abnormality in familial and sporadic ALS and FTLD. This mutation explains approximately 5–7 % of sporadic ALS and FTLD cases and about nearly 40 % of fALS and 21 % the fFTLD [1, 2, 24]. The function of the C9ORF72 protein is still unknown, along with the mechanism by which the repeat expansion causes the disease. There are currently more than 20 neurodegenerative and neuromuscular disorders that are characterized by unstable repeat expansions like C9ORF72, including Huntington’s diseases (HD), myotonic muscular dystrophy (DM1 and DM2), spinocerebellar ataxia type 8 (SCA8), fragile X syndrome type A (FRAXA), and tremor ataxia fragile X syndrome (TAFXS) [25–27]. Depending on their location in the genes, the repeat expansions can be labeled as coding or non-coding. The mechanisms through which expansions lead to diseases are heterogeneous. In DM1, there is a CUG expansion in the RNA of the DM protein kinase (DMPK) gene that leads to the accumulation of exceeding RNA in nuclear foci. These RNA foci are able to sequester RNA-binding protein, such as the muscleblind-like 1 (MBNL1) protein, with consequent activation of a pathologic molecular cascade [28]. This mechanism is indicated as toxic RNA gain-of-function and has been suggested to be present also in C9ORF72 mutations. In other diseases, the genetic expansions are deleterious through a mechanism of repeat-associated non-ATG (RAN)-initiated translation peptides, protein gain-of-function (HD), or protein loss-of-function (FRAXA, Friedreich’s ataxia (FRDA)) [27, 29, 30]. Regarding C9ORF72 hexanucleotide expansion, it is not clear yet which mechanism is responsible for neurodegeneration. Some data are favorable to the loss-of-function hypothesis and some other for the gain-of-function hypothesis. The Loss-of-Function Hypothesis In vitro studies revealed that C9ORF72 seems to be essential for correct development and motor system function since decreased protein levels, obtained with knockdown of the C9ORF72 orthologue, cause motor defects in zebrafish [31]. Also, decreased expression of C9ORF72 RNA in autoptic tissues of ALS/FTLD patients [1] was reported. A recent work by Xi et al [32] underlines the role of hypermethylation of the

Mol Neurobiol

CpG island 5' of the GGGGCC repeat, which seems to correlate with disease duration in patients. These data are again in support of the loss-of-function hypothesis since the hypermethylation induces a downregulation of the concerned gene. The Gain-of-Function Hypothesis Otherwise, there are also convincing elements in favor of the gain-of-function hypothesis. First of all, patients with homozygous C9ORF72 mutations do not present a more serious phenotype compared to heterozygous patients, as it has been observed in loss-of-function process, and stop codon mutations that would be liable for haploinsufficiency have not been found [33, 34]. Moreover, in some studies, C9ORF72 expression is not significantly decreased in C9-ALS patient cells, but there is rather a paradoxical shift toward transcription of the allele with the hexanucleotide repeat, supporting the notion that the C9ORF72 repeat expansion leads to gain-of-function, rather than loss-of-function [23]. On the other hand, it was also found that the downregulation of C9ORF72 RNA levels through ASOs did not produce an expression profile similar to that of C9ORF72 cells, indicating once again that the C9ORF72 mechanism of pathogenesis seems not be a loss of function [22]. In the most recent studies, authors reported intranuclear RNA foci in mutated ALS/FTLD patients’ motor cortex and spinal cord tissues [1, 3] (Fig. 2). RNA foci are produced by the aberrant localization of the RNA transcripts of the C9ORF72 gene carrying the hexanucleotide repeat expansion. They have been found to be histological hallmarks in ALS and FTLD brain cells, and their pathogenic role seems to be linked to accumulation into the nucleus as well as link and sequestration of RNA-binding proteins [1]. The presence of cytoplasmic pathological inclusions of TDP-43 has been found at a pathological level, and how the C9ORF72 foci leads to these abnormalities, which are present also in sporadic ALS, is not cle ar yet . M oreo ve r, it has be en rep orte d t hat hexanucleotide expansion could give rise to a repeatassociated non-ATG (RAN)-dependent translation that produces pathogenic dipeptides that could interfere with the normal cellular pathways [29, 30] (Fig. 1). Another interesting recent finding that has implications for therapeutic approaches is the discovery of abundant RNA foci with C9ORF72 repeats transcribed in the antisense (GGCCCC) direction [22, 35]. It is not yet been determined whether antisense strand RNAs can be incorporated into antisense foci and also be translated into RAN polydipeptides, as it has been shown for the sense strand. Because of the greater amount of data and because of the reasons that will be expose along the text, the gain-of-function hypothesis seems more feasible to us even if more studies will be necessary to definitely test it.

RNA-Binding Protein Pathomechanism The discovery of several RNA-binding protein (RBP) partners for the expanded GGGGCC (GGGGCCexp) RNA, probably sequestered by C9ORF72 RNA foci, could make light on the altered molecular mechanisms. In particular, among such a protein, adenosine deaminase, RNA-specific, B2 (ADARB2), heterogeneous nuclear ribonucleoprotein A1 (hnRNPA1), and Pur-α, but not hnRNPA3, hnRNPA2/B1, or TDP-43 or FUS (which are mutated in rare cases of familial ALS), were found to colocalize with RNA foci into patient-derived induced pluripotent stem cells (iPSCs) [23]. Mutations of hnRNPA1 and hnRNPA2/B1 were identified in two families affected by inclusion body myopathy associated with Paget disease of the bone, frontotemporal dementia (FTD), and ALS [36]. This data was not validated after a screening in a large Italian cohort of familial ALS patient, suggesting that mutations in hnRNPA genes are very rare in ALS patients [37]. ADARB2 belongs to the ADAR family that is accountable for the adenosine-to-inosine (A-to-I) conversions in coding and non-coding RNA regions [38]. ADAR2 mRNA localizes in the nucleus, and it undergoes alternative splicing producing two isoforms, ADAR2a and ADAR2b, both expressed in the CNS, particularly in the cerebellum for ADAR2b [38, 39]. ADARB2 is an RBP, so its co-localization with C9ORF72 RNA foci [21] could result in the sequestration of this protein. It participates mainly in the editing of the (Q/R) site of the GluR2 αamino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptor altering neuronal excitability [40]. Increased calcium permeability of AMPA receptors may be responsible for motor neuron degeneration [41]. Indeed, sporadic ALS (sALS) patients could present GluR2 mRNA lacking A-to-I conversion at the Q/R site [42], and recently altered ADAR-mediated editing has been described in association with sALS [40]. Also, the pathologic isoform of the GluR2 receptor could be liable for the increased sensitivity to glutamate found in C9ORFexpanded iPS neurons [21]. The presence of RNA foci and the associated RBP sequestration may also be responsible for anomalous cellular transcription. Deregulated gene expression in C9 cells was independently reported by several groups [21–23]. Svendsen’s group, in particular, highlighted three genes that are affected: dipeptidylpeptidase 6 (DPP6), a gene identified in multiple previous genome-wide association (GWA) studies as being associated with sporadic ALS; the interacting potassium channel KCNQ3; and three members of the cerebellin family of proteins involved in synapse formation [23]. However, many genes have been highlighted by different groups as potential candidates for

