Clin Genet 2014 Printed in Singapore. All rights reserved
© 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd CLINICAL GENETICS doi: 10.1111/cge.12344
Short Report
Founder mutation for Huntington disease in Caucasus Jews Melamed O., Behar D.M., Bram C., Magal N., Pras E., Reznik-Wolf H., Borochowitz Z.U., Davidov B., Mor-Cohen R., Baris H.N. Founder mutation for Huntington disease in Caucasus Jews. Clin Genet 2014. © John Wiley & Sons A/S. Published by John Wiley & Sons Ltd, 2014 Huntington disease (HD), an autosomal dominant disorder involving HTT , is characterized by chorea, psychiatric illness and cognitive decline. Diagnosis and age of onset depend on the degree of expansion of the trinucleotide CAG repeat within the gene. The prevalence of HD is known for Europeans but has not been studied in the Israeli population. Between 2006 and 2011 we diagnosed in our adult genetics clinic ten HD probands, nine of whom were Caucasus Jews (CJ) (Azerbaijani), and one Ashkenazi Jewish. We performed haplotype analysis to look for evidence of a founder mutation, and found that of the nine CJ, eight shared the same haplotype that was compatible with the A1 haplogroup. We calculated the coalescence age of the mutation to be between 80 and 150 years. Ninety percent of our HD patients are CJ, as are 27% of the HD patients in Israel, although the CJ comprise only 1.4% of the Israeli population. Our findings suggest a higher prevalence of HD among CJ compared to the general Israeli population and are consistent with a recent founder mutation. We recommend a higher degree of suspicion for HD in CJ with subtle clinical findings. Conflict of interest
The authors have declared that there are no conflicts of interest.
O. Melameda,† , D. M. Behara,b,† , C. Bramc , N. Magala , E. Prasd,e , H. Reznik-Wolfd , Z. U. Borochowitzf,g , B. Davidova , R. Mor-Cohene,h and H. N. Barisa,e a The Raphael Recanati Genetic Institute, Rabin Medical Center, Beilinson Hospital, Petah Tikva, Israel, b Molecular Medicine Laboratory, Rambam Health Care Campus, Haifa, Israel, c Van Leer Institute, Jerusalem and James Madison College of Public Affairs, Michigan State University, East Lansing, MI, USA, d The Danek Gartner Institute of Human Genetics, Sheba Medical Center, Tel Hashomer, Israel, e Sackler Faculty of Medicine, Tel Aviv University, Tel Aviv, Israel, f The Simon Winter Institute for Human Genetics, Bnai-Zion Medical Center, Haifa, Israel, g Rappaport Faculty of Medicine and Research Institute, Technion-Israeli Institute of Technology, Haifa, Israel, and h Amalia Biron Research Institute of Thrombosis and Hemostasis, Sheba Medical Center, Tel Hashomer, Israel † These authors contributed equally to this work.
Key words: Caucasus Jews – founder mutation – haplotype – Huntington disease Corresponding author: Hagit Baris, MD, The Raphael Recanati Genetic Institute, Rabin Medical Center, Beilinson Hospital, 49100 Petah Tikva, Israel Tel.: +972 3 9377659; fax: +972 3 9377660; e-mail: [email protected] Received 1 October 2013, revised and accepted for publication 6 January 2014
1
Melamed et al. Huntington disease (HD [MIM 143100]) is a neurodegenerative autosomal dominant disorder characterized by involuntary movements (chorea), psychiatric illness, memory loss and cognitive decline (1). The protein Huntingtin is encoded by HTT (also called IT15 ), which is responsible for causing HD. The diagnosis and the age of onset are determined by the degree of expansion of the trinucleotide CAG repeats within the gene (2). The mutated HTT allele in HD patients contains a minimum of 36 CAG repeats. An allele with 27–35 repeats is unstable, and the offspring of such carriers are at risk of expansion to the HD zone, especially when transmitted by the father (3, 4). The prevalence of HD varies among different populations and is highest in USA and Western Europe; 4–8:100,000 (5). The aims of our study were to estimate the prevalence of HD among the various Israeli communities, and to identify the haplotype containing the mutation. Methods Clinical data
Following approval from the Rabin Medical Center Institutional Review Board committee, we reviewed the clinical and genetic data of all HD patients referred to the adult genetics clinic of the Rabin Medical Center, Petah Tikva, Israel, which is a large tertiary medical center, between the years 2006 and 2011. Mutation detection
The mutation was detected by direct amplification of the repeating HTT segment, using the primers: 5 -ATGA AGGCCTTCGAGTCCCTCAAGTCCTTC-3 and 5 GGCGGTGGCGGCTGTTGCTGCTGCTGCTGC-3 . The reaction was carried out in a 25 μl reaction volume containing 50 ng of DNA, 13.4 ng of each primer, and 1.5 mM dNTP’s, in 1.5 mM MgCl2 PCR buffer, with 1.2 U of Taq polymerase (Bio-Line, London, UK). After an initial denaturation of 5 min at 95◦ C, 30 cycles were performed (94◦ C for 30 s, 65◦ C for 45 s, and 72◦ C for 30 s), followed by a final extension of 10 min at 72◦ C. The amplification products were viewed on an ABI 3100 Genetic Analyzer (Applied Biosystems, Grand Island, NY). Haplotype analysis
Samples were collected from 11 individuals clinically diagnosed with HD and from 31 random control individuals of Caucasus Jewish origin from the general population. DNA was purified from peripheral blood leukocytes using standard protocols. The haplotype surrounding HTT was defined in the patients and controls by eight polymorphic markers using the ABI 3130 genetic analyzer (Applied Biosystems) with PCR products marked by fluorescent primers. Table 1 shows the primers used. To further define the HD haplotype we sequenced eight single nucleotide polymorphisms (SNPs)