Mol Neurobiol

Fig. 1 ASOs’ targets in C9ORF72 hexanucleotide-expanded gene. Red ASOs represent ASOs from Sareen et al.’s paper [21], green ASOs from Lagier-Tourenne et al.’s paper [20], and grey ASOs from Donnelly et al.’s

paper [19]. Orange squares indicate common ASOs used in the three papers [19–21]. RBP RNA-binding proteins, RAN repeat-associated nonATG-initiated translation peptides (color figure online)

future development of pharmacodynamic biomarkers to monitor C9ORF72 therapy in human CSF and/or blood [21–23].

motor neuron final degeneration [21]. Motor neurons obtained from patient-derived iPSCs show a lacking action potential response after membrane depolarization [23]. Overall, these findings suggest that iPSCs derived from ALS patients appear to recapitulate the pathological and genomic abnormalities found in the C9ORF72 ALS CNS tissues in vivo. Modeling this expansion mutation in animals can be particularly challenging since the vast majority of human disease is caused by very large numbers of G/C-rich repeats that are difficult to clone and express in an animal model either because they are often instable or because it results technically challenging to reproduce them [21, 43]. Therefore, it is possible that animal models are not able to give the desired phenotype. Hence, human C9ORF72 iPSCs provide an exceptionally valuable tool to investigate ALS/FTLD pathophysiological pathways and therapy development and could also be used to validate future in vivo disease models. RNA foci seem to cover a major role in C9ORF-ALS pathogenesis because they could be responsible for RBP sequestration [44].

Molecular Insights Made with Disease Models Recent reports have described the generation of iPSCs from patients with ALS caused by the C9ORF72 repeat expansion (C9-ALS) and their differentiation into neurons and motor neurons [21, 23]. Patient fibroblasts and iPS neurons/motor neurons contain disease-specific intranuclear GGGGCC RNA foci similar to those found in vivo [1, 21–23]. Findings about the contribution of RAN translation pathology in C9ORF72 pathogenic mechanism are controversial: Some researchers demonstrated the presence and a pathologic role of RAN in cells [21], while other groups did not detect these abnormalities [23]. These contrasting data could be due to the different cells studied by different authors (i.e., neurons vs motoneurons in the study of Donnelly et al. [21] and Sareen et al. [23], respectively), suggesting a possible cell-specific production of RAN [23]. Another possible explanation could be the use of different protocols and antibodies for the identification of RAN that probably needs to be optimized to obtain more reliable data. Moreover, another point that needs to be deepened in the near future is the possible production of RAN from the antisense transcripts [22]. There are discrepancies also in demonstrating the reduction of C9ORF72 RNA levels. Donnelly et al. showed that C9ORF72 iPSCs that exhibit the GGGGCC repeat expansion have reduced C9ORF72 RNA levels. In particular, they found a reduction in C9ORF72 V1 and V2 transcript RNA levels and likely in pre-V2 and V3 RNA in C9ORF72 ALS cells. They conclude that whether these changes in RNA correlate with endogenous protein is still uncertain, as current antibodies to C9ORF72 protein are not suitable for specific quantification [21]. On the other hand, Sareen et al. showed no RNA or protein reduction, but rather an increased transcription of the alleles with the hexanucleotide expansion [23]. C9ORF72 iPSC motor neurons were also found to be highly susceptible to glutamate toxicity, which could be a possible pathway of

ASOs: Versatile Tools to Target RNA Recent advancements in molecular therapeutic strategies are based on the use of ASOs. These molecules are short oligonucleotide sequences that are able to interfere with RNA processing/transduction in many different ways, preventing or modifying protein expression according to their morphological features and to the specific target sites, as clearly illustrated in the cartoon of Donnelly et al. [21, 45]. Through the binding with pre-RNA, they can either activate RNA degradation with the induction of RNase H or L or prevent the ligation with specific RNA-binding proteins, which is essential for RNA splicing and/or processing [45, 46]. Also, they can interfere with RNA secondary or tertiary structure [46, 47]. ASOs present different degrees of efficiency in treated cells, according to their concentration and structure as well as temperature and cell lines employed [45]. For this reason, it is often necessary to use a carrier (such as a liposome) to

Mol Neurobiol

ensure the adequate penetration of the ASOs into the cells to exploit their effects. Moreover, additional modification to ASO structure can enable a better penetration of oligonucleotides into target cells [46]. In recent works and also in the ones reviewed in this paper [21–23], structural modifications have been adopted to increase ASO stability, cell penetration, and targeting of the RNA. These modifications consist mainly in the manipulation of the phosphorothioate backbone. ASOs have been used so far for many different genetic diseases in preclinical studies and in some clinical trials. On the other hand, a particular type of ASOs, which differ from the classical form for the morpholino ring that replaces the deoxyribose moiety and for the presence of uncharged phosphorodiamidate linkage, has been discovered. These features confer to morpholino an increased stability [45]. Morpholino, for its biochemical properties, acts in a slightly different way with respect to other ASOs, mainly blocking the transduction or interfering with the RNA-binding proteins rather than degrading RNA. Whether these effects can be useful in genetic form of ALS/FTLD due to C9ORF72 mutations has to be experimentally demonstrated.

Drugs that Modulate C9ORF72 Silencing? Mechanisms of Action of Promising Experiences in Degenerative Diseases ASOs play an increasing role in neurologic disease field. They showed very positive results in preclinical experiments with Duchenne muscular dystrophy (DMD) mouse models [48]. In this context, ASOs can be used to promote a beneficial exon skipping in order to restore the in-frame reading of the dystrophin gene (which is lost with DMD mutations) with subcutaneous, intravenous, and intramuscular injections [49–51]. The dystrophin gene can present mutations along the entire extension of the gene. Therefore, the ASO approach is now on study for the most frequent hot spot dystrophin deletions [52]. Some recent disappointing results in clinical outcomes, compared to the very promising preclinical data in DMD mice, suggest that a more careful evaluation of the dose scale-up in humans, as well as of other variables in pharmacokinetic and tissue biodistribution, is crucial (http://www.clinicaltrials.gov; Phase 2b Extension Study of Ataluren (PTC124) in Duchenne/Becker Muscular Dystrophy (DMD/BMD)). Manipulation of RNA splicing is a very promising therapeutic approach for SMA, a devastating autosomal recessive neurodegenerative disease due to SMN1 mutations which causes progressive motor neuron death [52]. ASOs can mediate the inclusion of exon 7 in SMN2, a paralogue gene of SMN1, which normally produces just 10 % of full-length protein, in order to enable it to provide the normal amount of full-length SMN protein [52]. Moreover, ASOs have been used to target expanded RNA in many different diseases.

Recently, exon-skipping approach through ASOs has been proposed for SCA type 3 (SCA3) [53]. SCA3 is due to a polyglutamine expansion in the ataxin-3 protein, which is involved in proteasomal protein degradation and deubiquitination. Since an extensive downregulation of this protein could be very dangerous for the cells, ASO-mediated exon skipping of the expanded region could restore the functional protein without altering its overall levels in cells [53]. ASO technology has been extensively used also for developing a therapeutic strategy for DM1, which is due to a CTG expansion in the MBNL1 gene [54]. In particular, ASOs were able to reduce the aberrant RNA accumulation, the formation of RNA foci, the sequestration of MBNL1, and the reduction of expanded DMPK mRNAs with very promising results both in vitro and in vivo [55, 56]. Other recent examples include ASO-mediated ribonuclease H-dependent degradation of CAG repeat-containing transcripts in Huntington’s disease, with significant protein modulation in vitro and in vivo [57]. Therefore, since ASOs have already shown their potential beneficial effects in genetic disorders, and particularly in diseases that are due to aberrant RNA expansion, they could really represent a promising approach for C9ORF72-mutated ALS patients.

Identification of ASOs that Target C9 and Reduction of C9ORF72 RNA Level Considering the C9ORF72 gene structure and the strategic location of the pathogenic hexanucleotide expansion (i.e., between two exons that can be alternatively used as the first exon generating the same polypeptide), all the three groups designed two main classes of ASOs, plus some other peculiar ones [21–23], targeting a region upstream the expansion or a region downstream the expansion (Fig. 2). It was found that targeting the region downstream the pathologic expansion allowed a more pronounced downregulation of C9ORF72 RNA level (Table 1). This is because the C9ORF72 gene can be expressed in three mRNA variants with two protein isoforms [1]. Two mRNA variants contain open reading frames (ORFs) upstream of the GGGGCC expansion. Therefore, ASOs that interfere with the expansion are able to reduce just the two mRNA isoforms containing it, while the third isoform (downstream the expansion) can still be transcribed. On the other hand, ASOs blocking introns downstream the expansion can reduce the transcription of the three mRNA variant, producing a more significant downregulation of the total C9ORF72 RNA level. Rothstein’s group selected five candidate ASOs, after having screened more than 250 chimeric 2′-methoxyethyl (MOE)/DNA RNase H-active ASOs (gapmers). With respect to conventional oligonucleotides, these gapmers contain modified nucleic acid residues to induce RNase H-mediated

Mol Neurobiol Fig. 2 Schematic representation of C9ORF72 hexanucleotideexpanded gene modification with ASOs. ASOs are shown as denominated in the cited articles

degradation. ASOs were MOE/DNA-produced by ISIS targeted to both different sequences of the C9ORF72 transcript and the GGGGCCexp RNA. They also tested an ASO able to block every possible RBP interaction binding to the hexanucleotide expansion of C9ORF72 without degrading the transcript. ASOs were tested on C9ORF72 ALS patient fibroblast lines and three patient iPS-derived neuronal lines (iPSNs) [21]. They found that ASOs targeting the GGGG CCexp RNA (ASOs A–C), even as blocker or RNase H activator, were not able to reduce C9ORF72 V1 or V2 RNA levels neither in fibroblasts nor in iPSNs. On the other hand, ASOs designed to target the intronic region downstream of the repeat or exon 2 produced a significant reduction of C9ORF72 V1 and V2 RNA levels in patient fibroblasts and iPSNs [21]. Sareen et al. tested two ASOs: one designed to bind exon 2 (therefore targeting all transcripts) (ASO816), the other binding a region close to the expansion in exon 1 (therefore targeting only the transcript owing the expansion) (ASO061). ASOs were used on iPSC-derived motor neuron cultures that were obtained from a C9ORF72 ALS patient. ASO816 produced a significant decrease of C9ORF72 transcript levels (almost ~90 %). On the other hand, ASO061 produced a significant alteration in upstream exon use, with production of a higher amount of 1b compared to exon 1a (repeat-containing) transcripts, but it weakly reduced C9ORF72 transcript levels. Both ASOs are not toxic to cultured motor neurons [23]. Lagier-Tourenne et al. tested in patient fibroblasts six ASOs designed by ISIS. All of them contained 2′-O-(2methoxyethyl) modifications that increased the ASO stability with a low toxicity. Two of them (ASO1 and ASO2) targeted the region upstream the hexanucleotide expansion in intron 1. They reduced solely the transcripts containing the expansion, and therefore they produced only partially decreased levels of C9ORF72 RNA. The other four ASOs were designed to bind

downstream the expansion: They target all the C9ORF72 transcripts, and this is why they produced a significant reduction of the RNA levels (to 4–13 % of the RNA level in control untreated fibroblasts) [22]. It is difficult to say which are the best ASOs to use against C9ORF72. Indeed, even ASOs targeting region downstream the GGGGCC expansion produce more significant reduction of C9ORF72 RNA levels; as we will discuss later in the review, there is a similar decrease in RNA foci with both kinds of ASOs. Therefore, it could be preferable to use ASOs that reduce less the total RNA level, to not interfere with the other functions of the translated non-expanded protein. However, more reliable data will come from possible future tests in animal models that could reveal which ASOs are able to induce a more significant phenotypic rescue.

Therapeutic Effects of Antisense Drugs that Target C9ORF72 Gene Other than C9ORF72 RNA reduction levels, other different biological features have been studied. These primarily include particularly RNA foci levels, RNA-binding protein downregulation, and gene transcription profile (Table 1). Treatment with ASOs showed a positive effect on RNA foci, producing their reduction in fibroblasts and ALS patientderived iPSN cultures independently from RNA level, therefore with both ASOs that downregulate the overall C9ORF72 levels targeting intronic regions downstream the expansion as well as with ASOs that hybridize the transcripts containing the hexanucleotide repeat expansion [21–23]. The “cleaning effect” on RNA foci has been evaluated as the reduction of the percentage of cells that contain GGGGCCexp RNA foci as well as the number of foci per cell [21].

Cell models

ASOs

1: TACAGGCTGCGGTTGTTTCC MOE-Gapmer 2: CCCGGCCCCTAGCGCGCGAC MOE-Gapmer 3: GGTAACTTCAAACTCTTGGG MOE-Gapmer 4: GCCTTACTCTAGGACCAAGA MOE-Gapmer 5: GCCATGATTTCTTGTCTGGG MOE-Gapmer 6: GGGACACTACAAGGTAGTAT MOE-Gapmer

ASOs D–E: significant reduction of V1 and V2

Intronic region downstream of the repeat or exon 2 ASO-816: exon 2 ASO061: region in intron 1 adjacent to the repeat

Decreased electrical Not detected DPP6, CBLN1, Reduction of ASO 816: reduction excitability in CBLN2, CBLN4, even in RNA foci with of RNA of 90 % C9-ALS patientand SLITRK2 untreated both ASO816 ASO061: small derived MN cells and ASO061 decreased of RNA (but alter upstream exon use with exon 1b>1a transcript) ASOs 1–2: upstream ASO 1–2: reduce only Significantly No triggering of Not tested ACTC1, SPTAN1, neuropathological CDKN1A, reduced by all containing expansion exon 2 or behavioral GADD45A, IL33, ASOs C9ORF72 defects after ICV and FGF18 RNA injection of ASO 3–6: decrease all ASOs do not ASOs 3–6: C9ORF72-specific reduce C9ORF72 RNA downstream exons ASO in control antisense isoforms 1a and 1b mice strand foci

NEDD4L, FAM3C, Glutamate sensitivity, in vivo functional CHRDL1, SEPP1, tests and SERPINE2

Still present

Reduction (fewer effect of ASO B)

ASOs A–C: not reduction of C9ORF72 V1 or V2 RNA

GGGGCCexp

Functional outcomes

Deregulated proteins

RAN

RNA foci

RNA level

ASO targets

RAN repeat-associated non-ATG-initiated translation peptides, iPSCN induced pluripotent stem cell-derived neurons, ICV intracerebroventricular

Patient autoptic Lagiertissues and in Tourenne vivo in control et al. [20] mice

A: GCCCCGGCCCCTAGCGCGCG Donnelly ALS patient et al. [19] fibroblast and (5-10-5 2′OME, PT backbone RNase H) derived iPSNs B: CCGGCCCCGGCCCCGGCCCC (Full MOE, PT backbone Block) C: CCGCCCCGGCCCCGGCCCC (5-10-5 2′OME, PT backbone RNase H) D: GGTAACTTCAAACTCTTGGG (5-10-5 2′OME, PT backbone RNase H) E: GCCTTACTCTAGGACCAAGA (5-10-5 2′OME, PT backbone RNase H) Sareen et al. ALS patientASO-576816) GCCTTACTCTAGGACCAAGA [21] derived iPSNs ASO-577061) TACAGGCTGCGGTTGTTTCC