2
surrounding HTT in all the HD patients. The SNPs were chosen by their ability to discriminate between the HTT region haplotypes based on Warby et al. 2009 (6) (Fig. 1). The SNPs were analyzed by direct sequencing using ABI 3130 genetic analyzer (Applied Biosystems). Phasing was performed manually and therefore was inferred. The common haplotype was phased based on HD102 and HD111, siblings who inherited the CAG expanded haplotype from their HD-affected deceased father and different alleles from their healthy mother, who was not available for genotyping. Dating the founder mutation and relatedness of ancestors
Dating the founder mutation in Caucasus Jews (CJ) was carried out using the dmle+2.0 software program (www.dmle.org) (7, 8). It was based on the following parameters: (1) genotypes of polymorphic markers in 62 control chromosomes and haplotypes of eight chromosomes carrying the mutation. (2) Map distances between markers and the mutation taken from the human genome working draft GRch37/hg19. (3) The growth rate (r) of the CJ estimated from the equation: T 1 = T 0 e (gr) , where T 1 is the estimated size of the CJ population in the world at the present time (120,000–140,000) (9–11), T 0 is the estimated size of the ancestral population, i.e. ∼10,000–15,000 in the 17th century (12), and g is the number of generations between T 1 and T 0 assuming 20 years per generation. The calculation yielded a growth rate of 0.118. (4) The estimated allele frequency of the founder HTT mutation in the general CJ population based on the estimated number of CJ HD patients in Israel and a total of 105,000–120,000 CJ in Israel (C. Bram and M. Sicron: personal communication 17 January 2013) (13–15). Given the strong founder effect previously suggested for CJ (16, 17), we tested for cryptic relatedness among our patients at the whole genome level using the Illumina HumanOmniExpress BeadChip array composed of ∼730 K SNPs (Illumina, San Diego, CA). Genotyping was performed following the manufacturer’s directions. Data were evaluated and analyzed using Illumina’s genomestudio v2011.1. The recent ancestry was estimated by measuring the total size of identical by descent (IBD) shared segments between all pairs of HD patients when a segment is defined by a minimum of 500 consecutive SNPs in a raw on the OMNI BeadChip providing it is no less than 1 cM as taken from HapMap. Results Patients
Between the years 2006 and 2011, 1,400 patients were referred to the adult genetics clinic at our center. A total of 11 patients from 10 different families were diagnosed with HD. Of ten probands, nine were of CJ origin and one was of Ashkenazi Jewish ancestry. Table 2 gives the detailed clinical and genetic data of the patients. The average age of onset of symptoms was 45 years (range:
Founder mutation in HTT in Caucasus Jews Table 1. List of the primers used to detect the polymorphic markers. Marker
hg19 location (base)
Forward
Reverse
D4S3038 17 × TG 40 × AC D4S1614 HTT D4S412 D4S3023 D4S2925 D4S2285
10998981100210 1881552–1881586 1953171–1953251 2646545–2646878 3076408–3245687 3380692–3381012 4301335–4301697 4893183–4893399 5103989–5104325
GAAGACCAGCATTCGG TCACCCGTGTTCAGTGAGAG CCTGGGATTGAGTTGTCTCC CATCTAGGAGAATCAGTACTTGG
GGTTTAATACACAGTAATTGTTCA CCACAGAACAGAGCGTCAAA AAAACAGGCCTAGCACCTCA TTACCATGAGCATATTTCCA
ACTACCGCCAGGCACT ACCTCACTGGAAACTAAATGG TCAGAAACCCCTACAGGAAA ATGAGCTCCTCTGAGAGG
CTAAGATATGAAAACCTAAGGGA TGAACAGCAGCGGTCT TTTGATGAGTTATTCGGAGG GGAAAGAGGGCAAGACTC
HTT
HTT
Haplogroup D4S3038 17xTG 40xAC D4S1614 rs2857936 rs12506200 rs762855 rs3856973 rs363102 rs363096 rs2276881 rs362307 D4S412 D4S3023 D4S2925 D4S2285
Haplogroup D4S3038 17xTG 40xAC D4S1614 rs2857936 rs12506200 rs762855 rs3856973 rs363102 rs363096 rs2276881 rs362307 D4S412 D4S3023 D4S2925 D4S2285
HD101 A1/C 223 221 161 155 173 183 143 141 C T G G A G G A A A T C G G T C 241 235 141 149 148 148 293 289
HD106 A1/A2 223 221 161 155 173 179 143 145 C C G G A A G G A G T C G G T C 241 243 141 143 148 148 293 269
HD102 A1/A4 223 221 161 151 173 159 143 145 C C G G A A G G A A T T G G T C 241 237 141 143 148 150 293 269
HD107 A2/C 217 205 155 153 169 167 143 145 C C G G A G G A A G C C G G C C 237 243 141 143 146 150 289 269
HD103 A1/C 217 219 151 157 173 181 143 141 C T G A A G G A A A T C G G T C 241 235 141 141 148 146 293 289
HD108 A2/C 221 219 157 155 185 165 139 145 C T G G A G G A A G C C G G C C 235 247 141 143 148 146 293 297
HD104 A1/C 223 203 161 157 173 173 143 143 C C G G A G G A A A T C G G T C 241 241 141 141 148 146 293 289
HD109 A1/C 223 217 161 159 173 163 143 145 C T G A A G G A A A T C G G T C 241 241 141 141 148 146 293 297
HD110 A1/C 223 217 161 153 173 167 143 143 C C G A A G G A A A T C G G T C 241 243 141 141 148 146 293 289
HD105 A1/C 223 219 161 157 173 169 143 141 C C G G A G G A A G T C G G T C 241 241 141 141 148 148 273 289
HD111 A1/C 223 217 161 157 173 173 143 143 C C G G A G G A A A T C G G T C 241 241 141 141 148 148 293 289
Fig. 1. Analysis of the patients’ haplotypes around HTT using eight polymorphic markers and eight SNPs. The blackened haplotype represents the shared region. The coordinates of the markers are according to assembly hg19 from telomere (top) to centromere (bottom). HD103 marks the telomeric boundary (black arrowhead) and HD105 marks the centromeric boundary (white arrowhead) of the shared haplotype. HD102 and HD111 are siblings who inherited the common haplotype from their affected father and different alleles from their healthy mother. The SNPs define the haplogroups. The common haplotype is consistent with haplogroup A1, however HD107 and HD108 have haplogroup A2.