Reference

Table 1 Comparison between ASOs targeting C9ORF72 hexanucleotide-expanded gene used in the three cited works [19–21] and data obtained after treating cells or mice with ASOs

Mol Neurobiol

Mol Neurobiol

These data support the idea that we can obtain pathogenic RNA foci reduction without interfering with RNA levels, and this could be one of the reasons why ASO treatment is so welltolerated in treated cells. On the other hand, siRNA approach (which is aimed at destroying C9ORF72 RNA) is not able to reduce RNA foci, probably because it mainly targets cytoplasmatic RNA which is not pathogenic, without interfering with the accumulated nuclear RNA [22]. The role of sequestration of RNA-binding proteins seems to be crucial for the RNA foci in producing neurodegeneration. However, it is not clear yet which RNABPs are more implicated in these mechanisms. A significant reduction of the ADARB2 protein nuclear co-localization with RNA foci in treated iPSNs was found, as shown by immunostaining [21]. These data support the hypothesis that RNA foci act by sequestering RBPs, such as ADARB2. Therefore, reducing the number of the foci also has a positive effect on the involved BPs and the molecular mechanisms that they regulate. After ASO treatment in patient-derived iPSNs, independently from RNA level decrease, the previously more deregulated genes (NEDD4L, FAM3C, CHRDL1, SEPP1, and SERPINE2) reached normalized levels if compared to scramble-treated cells [21]. These genes could be used as efficient biomarkers in therapeutic trials, since the authors selected among the common deregulated genes in ALS patients’ postmortem tissue and iPSNs the ones that produce proteins that could be secreted in the cerebrospinal fluid (therefore being suitable to be markers to monitor potential therapies). Moreover, the authors did not observe further gene expression modifications, indicating that ASOs are welltolerated by the cell also because they do not interfere with general gene transcription [21]. Also, the RNA-seq analysis in C9-ALS motoneurons and control motoneurons revealed a significant reversal after ASO treatment of the deregulated genes in C9-ALS motoneurons compared to control, particularly of DPP6, CBLN1, CBLN2, CBLN4, and SLITRK2, with both ASO061 and ASO816 [23]. Surprisingly, after ASO treatment, Lagier-Tourenne et al. did not find the same expression profile modification reported by Svendsen’s group. They identified only six genes with significant expression changes [22]. A reason for the discrepancy in these results could be the different cells used (fibroblast for Ravits’ group and iPSNCs for Svendsen’s group) along with the different targets of ASOs. The other important findings in C9OF72mutated tissues were the RAN-initiated translation peptides. The expanded region seems to be able to start its own translation even if it is located in a non-coding gene region, generating accumulation of RNA peptides [35]. Unexpectedly, after treatment with ASOs and reduction of C9ORF72 RNA levels, RAN products were still present in C9ORF72 iPSNs [21]. It has been hypothesized that ASOs interfere with different RAN that cannot be detected with the antibodies

available up to now. Also, since RAN can be transcribed starting from both sense and antisense strands of the gene [35], it could be possible that a more positive effect on RAN levels will be achieved using a strategy able to target also the antisense strand. Since patient-derived iPSNs presented a greater susceptibility to glutamate toxicity, the possible rescue of this feature after ASO treatment has been also evaluated [21]. After incubating ASO-treated cells with glutamate, the rescue of the glutamate toxicity sensitivity with both ASOs targeting the expansion as well as with ASO hybridizing exon 2 (to levels of 30 and 16 %, respectively) was registered significantly [21]. All these observations support the therapeutic effects of the ASOs targeting C9ORF72 expansion, since most of the pathogenic markers of this mutation (i.e., RNA foci, RBP sequestration, gene expression profile modification, and glutamate sensitivity) results to be correct after such a treatment.

Pharmacokinetic and Transcriptional Effects of Antisense Oligonucleotides in Mice: Toward the Clinic To translate ASO strategy into clinical trials, it is necessary to demonstrate the tolerability of ASOs and the safety of reducing C9ORF72 RNA levels in in vivo model as well as in human being. Up until now, there are already different clinical trials using ASOs in neuromuscular diseases, particularly for DMD [48, 58]. From the interim analysis of those trials, no serious adverse events in the pediatric population have been reported. Many minor adverse events that still need to be accurately monitored are the cutaneous irritation in the region of injection and renal impairments [59]. Other clinical trials are starting, particularly for SMA, where ASOs will be administered by lumbar intrathecal injection (ISIS Pharmaceuticals http:// clinicaltrials.gov). These studies will offer significant safety data that could be considered for future trials in patients affected by ALS. Another main point that needs consideration is the tolerability of C9ORF72 ASOs in vivo. This data was studied and reported only in Lagier-Tourenne et al.’s paper in animal models. They injected a mouse-specific C9ORF72 ASO into the lateral ventricle of adult mice by a single intracerebroventricular stereotactic injection [22]. After 3 weeks, the mouse’s brain and spinal cord were analyzed. A significant reduction of C9ORF72 RNA levels was collected in the two tissues (30 % in the spinal cord and 40 % in the brain). Also, ASO was identified through a specific antibody targeting the ASO’s phosphorothioate backbone at different time points after injection throughout the CNS (particularly in the cortex, hippocampus, and spinal cord). The authors observed a prolonged suppression of C9ORF72 levels in treated animals, and there

Mol Neurobiol

were no pathogenic inclusions of TDP-43 and p62 in mice autoptic tissues [22]. No function and behavioral alterations in terms of strength, motor coordination, activity, and anxiety have been reported even after 17 weeks from the injection. Moreover, a very restricted modification in gene expression profile of treated cells was observed. Particularly, with strandspecific, genome-wide sequencing of RNAs, they identified 12 genes significantly upregulated and 12 genes downregulated. The two genes with the highest deregulation were C9ORF72 itself and cysteine-rich protein 61 gene (Cyr61) [22]. Thus, these preliminary results show that C9ORF suppression strategy could be safe and long-lasting in animal models. One main point that still needs to be defined is the best way of administration of the therapeutic ASOs. Subcutaneous injections gave positive results in animal models of DMD and restored correct dystrophin levels in muscles and heart, but ASOs have a limited or no diffusion through the blood–brain barrier [60]. Thus, intrathecal administration could provide more efficient results in neurodegenerative diseases.