29–61 years). There were no statistically significant differences between the genders. The average age of genetic diagnosis was 55 years (range: 36–68 years). The number of CAG repeats expanded to between 39 and 50. There was a mean gap of 6.9 years between onset of symptoms and confirmation of the diagnosis (HD). Haplotype analysis
Analysis of the patients’ haplotypes around HTT revealed that eight of the nine CJ HD patients shared
an extended haplotype based on the eight markers; this haplotype was found in 1 of 62 chromosomes of CJ in the general population. The 3.74 Mb shared haplotype is located 1.71 Mb upstream and 1.86 Mb downstream from HTT (Fig. 1). Individual HD108, who is of Ashkenazi Jewish origin, had a different haplotype, as did individual HD107, who is CJ. The specific HD haplogroups were assessed using eight SNP’s and revealed that the shared haplotype is compatible with the HD susceptible A1 haplogroup, although phasing was performed manually and therefore was inferred (Fig. 1). We could not exclude the A4
3
4
M M
F F
M
M M
F
F F
F
HD101 HD102
HD103 HD104
HD105
HD106 HD107
HD108
HD109 HD110
HD111 (sister of HD102)
CJ
CJ CJ
AJ
CJ CJ
CJ
CJ CJ
CJ CJ
Ethnicity
46 34 (Dep – 29, schiz – 34) 40
64
50 60
63
29 56–60
49 35
50
52 49
68
55 65
66
36 64
55 44
Age of genetic diagnosis
10
6 15
4
5 5
3
7 4–8
6 9
Delay in diagnosis (in years)
Cognitive and memory decline + +
+ −
+
+ + − + +
+
Involuntary movements + +
+ +
+
+ + + + +
+
Aggressive responses
Depression Depression, schizophrenia
Depression
Mood changes, anger Mood changes
Depression
Depression Depression and upset mood
Depression Aggressive responses
Psychiatric complaints
n/a
n/a Global cerebral atrophy, symmetric putamen nuclei atrophy, low signal of Globus Pallidus Cerebral atrophy Diffuse hyperintense T2 changes in centrum semiovale and hemispheres, compatible with ischemic changes Moderate dilation of ventricles, mild periventricular Hyperintensity in flair and T2 n/a MRI n/a, brain CT – mild cerebral atrophy MRI n/a, brain CT – cerebral atrophy n/a normal
Brain MRI
43, 18
41, 15 43, 18
39, 15
42, 24 40, 16
40, 17
50, 17 40, 18
42, 16 45, 17
No. of CAG repeats
AJ, Ashkenazi Jews; CJ, Caucasus Jews; Dep, depression; F, female; HD, Huntington; Hx, history; ID, identification; M, male; MRI, magnetic resonance imaging; schiz, schizophrenia.
M/F
Patient ID
Age of onset
Table 2. Clinical and genetic information of the observed mutations
+
Neg Neg
+
Father
/ /
Father
Mother ?
Mother
+
+ ?
Father ?
Mother Father
Parent of HD origin
+ +
+ +
Family Hx
Melamed et al.
Founder mutation in HTT in Caucasus Jews (a) 0.045 0.04 0.035
frequency
haplogroup, because all eight patients with the shared haplotype were heterozygous for rs362307 (C/T), meaning that their haplotypes could be compatible with either the A1 or the A4 alleles. However, the A4 allele seems very unlikely, because it would force the ‘T’ allele at rs362307 onto the non-expanded chromosome, making it an unknown haplotype, rather than the common ‘C’ haplotype on non-expanded chromosomes. The CAGexpansion in HD107 and HD108 was assumed to be on the HD A2 haplogroup.
0.03 0.025 0.02 0.015 0.01 0.005 0 0
10
20
30
40
Discussion
HD is one of the most devastating neurodegenerative diseases. Its prevalence is highest in the USA and Western Europe (4–8 cases per 100,000 individuals) (5). Jewish immigrants constitute the majority of Israeli society and we expected the prevalence of HD to be equal among the various ethnicities. However, we noted that the CJ HD patients comprise 90% of HD patients in our genetics clinic and 27% of the HD patients in Israel, even though the CJ account for only 1.4% of the Israeli population (the total Israeli population is based on the 2011 Israeli Central Bureau of Statistics). In Israel the CJ are a small and closely related population of 105,000–120,000 who are scattered around all parts of the country, with the majority concentrated mostly in the periphery. The CJ who live in the center of Israel are served by our genetics clinic. In the literature there are reports of a high prevalence of HD in Azerbaijan, which was one of the countries where the CJ’s resided during the Diaspora (20); however, we were unable to find a comprehensive molecular study in
60
70
80
90
100 110
Peak:4.3 generations (95% CS 0.8-27.8)
(b)
0.03 0.025
frequency
To date the coalescence age of the founder HTT mutation in the CJ population we used the dmle + 2.0 program based on the parameters described in the methods. On the basis of an estimate of 66 CJ HD patients out of a total of 245 HD patients diagnosed in the two HD diagnostic laboratories in Israel and ∼112,500 CJ in Israel, we calculated the allele frequency of the founder mutation to be 0.000293. However, we know that HD is frequently misdiagnosed (18, 19), and therefore for our calculation we also doubled the actual number of patients to compensate for the under-diagnosis. We estimated that the mutation occurred 4.3–7.6 generations ago, corresponding to 80–150 years ago (Fig. 2). For estimation of relatedness at the whole genome level we studied the total and largest IBD haplotype segments shared by our patients and as inferred from ∼730 K SNPs genotypes available from the BeadChip platform. HD108 showed no evidence of recent ancestry within the last six generations and was actually predicted to be of Ashkenazi ancestry. HD102 and HD111 showed a relatedness pattern compatible with a parent/child or full sibling pattern. All other comparisons suggested the individuals to be first to fifth degree relatives.
50
generations
Dating the founder mutation and estimation of relatedness
0.02 0.015 0.01 0.005 0 0
10
20
30
40
50
60
70
80
90
100 110
generations
Peak:7.6 generations (95% CS 1.8-34.5)
Fig. 2. The posterior probability densities of the founder mutation age (in generations) estimated by the dmle program based on 66 (A) and 130 (B) Caucasus Jews (CJ) Huntington disease (HD) patients. The vertical broken line represents the age value that had the highest probability (peak). The 95% credible set (CS) of values for each posterior density is indicated.
this population. We conducted this clinical and genetic study in order to expand our knowledge of HD in the CJ population. Statistics based on CJ population size should be regarded with caution because tracing the demographic characteristics of CJ is a difficult task (21) and there is no official census count. One estimate by Nikolas Witsen put the size of the original CJ population at the end of the 17th century at about 15,000 (12). There is evidence that some Jews converted to Islam, and it is probable that many also left the region altogether (21). Taking all these statistics together, we suggest that an approximate figure of 10,000–15,000 was the probable size of the original CJ population at the end of the 17th century, because it is probable that only a part of the population survived or kept their Jewish identity (21). The clinical characteristics of our HD patients are shown in Table 2. There is a mean of 6.9 years’ delay in the diagnosis of HD in our patients; this is probably a result of the frequent misdiagnosis of these patients, which is known to be a problem (18, 19). In one extreme case, patient HD110, there was a 15 year delay between a schizophrenic episode and the diagnosis of HD. This case shows the need for a high level of awareness of the higher prevalence of HD among CJ.
5
Melamed et al. The molecular analysis of the HTT locus in our cohort of HD patients showed a common founder haplotype in 8 of the 10 probands (Fig. 1), a second haplotype in the AJ patient (HD108), and, surprisingly, a third haplotype in another CJ HD patient (HD107). The shared CJ HD haplotype is 3.74 Mb long and HTT is located approximately in the middle. By dating this founder mutation we found that it is of recent origin occurring 80–150 years ago. In a further study for ancestry relatedness among our CJ patients we found them to be first to fifth degree relatives. This is compatible with the suggested demographics of the population and molecularly attests to a strong founder effect, isolation, and the probable high level of inbreeding of the CJ. It is also concordant with the recent origin of the mutation. It has been suggested that many factors contribute to CAG instability (6). Warby et al. proposed the predisposing haplogroup model, where certain haplotypes surrounding HTT are predisposed to CAG expansion based on genetic cis-elements and trans-factors, whereas other haplogroups are more stable (6, 22). It was shown that the A1 and A2 haplogroups are more prevalent in HD patients, suggesting that chromosomes harboring these haplogroups are more susceptible to CAG-expansion (6). To study this further in our CJ HD patients, we analyzed all the HD patients using SNPs known to have discriminatory power between the various HD haplogroups. In the common CJ haplotype we could not differentiate between the A1 and A4 haplogroups because all the patients were heterozygous for rs362307 (C/T); however, the A1 allele is more probable as it allows the non-expanded chromosome to be a ‘C’ haplotype rather than an unknown allele (Fig. 2). This is also supported by Warby et al. (6), who showed that a cluster of similar haplotypes (haplotype A) is present on 95% of HD chromosomes, where the majority of these (55%) could be classified as the A1 allele and the A4 allele was almost absent from the expanded CAG chromosomes. Both patients HD107 and HD108, who did not harbor the common CJ haplotype, have haplogroup A2, which is the second most common risk allele. Conclusion
In view of our finding of a founder mutation that causes a higher prevalence of HD among CJ compared to the general population in Israel and the documented average delay of around 7 years to diagnosis, we want to raise awareness among physicians of HD in this unique CJ population. This will enable earlier diagnosis allowing for prenatal evaluation and possible preimplantation genetic diagnosis when desired, and when specific and effective treatment becomes available, early initiation of such treatment. Acknowledgments The authors thank Prof. Moshe Frydman and Dr Israela Lerer for their help with the manuscript, Prof. Moshe Sicron for his
6
assistance in calculating the CJ population size and Dr Gabrielle J. Halpern for her editorial assistance.
References 1. Roos RA. Huntington’s disease: a clinical review. Orphanet J Rare Dis 2010: 5 (1): 40. 2. Andrew SE, Goldberg YP, Kremer B et al. The relationship between trinucleotide (CAG) repeat length and clinical features of Huntington’s disease. Nat Genet 1993: 4 (4): 398–403. 3. Semaka A, Creighton S, Warby S, Hayden MR. Predictive testing for Huntington disease: interpretation and significant of intermediate alleles. Clin Genet 2006: 70 (4): 283–294. 4. Telenius H, Kremer HP, Theilmann J et al. Molecular analysis of juvenile Huntington disease: the major influence on (CAG)n repeat length is the sex of the affected parent. Hum Mol Genet 1993: 2 (10): 1535–1540. 5. Harper PS. The epidemiology of Huntington’s disease. Hum Genet 1992: 89 (4): 365–376. 6. Warby SC, Montpetit A, Hayden AR et al. CAG expansion in the Huntington disease gene is associated with a specific and targetable predisposing haplogroup. Am J Hum Genet 2009: 84 (3): 351–366. 7. Rannala B, Reeve JP. High-resolution multipoint linkagedisequilibrium mapping in the context of a human genome sequence. Am J Hum Genet 2001: 69 (1): 159–178. 8. Reeve JP, Rannala B. DMLE+: Bayesian linkage disequilibrium gene mapping. Bioinformatics 2002: 18 (6): 894–895. 9. Tults M. The interrelationship between emigration and the sociodemographic profile of Russian Jewry. In: Lewin-Epstein N, Roi Y, Ritterband P, eds. Russian Jews on three continents – migration and resettlement. London: Frank Cass, 1997: 147–176. 10. Bram C. Ethnic categorization and cultural diversity: “A view from the margins”: Caucasus Jews between Europe and Asia. PhD Dissertation, the Hebrew University of Jerusalem, 2008. 11. Bram C. Immigrant Jews of the Caucasus in New York and Moscow: ethno-cultural identity and community organization. Sociol Pap 2009: 13: 43–57. 12. Magid DL. Everey na yuz’nakh Rossia, Veiposk I: Everei na Kavkaze, Istoricheskii ocherk. 1920. Cited in: Altshuler M. The Jews of the Eastern Caucasus: the history of the Mountain Jews from the beginning of the nineteenth century. Jerusalem: Ben Zvi Institute for the study of Jewish communities of the East – the Hebrew University of Jerusalem, 1990: 43 (Hebrew). 13. Olim BeYishuvim (immigrants in towns/municipalities – table), Israel Ministry for Immigrant Absorption, 2004. 14. Bram C. Shaping group identity during a migration process: Caucasus Jews and the Importance of “inner” diversity. Peamim 2007: 111–112, pp. 145–185 (Hebrew). 15. Bram C. Visibility processes, visibility agents, and social categorization. Lomsky-Feder E, Rapoport T, eds. Visibility in immigration: body, gaze, pepresentations. The Van Leer Jerusalem Institute and Hakibbutz Hameochad, Jerusalem 2010 (Hebrew). 16. Behar DM, Metspalu E, Kivisild T et al. Counting the founders: the matrilineal genetic ancestry of the Jewish Diaspora. PLoS One 2008: 3 (4): e2062. 17. Behar DM, Yunusbayev B, Metspalu M et al. The genome-wide structure of the Jewish people. Nature 2010: 466 (7303): 238–242. 18. Folstein SE, Leigh RJ, Parhad IM, Folstein MF. The diagnosis of Huntington’s disease. Neurology 1986: 36 (10): 1279–1283. 19. Stewart JT. Misdiagnosis of Huntington’s disease. J Neuropsychiatry Clin Neurosci 1989: 1 (1): 97. 20. Kozlova SI, Dadali EL, Prytkov AN, Bol’shakova LP, Sibiriakova LG. Population-demographic and clinico-genetic characteristics of Huntington chorea in one region of Azerbaijan. Genetika 1986: 22 (10): 2534–2539. 21. Altshuler M. The Jews of the Eastern Caucasus: the history of the Mountain Jews from the beginning of the nineteenth century. Jerusalem: Ben Zvi Institute for the study of Jewish communities of the East – the Hebrew University of Jerusalem, 1990: 44–47, 147–149 (Hebrew). 22. Warby SC, Visscher H, Collins JA et al. HTT haplotypes contribute to differences in Huntington disease prevalence between Europe and East Asia. Eur J Hum Genet 2011: 19 (5): 561–566.