Discussion The C9ORF72 gene has been recently described to be the most frequent cause of familial ALS and FTLD [1–3]. The function of this gene is still unknown. An interesting recent work demonstrated that the C9ORF72 gene is mostly expressed in those cells that are more susceptible to degeneration in ALS and FTLD (i.e., ventral horn in the spinal cord, cortical motor neurons, basal ganglia, and brain stem, with lower levels of expression in white matter) [61]. These data support the central and pathogenic role of C9ORF72 expansion in ALS and FTLD. Moreover, among different isoforms of the C9ORF2 gene, the ones that do not contain the hexanucleotide expansion (i.e., V1) seem to be more expressed in motor neurons in mouse and human autopsy [61]. Therefore, reducing expanded C9ORF72 expression could represent a really promising approach to cure these diseases. Recently, three papers have been published describing the positive results of targeting and degrading/blocking of C9ORF72 mRNA in ALS patient tissues using different kinds of ASOs [21–23] (Fig. 1; Table 1). In general, the knockdown of all C9ORF72 transcripts was able to reduce the RNA foci and was also not toxic in vitro or in vivo. Knocking down C9ORF72 to very low levels had no impact on cell survival and on mice phenotype [22]. ASOs designed to activate RNase H-mediated C9ORF72 RNA degradation or to block the toxic GGGGCCexp RNA rescued all the described pathogenic phenotypes in vitro in patient iPSC-derived motor neurons, except for RAN formation, as well as partial glutamate sensitivity [21]. Interestingly, ASOs downstream of the repeat were able to rescue some of

the observed toxic phenotypes (e.g., nuclear foci), despite the fact that RNA far downstream of the repeat, where Donnelly et al.’s ASOs D and E target, is not sequestered into C9ORF72 intranuclear GGGGCC RNA foci [21]. It is possible that ASOs might degrade the RNA very early during transcription and prior to any splicing events or foci formation, as previously described [62]. However, despite the mitigation of excitotoxicity, large reductions in RNA foci and RBP aggregation, and the normalization of expression profile mediated by ASO therapy, RAN peptide can still be detected after ASO treatment [21]. This fact suggests that detected cytoplasmic peptides were not a major contributor to neurotoxicity in Rothstein’s culture model [21]. In addition, it is important to note that it is possible that ASO treatment could rescue the formation of newly synthesized RAN peptides and that longer ASO treatment would eventually show a reduction of RAN products. Furthermore, there could be other RAN peptides, such as antisense RAN peptides, contributing to the observed phenotypes that have not been detected with the present antibodies that preferentially target the poly-(Gly-Pro) RAN product. However, a subset of ASOs very effectively reduced C9ORF72 RNA levels by more than 50 % (AOSs D and E in Donnelly et al. [21]) in human iPSNs with no toxicity for the treated cells. This strongly suggests that the loss of C9ORF72 is not a major cause of C9ORF72 ALS pathology and toxicity seen in iPSNs. The altered gene expression profiles observed in C9-ALS patient cells were improved rather than worsened by C9ORF72 knockdown with ASOs, supporting the notion that these changes are due to gain of function of the C9ORF72 repeat, rather than loss of function. Therefore, although it remains possible that the expansion leads to a small decrease in overall C9ORF72 expression, it does not appear to result in a functional deficit [21, 23]. Given that ASOs targeting the region adjacent to the C9ORF72 expansions were able to suppress just the repeat-containing RNA transcript, it may be possible to suppress the toxic effects of C9ORF72 repeat transcription (whether RNA- or protein-mediated) while avoiding potential unforeseen consequences of knocking down overall C9ORF72 levels. Importantly, treatment with ASOs that reduces sense strand containing foci did not affect the frequency of antisense strand foci, indicating that they are independent from each other. The failure to correct the RNA signature in C9ORF72 patient fibroblasts, as observed by Ravits’ group in contrast to the other two groups, after treatment with ASOs targeting only sense strand repeat-containing RNA may be explained by the unaltered accumulation of antisense RNA foci potentially disrupting the function of RNA-binding proteins [22]. Also, although genome-wide RNA profiling identified an RNA signature in C9ORF72 patient fibroblasts, ASOs targeting only sense strand repeat-containing RNAs did not correct this

Mol Neurobiol

RNA profile in the experiments of Ravits’ group. This failure may be explained again by RNA foci with C9ORF72 repeats transcribed in the antisense (GGCCCC) direction, which have been determined not to be affected by sense strand-targeting ASOs. Of immediate interest, it will be to determine the relative levels of sense and antisense transcripts in different cell types and tissues from controls and patients with C9ORF72 expansions. In addition, the development of ASOs targeting the antisense transcripts will undeniably represent a crucial step to evaluate the contribution of antisense-expanded RNAs in disease pathogenesis. Taken together, these findings support that ASO therapy to reduce hexanucleotide repeatcontaining RNAs is a rational and promising approach, but they also raise the important possibility that expanded RNAs transcribed from both directions may need to be targeted. The limited effect of C9ORF72 depletion on the expression levels of other RNAs is consistent with the tolerability of C9ORF72 reduction in the adult CNS. Regardless, the presence of sense and antisense RNA foci and the demonstration of an RNA signature linked to C9ORF72 repeat expansion that does not reflect the very modest RNA changes that accompany C9ORF72 loss of function offer strong support that RNA-mediated toxicity is a critical mechanism in the pathogenesis of ALS and FTLD caused by repeat expansions. One potential issue with ASO-mediated reduction of C9ORF72 RNAs could be exacerbating the loss of C9ORF72 function. This possibility has been mitigated by the demonstration that RNAs containing the hexanucleotide expansion can be selectively reduced, without significant reduction in overall C9ORF72 RNA levels. Moreover, even for ASOs that target both repeat- and non-repeat-containing C9ORF72 RNAs, the authors have demonstrated that reducing C9ORF72 broadly within the rodent nervous system for several months does not produce a behavioral phenotype or neuropathological abnormalities. This evidence proves that the abnormal accumulation of TDP-43, p62, and ubiquitin seen in patients with ALS and FTLD with C9ORF72 expansions is not induced by the loss of C9ORF72 function mRNA and that ASO-mediated C9ORF72 reductions should be tolerated in an adult nervous system and may be safe to use in ALS and FTLD models.

Conclusion In the last year, expansions of a GGGGCC hexanucleotide repeat in the first intron/promoter of the C9ORF72 have been identified as the major cause of familial forms of ALS and FTLD [1–3]. Recently, three main works have been published reporting the positive effects of ASOs hybridizing C9ORF72 RNA able to reduce expansion-dependent pathology including the formation of RNA foci and sequestration of RNAbinding protein, aberrant answers to neurotoxic stimuli (such

as response to excess of glutamate), and altered gene expression [21–23]. These data were supported both in vitro (in fibroblast and iPSC-derived motor neurons) and in vivo, in animal models [21–23]. Furthermore, these positive results go along with a high ASO selectivity for hexanucleotide expansion, with minimal perturbation of C9ORF72 RNA levels, thus minimizing pathology and toxicity allowing rapid translation of this approach in humans.

Conflict of Interest The authors declare that they have no conflict of interest.