© 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd CLINICAL GENETICS doi: 10.1111/cge.12344
Short Report
Founder mutation for Huntington disease in Caucasus Jews Melamed O., Behar D.M., Bram C., Magal N., Pras E., Reznik-Wolf H., Borochowitz Z.U., Davidov B., Mor-Cohen R., Baris H.N. Founder mutation for Huntington disease in Caucasus Jews. Clin Genet 2014. © John Wiley & Sons A/S. Published by John Wiley & Sons Ltd, 2014 Huntington disease (HD), an autosomal dominant disorder involving HTT , is characterized by chorea, psychiatric illness and cognitive decline. Diagnosis and age of onset depend on the degree of expansion of the trinucleotide CAG repeat within the gene. The prevalence of HD is known for Europeans but has not been studied in the Israeli population. Between 2006 and 2011 we diagnosed in our adult genetics clinic ten HD probands, nine of whom were Caucasus Jews (CJ) (Azerbaijani), and one Ashkenazi Jewish. We performed haplotype analysis to look for evidence of a founder mutation, and found that of the nine CJ, eight shared the same haplotype that was compatible with the A1 haplogroup. We calculated the coalescence age of the mutation to be between 80 and 150 years. Ninety percent of our HD patients are CJ, as are 27% of the HD patients in Israel, although the CJ comprise only 1.4% of the Israeli population. Our findings suggest a higher prevalence of HD among CJ compared to the general Israeli population and are consistent with a recent founder mutation. We recommend a higher degree of suspicion for HD in CJ with subtle clinical findings. Conflict of interest
The authors have declared that there are no conflicts of interest.
O. Melameda,† , D. M. Behara,b,† , C. Bramc , N. Magala , E. Prasd,e , H. Reznik-Wolfd , Z. U. Borochowitzf,g , B. Davidova , R. Mor-Cohene,h and H. N. Barisa,e a The Raphael Recanati Genetic Institute, Rabin Medical Center, Beilinson Hospital, Petah Tikva, Israel, b Molecular Medicine Laboratory, Rambam Health Care Campus, Haifa, Israel, c Van Leer Institute, Jerusalem and James Madison College of Public Affairs, Michigan State University, East Lansing, MI, USA, d The Danek Gartner Institute of Human Genetics, Sheba Medical Center, Tel Hashomer, Israel, e Sackler Faculty of Medicine, Tel Aviv University, Tel Aviv, Israel, f The Simon Winter Institute for Human Genetics, Bnai-Zion Medical Center, Haifa, Israel, g Rappaport Faculty of Medicine and Research Institute, Technion-Israeli Institute of Technology, Haifa, Israel, and h Amalia Biron Research Institute of Thrombosis and Hemostasis, Sheba Medical Center, Tel Hashomer, Israel † These authors contributed equally to this work.
Key words: Caucasus Jews – founder mutation – haplotype – Huntington disease Corresponding author: Hagit Baris, MD, The Raphael Recanati Genetic Institute, Rabin Medical Center, Beilinson Hospital, 49100 Petah Tikva, Israel Tel.: +972 3 9377659; fax: +972 3 9377660; e-mail: [email protected] Received 1 October 2013, revised and accepted for publication 6 January 2014
1
Melamed et al. Huntington disease (HD [MIM 143100]) is a neurodegenerative autosomal dominant disorder characterized by involuntary movements (chorea), psychiatric illness, memory loss and cognitive decline (1). The protein Huntingtin is encoded by HTT (also called IT15 ), which is responsible for causing HD. The diagnosis and the age of onset are determined by the degree of expansion of the trinucleotide CAG repeats within the gene (2). The mutated HTT allele in HD patients contains a minimum of 36 CAG repeats. An allele with 27–35 repeats is unstable, and the offspring of such carriers are at risk of expansion to the HD zone, especially when transmitted by the father (3, 4). The prevalence of HD varies among different populations and is highest in USA and Western Europe; 4–8:100,000 (5). The aims of our study were to estimate the prevalence of HD among the various Israeli communities, and to identify the haplotype containing the mutation. Methods Clinical data
Following approval from the Rabin Medical Center Institutional Review Board committee, we reviewed the clinical and genetic data of all HD patients referred to the adult genetics clinic of the Rabin Medical Center, Petah Tikva, Israel, which is a large tertiary medical center, between the years 2006 and 2011. Mutation detection
The mutation was detected by direct amplification of the repeating HTT segment, using the primers: 5 -ATGA AGGCCTTCGAGTCCCTCAAGTCCTTC-3 and 5 GGCGGTGGCGGCTGTTGCTGCTGCTGCTGC-3 . The reaction was carried out in a 25 μl reaction volume containing 50 ng of DNA, 13.4 ng of each primer, and 1.5 mM dNTP’s, in 1.5 mM MgCl2 PCR buffer, with 1.2 U of Taq polymerase (Bio-Line, London, UK). After an initial denaturation of 5 min at 95◦ C, 30 cycles were performed (94◦ C for 30 s, 65◦ C for 45 s, and 72◦ C for 30 s), followed by a final extension of 10 min at 72◦ C. The amplification products were viewed on an ABI 3100 Genetic Analyzer (Applied Biosystems, Grand Island, NY). Haplotype analysis
Samples were collected from 11 individuals clinically diagnosed with HD and from 31 random control individuals of Caucasus Jewish origin from the general population. DNA was purified from peripheral blood leukocytes using standard protocols. The haplotype surrounding HTT was defined in the patients and controls by eight polymorphic markers using the ABI 3130 genetic analyzer (Applied Biosystems) with PCR products marked by fluorescent primers. Table 1 shows the primers used. To further define the HD haplotype we sequenced eight single nucleotide polymorphisms (SNPs)
2
surrounding HTT in all the HD patients. The SNPs were chosen by their ability to discriminate between the HTT region haplotypes based on Warby et al. 2009 (6) (Fig. 1). The SNPs were analyzed by direct sequencing using ABI 3130 genetic analyzer (Applied Biosystems). Phasing was performed manually and therefore was inferred. The common haplotype was phased based on HD102 and HD111, siblings who inherited the CAG expanded haplotype from their HD-affected deceased father and different alleles from their healthy mother, who was not available for genotyping. Dating the founder mutation and relatedness of ancestors
Dating the founder mutation in Caucasus Jews (CJ) was carried out using the dmle+2.0 software program (www.dmle.org) (7, 8). It was based on the following parameters: (1) genotypes of polymorphic markers in 62 control chromosomes and haplotypes of eight chromosomes carrying the mutation. (2) Map distances between markers and the mutation taken from the human genome working draft GRch37/hg19. (3) The growth rate (r) of the CJ estimated from the equation: T 1 = T 0 e (gr) , where T 1 is the estimated size of the CJ population in the world at the present time (120,000–140,000) (9–11), T 0 is the estimated size of the ancestral population, i.e. ∼10,000–15,000 in the 17th century (12), and g is the number of generations between T 1 and T 0 assuming 20 years per generation. The calculation yielded a growth rate of 0.118. (4) The estimated allele frequency of the founder HTT mutation in the general CJ population based on the estimated number of CJ HD patients in Israel and a total of 105,000–120,000 CJ in Israel (C. Bram and M. Sicron: personal communication 17 January 2013) (13–15). Given the strong founder effect previously suggested for CJ (16, 17), we tested for cryptic relatedness among our patients at the whole genome level using the Illumina HumanOmniExpress BeadChip array composed of ∼730 K SNPs (Illumina, San Diego, CA). Genotyping was performed following the manufacturer’s directions. Data were evaluated and analyzed using Illumina’s genomestudio v2011.1. The recent ancestry was estimated by measuring the total size of identical by descent (IBD) shared segments between all pairs of HD patients when a segment is defined by a minimum of 500 consecutive SNPs in a raw on the OMNI BeadChip providing it is no less than 1 cM as taken from HapMap. Results Patients
Between the years 2006 and 2011, 1,400 patients were referred to the adult genetics clinic at our center. A total of 11 patients from 10 different families were diagnosed with HD. Of ten probands, nine were of CJ origin and one was of Ashkenazi Jewish ancestry. Table 2 gives the detailed clinical and genetic data of the patients. The average age of onset of symptoms was 45 years (range:
Founder mutation in HTT in Caucasus Jews Table 1. List of the primers used to detect the polymorphic markers. Marker
hg19 location (base)
Forward
Reverse
D4S3038 17 × TG 40 × AC D4S1614 HTT D4S412 D4S3023 D4S2925 D4S2285
10998981100210 1881552–1881586 1953171–1953251 2646545–2646878 3076408–3245687 3380692–3381012 4301335–4301697 4893183–4893399 5103989–5104325
GAAGACCAGCATTCGG TCACCCGTGTTCAGTGAGAG CCTGGGATTGAGTTGTCTCC CATCTAGGAGAATCAGTACTTGG
GGTTTAATACACAGTAATTGTTCA CCACAGAACAGAGCGTCAAA AAAACAGGCCTAGCACCTCA TTACCATGAGCATATTTCCA
ACTACCGCCAGGCACT ACCTCACTGGAAACTAAATGG TCAGAAACCCCTACAGGAAA ATGAGCTCCTCTGAGAGG
CTAAGATATGAAAACCTAAGGGA TGAACAGCAGCGGTCT TTTGATGAGTTATTCGGAGG GGAAAGAGGGCAAGACTC
HTT
HTT
Haplogroup D4S3038 17xTG 40xAC D4S1614 rs2857936 rs12506200 rs762855 rs3856973 rs363102 rs363096 rs2276881 rs362307 D4S412 D4S3023 D4S2925 D4S2285
Haplogroup D4S3038 17xTG 40xAC D4S1614 rs2857936 rs12506200 rs762855 rs3856973 rs363102 rs363096 rs2276881 rs362307 D4S412 D4S3023 D4S2925 D4S2285
HD101 A1/C 223 221 161 155 173 183 143 141 C T G G A G G A A A T C G G T C 241 235 141 149 148 148 293 289
HD106 A1/A2 223 221 161 155 173 179 143 145 C C G G A A G G A G T C G G T C 241 243 141 143 148 148 293 269
HD102 A1/A4 223 221 161 151 173 159 143 145 C C G G A A G G A A T T G G T C 241 237 141 143 148 150 293 269
HD107 A2/C 217 205 155 153 169 167 143 145 C C G G A G G A A G C C G G C C 237 243 141 143 146 150 289 269
HD103 A1/C 217 219 151 157 173 181 143 141 C T G A A G G A A A T C G G T C 241 235 141 141 148 146 293 289
HD108 A2/C 221 219 157 155 185 165 139 145 C T G G A G G A A G C C G G C C 235 247 141 143 148 146 293 297
HD104 A1/C 223 203 161 157 173 173 143 143 C C G G A G G A A A T C G G T C 241 241 141 141 148 146 293 289
HD109 A1/C 223 217 161 159 173 163 143 145 C T G A A G G A A A T C G G T C 241 241 141 141 148 146 293 297
HD110 A1/C 223 217 161 153 173 167 143 143 C C G A A G G A A A T C G G T C 241 243 141 141 148 146 293 289
HD105 A1/C 223 219 161 157 173 169 143 141 C C G G A G G A A G T C G G T C 241 241 141 141 148 148 273 289
HD111 A1/C 223 217 161 157 173 173 143 143 C C G G A G G A A A T C G G T C 241 241 141 141 148 148 293 289
Fig. 1. Analysis of the patients’ haplotypes around HTT using eight polymorphic markers and eight SNPs. The blackened haplotype represents the shared region. The coordinates of the markers are according to assembly hg19 from telomere (top) to centromere (bottom). HD103 marks the telomeric boundary (black arrowhead) and HD105 marks the centromeric boundary (white arrowhead) of the shared haplotype. HD102 and HD111 are siblings who inherited the common haplotype from their affected father and different alleles from their healthy mother. The SNPs define the haplogroups. The common haplotype is consistent with haplogroup A1, however HD107 and HD108 have haplogroup A2.