References 1. DeJesus-Hernandez M, Mackenzie IR, Boeve BF, Boxer AL, Baker M, Rutherford NJ, Nicholson AM, Finch NA, Flynn H, Adamson J, Kouri N, Wojtas A, Sengdy P, Hsiung GY, Karydas A, Seeley WW, Josephs KA, Coppola G, Geschwind DH, Wszolek ZK, Feldman H, Knopman DS, Petersen RC, Miller BL, Dickson DW, Boylan KB, Graff-Radford NR, Rademakers R (2011) Expanded GGGGCC hexanucleotide repeat in noncoding region of C9ORF72 causes chromosome 9p-linked FTLD and ALS. Neuron 72:245–256 2. Renton AE, Majounie E, Waite A, Simón-Sánchez J, Rollinson S, Gibbs JR, Schymick JC, Laaksovirta H, van Swieten JC, Myllykangas L, Kalimo H, Paetau A, Abramzon Y, Remes AM, Kaganovich A, Scholz SW, Duckworth J, Ding J, Harmer DW, Hernandez DG, Johnson JO, Ryten KMK, Trabzuni D, Guerreiro RJ, Orrell RW, Neal J, Murray A, Pearson J, Jansen IE, Sondervan D, Seelaar H, Blake D, Young K, Halliwell N, Callister JB, Toulson G, Richardson A, Gerhard A, Snowden J, Mann D, Neary D, Nalls MA, Peuralinna T, Jansson L, Isoviita VM, Kaivorinne AL, Hölttä-Vuori M, Ikonen E, Sulkava R, Benatar M, Wuu J, Chiò A, Restagno G (2011) A hexanucleotide repeat expansion in C9ORF72 is the cause of chromosome 9p21-linked ALS-FTLD. Neuron 72:257–268 3. Gijselinck I, Van Langenhove T, van der Zee J, Sleegers K, Philtjens S, Kleinberger G, Janssens J, Bettens K, Van Cauwenberghe C, Pereson S, Engelborghs S, Sieben A, De Jonghe P, Vandenberghe R, Santens P, De Bleecker J, Maes G, Bäumer V, Dillen L, Joris G, Cuijt I, Corsmit E, Elinck E, Van Dongen J, Vermeulen S, Van den Broeck M, Vaerenberg C, Mattheijssens M, Peeters K, Robberecht W, Cras P, Martin JJ, De Deyn PP, Cruts M, Van Broeckhoven C (2012) A C9orf72 promoter repeat expansion in a Flanders-Belgian cohort with disorders of the frontotemporal lobar degenerationamyotrophic lateral sclerosis spectrum: a gene identification study. Lancet Neurol 11:54–65 4. Nuytemans K, Bademci G, Kohli MM, Beecham GW, Wang L, Young JI, Nahab F, Martin ER, Gilbert JR, Benatar M, Haines JL, Scott WK, Züchner S, Pericak-Vance MA, Vance JM (2013) C9ORF72 intermediate repeat copies are a significant risk factor for Parkinson disease. Ann Hum Genet. doi:10.1111/ahg.12033 5. Harms MB, Cady J, Zaidman C, Cooper P, Bali T, Allred P, Cruchaga C, Baughn M, Libby RT, Pestronk A, Goate A, Ravits J, Baloh RH (2013) Lack of C9ORF72 coding mutations supports a gain of function for repeat expansions in amyotrophic lateral sclerosis. Neurobiol Aging 34:2234.e13–2234.e19 6. Cacace R, Van Cauwenberghe C, Bettens K, Gijselinck I, van der Zee J, Engelborghs S, Vandenbulcke M, Van Dongen J, Bäumer V, Dillen L, Mattheijssens M, Peeters K, Cruts M, Vandenberghe R, De Deyn PP, Van Broeckhoven C, Sleegers K (2013) C9orf72 G4C2 repeat

Mol Neurobiol

7.

8.

9.

10. 11.

12.

13.

14.

15.

16.

17. 18.

19.

20.

expansions in Alzheimer’s disease and mild cognitive impairment. Neurobiol Aging 34:1712.e1–1712.e7 Hensman Moss DJ, Poulter M, Beck J, Hehir J, Polke JM, Campbell T, Adamson G, Mudanohwo E, McColgan P, Haworth A, Wild EJ, Sweeney MG, Houlden H, Mead S, Tabrizi SJ (2014) C9orf72 expansions are the most common genetic cause of Huntington disease phenocopies. Neurology 82(4):292–299 Chen-Plotkin AS, Lee VM, Trojanowski JQ (2010) TAR DNAbinding protein 43 in neurodegenerative disease. Nat Rev Neurol 6: 211–220 Ravits J, Appel S, Baloh RH, Barohn R, Brooks BR, Elman L, Floeter MK, Henderson C, Lomen-Hoerth C, Macklis JD, McCluskey L, Mitsumoto H, Przedborski S, Rothstein J, Trojanowski JQ, van den Berg LH, Ringel S (2013) Deciphering amyotrophic lateral sclerosis: what phenotype, neuropathology and genetics are telling us about pathogenesis. Amyotroph Lateral Scler Frontotemporal Degener 14(Suppl 1):5–18 Ferrari R, Kapogiannis D, Huey ED, Momeni P (2011) FTLD and ALS: a tale of two diseases. Curr Alzheimer Res 8(3):273–294 Ling SC, Polymenidou M, Cleveland DW (2013) Converging mechanisms in ALS and FTLD: disrupted RNA and protein homeostasis. Neuron 79(3):416–438. doi:10.1016/j.neuron. 2013.07.033 Johnson JO, Mandrioli J, Benatar M, Abramzon Y, Van Deerlin VM, Trojanowski JQ, Gibbs JR, Brunetti M, Gronka S, Wuu J, Ding J, McCluskey L, Martinez-Lage M, Falcone D, Hernandez DG, Arepalli S, Chong S, Schymick JC, Rothstein J, Landi F, Wang YD, Calvo A, Mora G, Sabatelli M, Monsurrò MR, Battistini S, Salvi F, Spataro R, Sola P, Borghero G, Galassi G, Scholz SW, Taylor JP, Restagno G, Chiò A, Traynor BJ, ITALSGEN Consortium (2010) Exome sequencing reveals VCP mutations as a cause of familial ALS. Neuron 68:857–864 Al-Chalabi A, Jones A, Troakes C, King A, Al-Sarraj S, van den Berg LH (2012) The genetics and neuropathology of amyotrophic lateral sclerosis. Acta Neuropathol 124:339–352 Neumann M, Sampathu DM, Kwong LK, Truax AC, Micsenyi MC, Chou TT, Bruce J, Schuck T, Grossman M, Clark CM, McCluskey LF, Miller BL, Masliah E, Mackenzie IR, Feldman H, Feiden W, Kretzschmar HA, Trojanowski JQ, Lee VM (2006) Ubiquitinated TDP-43 in frontotemporal lobar degeneration and amyotrophic lateral sclerosis. Science 314:130–133 Morris HR, Waite AJ, Williams NM, Neal JW, Blake DJ (2012) Recent advances in the genetics of the ALS-FTLD complex. Curr Neurol Neurosci Rep 12(3):243–250 Nlend Nlend R, Meyer K, Schümperli D (2010) Repair of pre-mRNA splicing: prospects for a therapy for spinal muscular atrophy. RNA Biol 7(4):430–440 Porensky PN, Burghes AH (2013) Antisense oligonucleotides for the treatment of spinal muscular atrophy. Hum Gene Ther 24(5):489–498 Winer L, Srinivasan D, Chun S, Lacomis D, Jaffa M, Fagan A, Holtzman DM, Wancewicz E, Bennett CF, Bowser R, Cudkowicz M, Miller TM (2013) SOD1 in cerebral spinal fluid as a pharmacodynamic marker for antisense oligonucleotide therapy. JAMA Neurol 70:201–207 Smith RA, Miller TM, Yamanaka K, Monia BP, Condon TP, Hung G, Lobsiger CS, Ward CM, McAlonis-Downes M, Wei H, Wancewicz EV, Bennett CF, Cleveland DW (2006) Antisense oligonucleotide therapy for neurodegenerative disease. J Clin Invest 116:2290–2296 Miller TM, Pestronk A, David W, Rothstein J, Simpson E, Appel SH, Andres PL, Mahoney K, Allred P, Alexander K, Ostrow LW, Schoenfeld D, Macklin EA, Norris DA, Manousakis G, Crisp M, Smith R, Bennett CF, Bishop KM, Cudkowicz ME (2013) An antisense oligonucleotide against SOD1 delivered intrathecally for patients with SOD1 familial amyotrophic lateral sclerosis: a phase 1, randomised, first-in-man study. Lancet Neurol 12(5):435–442. doi: 10.1016/S1474-4422(13)70061-9. Epub 2013 Mar 29