29–61 years). There were no statistically significant differences between the genders. The average age of genetic diagnosis was 55 years (range: 36–68 years). The number of CAG repeats expanded to between 39 and 50. There was a mean gap of 6.9 years between onset of symptoms and confirmation of the diagnosis (HD). Haplotype analysis
Analysis of the patients’ haplotypes around HTT revealed that eight of the nine CJ HD patients shared
an extended haplotype based on the eight markers; this haplotype was found in 1 of 62 chromosomes of CJ in the general population. The 3.74 Mb shared haplotype is located 1.71 Mb upstream and 1.86 Mb downstream from HTT (Fig. 1). Individual HD108, who is of Ashkenazi Jewish origin, had a different haplotype, as did individual HD107, who is CJ. The specific HD haplogroups were assessed using eight SNP’s and revealed that the shared haplotype is compatible with the HD susceptible A1 haplogroup, although phasing was performed manually and therefore was inferred (Fig. 1). We could not exclude the A4
3
4
M M
F F
M
M M
F
F F
F
HD101 HD102
HD103 HD104
HD105
HD106 HD107
HD108
HD109 HD110
HD111 (sister of HD102)
CJ
CJ CJ
AJ
CJ CJ
CJ
CJ CJ
CJ CJ
Ethnicity
46 34 (Dep – 29, schiz – 34) 40
64
50 60
63
29 56–60
49 35
50
52 49
68
55 65
66
36 64
55 44
Age of genetic diagnosis
10
6 15
4
5 5
3
7 4–8
6 9
Delay in diagnosis (in years)
Cognitive and memory decline + +
+ −
+
+ + − + +
+
Involuntary movements + +
+ +
+
+ + + + +
+
Aggressive responses
Depression Depression, schizophrenia
Depression
Mood changes, anger Mood changes
Depression
Depression Depression and upset mood
Depression Aggressive responses
Psychiatric complaints
n/a
n/a Global cerebral atrophy, symmetric putamen nuclei atrophy, low signal of Globus Pallidus Cerebral atrophy Diffuse hyperintense T2 changes in centrum semiovale and hemispheres, compatible with ischemic changes Moderate dilation of ventricles, mild periventricular Hyperintensity in flair and T2 n/a MRI n/a, brain CT – mild cerebral atrophy MRI n/a, brain CT – cerebral atrophy n/a normal
Brain MRI
43, 18
41, 15 43, 18
39, 15
42, 24 40, 16
40, 17
50, 17 40, 18
42, 16 45, 17
No. of CAG repeats
AJ, Ashkenazi Jews; CJ, Caucasus Jews; Dep, depression; F, female; HD, Huntington; Hx, history; ID, identification; M, male; MRI, magnetic resonance imaging; schiz, schizophrenia.
M/F
Patient ID
Age of onset
Table 2. Clinical and genetic information of the observed mutations
+
Neg Neg
+
Father
/ /
Father
Mother ?
Mother
+
+ ?
Father ?
Mother Father
Parent of HD origin
+ +
+ +
Family Hx
Melamed et al.
Founder mutation in HTT in Caucasus Jews (a) 0.045 0.04 0.035
frequency
haplogroup, because all eight patients with the shared haplotype were heterozygous for rs362307 (C/T), meaning that their haplotypes could be compatible with either the A1 or the A4 alleles. However, the A4 allele seems very unlikely, because it would force the ‘T’ allele at rs362307 onto the non-expanded chromosome, making it an unknown haplotype, rather than the common ‘C’ haplotype on non-expanded chromosomes. The CAGexpansion in HD107 and HD108 was assumed to be on the HD A2 haplogroup.
0.03 0.025 0.02 0.015 0.01 0.005 0 0
10
20
30
40
Discussion
HD is one of the most devastating neurodegenerative diseases. Its prevalence is highest in the USA and Western Europe (4–8 cases per 100,000 individuals) (5). Jewish immigrants constitute the majority of Israeli society and we expected the prevalence of HD to be equal among the various ethnicities. However, we noted that the CJ HD patients comprise 90% of HD patients in our genetics clinic and 27% of the HD patients in Israel, even though the CJ account for only 1.4% of the Israeli population (the total Israeli population is based on the 2011 Israeli Central Bureau of Statistics). In Israel the CJ are a small and closely related population of 105,000–120,000 who are scattered around all parts of the country, with the majority concentrated mostly in the periphery. The CJ who live in the center of Israel are served by our genetics clinic. In the literature there are reports of a high prevalence of HD in Azerbaijan, which was one of the countries where the CJ’s resided during the Diaspora (20); however, we were unable to find a comprehensive molecular study in
60
70
80
90
100 110
Peak:4.3 generations (95% CS 0.8-27.8)
(b)
0.03 0.025
frequency
To date the coalescence age of the founder HTT mutation in the CJ population we used the dmle + 2.0 program based on the parameters described in the methods. On the basis of an estimate of 66 CJ HD patients out of a total of 245 HD patients diagnosed in the two HD diagnostic laboratories in Israel and ∼112,500 CJ in Israel, we calculated the allele frequency of the founder mutation to be 0.000293. However, we know that HD is frequently misdiagnosed (18, 19), and therefore for our calculation we also doubled the actual number of patients to compensate for the under-diagnosis. We estimated that the mutation occurred 4.3–7.6 generations ago, corresponding to 80–150 years ago (Fig. 2). For estimation of relatedness at the whole genome level we studied the total and largest IBD haplotype segments shared by our patients and as inferred from ∼730 K SNPs genotypes available from the BeadChip platform. HD108 showed no evidence of recent ancestry within the last six generations and was actually predicted to be of Ashkenazi ancestry. HD102 and HD111 showed a relatedness pattern compatible with a parent/child or full sibling pattern. All other comparisons suggested the individuals to be first to fifth degree relatives.
50
generations
Dating the founder mutation and estimation of relatedness
0.02 0.015 0.01 0.005 0 0
10
20
30
40
50
60
70
80
90
100 110
generations
Peak:7.6 generations (95% CS 1.8-34.5)
Fig. 2. The posterior probability densities of the founder mutation age (in generations) estimated by the dmle program based on 66 (A) and 130 (B) Caucasus Jews (CJ) Huntington disease (HD) patients. The vertical broken line represents the age value that had the highest probability (peak). The 95% credible set (CS) of values for each posterior density is indicated.
this population. We conducted this clinical and genetic study in order to expand our knowledge of HD in the CJ population. Statistics based on CJ population size should be regarded with caution because tracing the demographic characteristics of CJ is a difficult task (21) and there is no official census count. One estimate by Nikolas Witsen put the size of the original CJ population at the end of the 17th century at about 15,000 (12). There is evidence that some Jews converted to Islam, and it is probable that many also left the region altogether (21). Taking all these statistics together, we suggest that an approximate figure of 10,000–15,000 was the probable size of the original CJ population at the end of the 17th century, because it is probable that only a part of the population survived or kept their Jewish identity (21). The clinical characteristics of our HD patients are shown in Table 2. There is a mean of 6.9 years’ delay in the diagnosis of HD in our patients; this is probably a result of the frequent misdiagnosis of these patients, which is known to be a problem (18, 19). In one extreme case, patient HD110, there was a 15 year delay between a schizophrenic episode and the diagnosis of HD. This case shows the need for a high level of awareness of the higher prevalence of HD among CJ.
5
Melamed et al. The molecular analysis of the HTT locus in our cohort of HD patients showed a common founder haplotype in 8 of the 10 probands (Fig. 1), a second haplotype in the AJ patient (HD108), and, surprisingly, a third haplotype in another CJ HD patient (HD107). The shared CJ HD haplotype is 3.74 Mb long and HTT is located approximately in the middle. By dating this founder mutation we found that it is of recent origin occurring 80–150 years ago. In a further study for ancestry relatedness among our CJ patients we found them to be first to fifth degree relatives. This is compatible with the suggested demographics of the population and molecularly attests to a strong founder effect, isolation, and the probable high level of inbreeding of the CJ. It is also concordant with the recent origin of the mutation. It has been suggested that many factors contribute to CAG instability (6). Warby et al. proposed the predisposing haplogroup model, where certain haplotypes surrounding HTT are predisposed to CAG expansion based on genetic cis-elements and trans-factors, whereas other haplogroups are more stable (6, 22). It was shown that the A1 and A2 haplogroups are more prevalent in HD patients, suggesting that chromosomes harboring these haplogroups are more susceptible to CAG-expansion (6). To study this further in our CJ HD patients, we analyzed all the HD patients using SNPs known to have discriminatory power between the various HD haplogroups. In the common CJ haplotype we could not differentiate between the A1 and A4 haplogroups because all the patients were heterozygous for rs362307 (C/T); however, the A1 allele is more probable as it allows the non-expanded chromosome to be a ‘C’ haplotype rather than an unknown allele (Fig. 2). This is also supported by Warby et al. (6), who showed that a cluster of similar haplotypes (haplotype A) is present on 95% of HD chromosomes, where the majority of these (55%) could be classified as the A1 allele and the A4 allele was almost absent from the expanded CAG chromosomes. Both patients HD107 and HD108, who did not harbor the common CJ haplotype, have haplogroup A2, which is the second most common risk allele. Conclusion
In view of our finding of a founder mutation that causes a higher prevalence of HD among CJ compared to the general population in Israel and the documented average delay of around 7 years to diagnosis, we want to raise awareness among physicians of HD in this unique CJ population. This will enable earlier diagnosis allowing for prenatal evaluation and possible preimplantation genetic diagnosis when desired, and when specific and effective treatment becomes available, early initiation of such treatment. Acknowledgments The authors thank Prof. Moshe Frydman and Dr Israela Lerer for their help with the manuscript, Prof. Moshe Sicron for his
6
assistance in calculating the CJ population size and Dr Gabrielle J. Halpern for her editorial assistance.
References 1. Roos RA. Huntington’s disease: a clinical review. Orphanet J Rare Dis 2010: 5 (1): 40. 2. Andrew SE, Goldberg YP, Kremer B et al. The relationship between trinucleotide (CAG) repeat length and clinical features of Huntington’s disease. Nat Genet 1993: 4 (4): 398–403. 3. Semaka A, Creighton S, Warby S, Hayden MR. Predictive testing for Huntington disease: interpretation and significant of intermediate alleles. Clin Genet 2006: 70 (4): 283–294. 4. Telenius H, Kremer HP, Theilmann J et al. Molecular analysis of juvenile Huntington disease: the major influence on (CAG)n repeat length is the sex of the affected parent. Hum Mol Genet 1993: 2 (10): 1535–1540. 5. Harper PS. The epidemiology of Huntington’s disease. Hum Genet 1992: 89 (4): 365–376. 6. Warby SC, Montpetit A, Hayden AR et al. CAG expansion in the Huntington disease gene is associated with a specific and targetable predisposing haplogroup. Am J Hum Genet 2009: 84 (3): 351–366. 7. Rannala B, Reeve JP. High-resolution multipoint linkagedisequilibrium mapping in the context of a human genome sequence. Am J Hum Genet 2001: 69 (1): 159–178. 8. Reeve JP, Rannala B. DMLE+: Bayesian linkage disequilibrium gene mapping. Bioinformatics 2002: 18 (6): 894–895. 9. Tults M. The interrelationship between emigration and the sociodemographic profile of Russian Jewry. In: Lewin-Epstein N, Roi Y, Ritterband P, eds. Russian Jews on three continents – migration and resettlement. London: Frank Cass, 1997: 147–176. 10. Bram C. Ethnic categorization and cultural diversity: “A view from the margins”: Caucasus Jews between Europe and Asia. PhD Dissertation, the Hebrew University of Jerusalem, 2008. 11. Bram C. Immigrant Jews of the Caucasus in New York and Moscow: ethno-cultural identity and community organization. Sociol Pap 2009: 13: 43–57. 12. Magid DL. Everey na yuz’nakh Rossia, Veiposk I: Everei na Kavkaze, Istoricheskii ocherk. 1920. Cited in: Altshuler M. The Jews of the Eastern Caucasus: the history of the Mountain Jews from the beginning of the nineteenth century. Jerusalem: Ben Zvi Institute for the study of Jewish communities of the East – the Hebrew University of Jerusalem, 1990: 43 (Hebrew). 13. Olim BeYishuvim (immigrants in towns/municipalities – table), Israel Ministry for Immigrant Absorption, 2004. 14. Bram C. Shaping group identity during a migration process: Caucasus Jews and the Importance of “inner” diversity. Peamim 2007: 111–112, pp. 145–185 (Hebrew). 15. Bram C. Visibility processes, visibility agents, and social categorization. Lomsky-Feder E, Rapoport T, eds. Visibility in immigration: body, gaze, pepresentations. The Van Leer Jerusalem Institute and Hakibbutz Hameochad, Jerusalem 2010 (Hebrew). 16. Behar DM, Metspalu E, Kivisild T et al. Counting the founders: the matrilineal genetic ancestry of the Jewish Diaspora. PLoS One 2008: 3 (4): e2062. 17. Behar DM, Yunusbayev B, Metspalu M et al. The genome-wide structure of the Jewish people. Nature 2010: 466 (7303): 238–242. 18. Folstein SE, Leigh RJ, Parhad IM, Folstein MF. The diagnosis of Huntington’s disease. Neurology 1986: 36 (10): 1279–1283. 19. Stewart JT. Misdiagnosis of Huntington’s disease. J Neuropsychiatry Clin Neurosci 1989: 1 (1): 97. 20. Kozlova SI, Dadali EL, Prytkov AN, Bol’shakova LP, Sibiriakova LG. Population-demographic and clinico-genetic characteristics of Huntington chorea in one region of Azerbaijan. Genetika 1986: 22 (10): 2534–2539. 21. Altshuler M. The Jews of the Eastern Caucasus: the history of the Mountain Jews from the beginning of the nineteenth century. Jerusalem: Ben Zvi Institute for the study of Jewish communities of the East – the Hebrew University of Jerusalem, 1990: 44–47, 147–149 (Hebrew). 22. Warby SC, Visscher H, Collins JA et al. HTT haplotypes contribute to differences in Huntington disease prevalence between Europe and East Asia. Eur J Hum Genet 2011: 19 (5): 561–566.