21. Donnelly CJ, Zhang PW, Pham JT, Heusler AR, Mistry NA, Vidensky S, Daley EL, Poth EM, Hoover B, Fines DM, Maragakis N, Tienari PJ, Petrucelli L, Traynor BJ, Wang J, Rigo F, Bennett CF, Blackshaw S, Sattler R, Rothstein JD (2013) RNA Toxicity from the ALS/FTLD C9ORF72 expansion is mitigated by antisense intervention. Neuron 80(2):415–428 22. Lagier-Tourenne C, Baughn M, Rigo F, Sun S, Liu P, Li HR, Jiang J, Watt AT, Chun S, Katz M, Qiu J, Sun Y, Ling SC, Zhu Q, Polymenidou M, Drenner K, Artates JW, McAlonis-Downes M, Markmiller S, Hutt KR, Pizzo DP, Cady J, Harms MB, Baloh RH, Vandenberg SR, Yeo GW, Fu XD, Bennett CF, Cleveland DW, Ravits J (2013) Targeted degradation of sense and antisense C9orf72 RNA foci as therapy for ALS and frontotemporal degeneration. Proc Natl Acad Sci U S A 110(47):E4530–E4539 23. Sareen D, O’Rourke JG, Meera P, Muhammad AK, Grant S, Simpkinson M, Bell S, Carmona S, Ornelas L, Sahabian A, Gendron T, Petrucelli L, Baughn M, Ravits J, Harms MB, Rigo F, Bennett CF, Otis TS, Svendsen CN, Baloh RH (2013) Targeting RNA foci in iPSC-derived motor neurons from ALS patients with a C9ORF72 repeat expansion. Sci Transl Med 5(208):208ra–149 24. Majounie E, Renton AE, Mok K, Dopper EG, Waite A, Rollinson S, Chiò A, Restagno G, Nicolaou N, Simon-Sanchez J, van Swieten JC, Abramzon Y, Johnson JO, Sendtner M, Pamphlett R, Orrell RW, Mead S, Sidle KC, Houlden H, Rohrer JD, Morrison KE, Pall H, Talbot K, Ansorge O, Hernandez DG, Arepalli S, Sabatelli M, Mora G, Corbo M, Giannini F, Calvo A, Englund E, Borghero G, Floris GL, Remes AM, Laaksovirta H, McCluskey L, Trojanowski JQ, Van Deerlin VM, Schellenberg GD, Nalls MA, Drory VE, Lu CS, Yeh TH, Ishiura H, Chromosome 9-ALS/FTLD Consortium, French research network on FTLD/FTLD/ALS, ITALSGEN Consortium (2012) Frequency of the C9orf72 hexanucleotide repeat expansion in patients with amyotrophic lateral sclerosis and frontotemporal dementia: a cross-sectional study. Lancet Neurol 11(4):323–330 25. Brouwer JR, Willemsen R, Oostra BA (2009) Microsatellite repeat instability and neurological disease. Bioessays 31:71–83 26. Pearson CE, Nichol Edamura K, Cleary JD (2005) Repeat instability: mechanisms of dynamic mutations. Nat Rev Genet 6:729–742 27. Todd PK, Paulson HL (2010) RNA-mediated neurodegeneration in repeat expansion disorders. Ann Neurol 67:291–300 28. Wojciechowska M, Krzyzosiak WJ (2011) Cellular toxicity of expanded RNA repeats: focus on RNA foci. Hum Mol Genet 20(19):3811–3821 29. Mori K, Weng SM, Arzberger T, May S, Rentzsch K, Kremmer E, Schmid B, Kretzschmar HA, Cruts M, Van Broeckhoven C, Haass C, Edbauer D (2013) The C9orf72 GGGGCC repeat is translated into aggregating dipeptide-repeat proteins in FTLD/ALS. Science 339: 1335–1338 30. Ash PE, Bieniek KF, Gendron TF, Caulfield T, Lin WL, DejesusHernandez M, van Blitterswijk MM, Jansen-West K, Paul JW III, Rademakers R, Boylan KB, Dickson DW, Petrucelli L (2013) Unconventional translation of C9ORF72 GGGGCC expansion generates insoluble polypeptides specific to c9FTD/ALS. Neuron 77: 639–646 31. Ciura S, Lattante S, Le Ber I, Latouche M, Tostivint H, Brice A, Kabashi E (2013) Loss of function of C9orf72 causes motor deficits in a zebrafish model of amyotrophic lateral sclerosis. Ann Neurol. doi:10.1002/ana.23946 32. Xi Z, Zinman L, Moreno D, Schymick J, Liang Y, Sato C, Zheng Y, Ghani M, Dib S, Keith J, Robertson J, Rogaeva E (2013) Hypermethylation of the CpG island near the G4C2 repeat in ALS with a C9orf72 expansion. Am J Hum Genet 92:981–989 33. Fratta P, Poulter M, Lashley T, Rohrer JD, Polke JM, Beck J, Ryan N, Hensman D, Mizielinska S, Waite AJ, Lai MC, Gendron TF, Petrucelli L, Fisher EM, Revesz T, Warren JD, Collinge J, Isaacs AM, Mead S (2013) Homozygosity for the C9orf72 GGGGCC

Mol Neurobiol

34.

35.

36.

37.

38.

39.

40.

41.

42.

43.

44.

45. 46.

47.

48.

repeat expansion in frontotemporal dementia. Acta Neuropathol 126: 401–409 Harms M, Benitez BA, Cairns N, Cooper B, Cooper P, Mayo K, Carrell D, Faber K, Williamson J, Bird T, Diaz-Arrastia R, Foroud TM, Boeve BF, Graff-Radford NR, Mayeux R, Chakraverty S, Goate AM, Cruchaga C, NIA-LOAD/NCRAD Family Study Consortium (2013) C9orf72 hexanucleotide repeat expansions in clinical Alzheimer disease. JAMA Neurol 70:736–741 Zu T, Liu Y, Bañez-Coronel M, Reid T, Pletnikova O, Lewis J, Miller TM, Harms MB, Falchook AE, Subramony SH, Ostrow LW, Rothstein JD, Troncoso JC, Ranum LP (2013) RAN proteins and RNA foci from antisense transcripts in C9ORF72 ALS and frontotemporal dementia. Proc Natl Acad Sci USA Nov 18. [Epub ahead of print] Kim HJ, Kim NC, Wang YD, Scarborough EA, Moore J, Diaz Z, MacLea KS, Freibaum B, Li S, Molliex A, Kanagaraj AP, Carter R, Boylan KB, Wojtas AM, Rademakers R, Pinkus JL, Greenberg SA, Trojanowski JQ, Traynor BJ, Smith BN, Topp S, Gkazi AS, Miller J, Shaw CE, Kottlors M, Kirschner J, Pestronk A, Li YR, Ford AF, Gitler AD, Benatar M, King OD, Kimonis VE, Ross ED, Weihl CC, Shorter J, Taylor JP (2013) Mutations in prion-like domains in hnRNPA2B1 and hnRNPA1 cause multisystem proteinopathy and ALS. Nature 495: 467–e473 Calini D, Corrado L, Del Bo R, Gagliardi S, Pensato V, Verde F, Corti S, Mazzini L, Milani P, Castellotti B, Bertolin C, Sorarù G, Cereda C, Comi GP, D’Alfonso S, Gellera C, Ticozzi N, Landers JE, Ratti A, Silani V, The SLAGEN Consortium (2013) Analysis of hnRNPA1, A2/B1, and A3 genes in patients with amyotrophic lateral sclerosis. Neurobiology of Aging 2695.e11e2695.e12 Kwak S, Nishimoto Y, Yamashita T (2008) Newly identified ADAR-mediated A-to-I editing positions as a tool for ALS research. RNA Biol 5(4):193–197 Nishimoto Y, Yamashita T, Hideyama T, Tsuji S, Suzuki N, Kwak S (2008) Determination of editors at the novel A-to-I editing positions. Neurosci Res 61:201–206 Hideyama T, Yamashita T, Aizawa H, Tsuji S, Kakita A, Takahashi H, Kwak S (2012) Profound downregulation of the RNA editing enzyme ADAR2 in ALS spinal motor neurons. Neurobiol Dis 45(3):1121–1128 Kuner R, Groom AJ, Bresink I, Kornau HC, Stefovska V, Müller G, Hartmann B, Tschauner K, Waibel S, Ludolph AC, Ikonomidou C, Seeburg PH, Turski L (2005) Late-onset motoneuron disease caused by a functionally modified AMPA receptor subunit. Proc Natl Acad Sci U S A 102:5826–5831 Kawahara Y, Ito K, Sun H, Aizawa H, Kanazawa I, Kwak S (2004) Glutamate receptors: RNA editing and death of motor neurons. Nature 427:801 Almeida S, Gascon E, Tran H, Chou HJ, Gendron TF, Degroot S, Tapper AR, Sellier C, Charlet-Berguerand N, Karydas A, Seeley WW, Boxer AL, Petrucelli L, Miller BL, Gao FB (2013) Modeling key pathological features of frontotemporal dementia with C9ORF72 repeat expansion in iPSC-derived human neurons. Acta Neuropathol 126(3):385–399 Echeverria GV, Cooper TA (2012) RNA-binding proteins in microsatellite expansion disorders: mediators of RNA toxicity. Brain Res 1462:100–111 Dias N, Stein CA (2002) Antisense oligonucleotides: basic concepts and mechanisms. Mol Cancer Ther 1:347–355 Bennett CF, Swayze EE (2010) RNA targeting therapeutics: molecular mechanisms of antisense oligonucleotides as a therapeutic platform. Annu Rev Pharmacol Toxicol 50:259–293 Kole R, Krainer AR, Altman S (2012) RNA therapeutics: beyond RNA interference and antisense oligonucleotides. Nat Rev Drug Discov 11(2):125–140 Aoki Y, Yokota T, Wood MJ (2013) Development of multiexon skipping antisense oligonucleotide therapy for Duchenne muscular dystrophy. Biomed Res Int 2013:402369

49. Lu QL, Mann CJ, Lou F, Bou-Gharios G, Morris GE, Xue SA, Fletcher S, Partridge TA, Wilton SD (2003) Functional amounts of dystrophin produced by skipping the mutated exon in the mdx dystrophic mouse. Nat Med 9:1009–1014 50. Lu QL, Rabinowitz A, Chen YC, Yokota T, Yin H, Alter J, Jadoon A, Bou-Gharios G, Partridge T (2005) Systemic delivery of antisense oligoribonucleotide restores dystrophin expression in body-wide skeletal muscles. Proc Natl Acad Sci U S A 102:198–203 51. Heemskerk H, de Winter C, van Kuik P, Heuvelmans N, Sabatelli P, Rimessi P, Braghetta P, van Ommen GJ, de Kimpe S, Ferlini A (2010) Preclinical PK and PD studies on 2′-O-methyl-phosphorothioate RNA antisense oligonucleotides in the mdx mouse model. Mol Ther 18:1210–1217 52. Douglas AG, Wood MJ (2013) Splicing therapy for neuromuscular disease. Mol Cell Neurosci 56:169–185 53. Evers MM, Tran HD, Zalachoras I, Pepers BA, Meijer OC, den Dunnen JT, van Ommen GJ, Aartsma-Rus A, van Roon-Mom WM (2013) Ataxin-3 protein modification as a treatment strategy for spinocerebellar ataxia type 3: removal of the CAG containing exon. Neurobiol Dis 58:49–56 54. Gao Z, Cooper TA (2013) Antisense oligonucleotides: rising stars in eliminating RNA toxicity in myotonic dystrophy. Hum Gene Ther 24(5):499–507 55. Mulders SA, van den Broek WJ, Wheeler TM, Croes HJ, van KuikRomeijn P, de Kimpe SJ, Furling D, Platenburg GJ, Gourdon G, Thornton CA, Wieringa B, Wansink DG (2009) Triplet-repeat oligonucleotide-mediated reversal of RNA toxicity in myotonic dystrophy. Proc Natl Acad Sci U S A 106(33):13915–13920 56. González-Barriga A, Mulders SA, van de Giessen J, Hooijer JD, Bijl S, van Kessel ID, van Beers J, van Deutekom JC, Fransen JA, Wieringa B, Wansink DG (2013) Design and analysis of effects of triplet repeat oligonucleotides in cell models for myotonic dystrophy. Mol Ther Nucleic Acids 2: e81 57. Ostergaard ME, Southwell AL, Kordasiewicz H, Watt AT, Skotte NH, Doty CN, Vaid K, Villanueva EB, Swayze EE, Frank Bennett C, Hayden MR, Seth PP (2013) Rational design of antisense oligonucleotides targeting single nucleotide polymorphisms for potent and allele selective suppression of mutant Huntingtin in the CNS. Nucleic Acids Res 41(21):9634–9650 58. Anthony K, Feng L, Arechavala-Gomeza V, Guglieri M, Straub V, Bushby K, Cirak S, Morgan J, Muntoni F (2012) Exon skipping quantification by quantitative reverse-transcription polymerase chain reaction in Duchenne muscular dystrophy patients treated with the antisense oligomer eteplirsen. Hum Gene Ther Methods 23(5):336– 345 59. Goemans NM, Tulinius M, van den Akker JT, Burm BE, Ekhart PF, Heuvelmans N, Holling T, Janson AA, Platenburg GJ, Sipkens JA, Sitsen JM, Aartsma-Rus A, van Ommen GJ, Buyse G, Darin N, Verschuuren JJ, Campion GV, de Kimpe SJ, van Deutekom JC (2011) Systemic administration of PRO051 in Duchenne’s muscular dystrophy. N Engl J Med 364(16):1513–1522 60. Tanganyika-de Winter CL, Heemskerk H, Karnaoukh TG, van Putten M, de Kimpe SJ, van Deutekom J, Aartsma-Rus A (2012) Long-term exon skipping studies with 2’-O-methyl phosphorothioate antisense oligonucleotides in dystrophic mouse models. Mol Ther Nucleic Acids 1:e44 61. Suzuki N, Maroof AM, Merkle FT, Koszka K, Intoh A, Armstrong I, Moccia R, Davis-Dusenbery BN, Eggan K (2013) The mouse C9ORF72 ortholog is enriched in neurons known to degenerate in ALS and FTLD. Nat Neurosci 16(12): 1725–1727 62. Rigo F, Hua Y, Krainer AR, Bennett CF (2012) Antisensebased therapy for the treatment of spinal muscular atrophy. J Cell Biol 199(1):21–25