Cell, Vol. 66, 317-326,

July 26, 1991, Copyright

0 1991 by Cell Press

Fos-Jun Heterodimers and Jun Homodimers Bend DNA in Opposite Orientations: Implications for Transcription Factor Cooperativity Tom K. Kerppola and Tom Curran Department of Molecular Oncology and Virology Roche Institute of Molecular Biology Nutley, New Jersey 07110

Summary Association of Fos and Jun with the AP-1 site results in a conformational change in the basic amino acid regions that constitute the DNA-binding domain. We show that Fos and Jun induce a corresponding alteration in the conformation of the DNA helix. Circular permutation analysis indicated that both Fos-Jun heterodimers and Jun homodimers induce flexure at the AP-1 site. Phasing analysis demonstrated that FosJun heterodimers and Jun homodimers induce DNA bends that are directed in opposite orientations. FosJun heterodimers bend DNA toward the major groove, whereas Jun homodimers bend DNA toward the minor groove. Fos and Jun peptides encompassing the dimerization and DNA-binding domains bend DNA in the same orientations as the full-length proteins. However, additional regions of both proteins influence the magnitude of the DNA bend angle. Thus, despite the amino acid sequence similarity in the basic region Fos-Jun heterodimers and Jun homodimers form topologically distinct DNA-protein complexes. Introduction Regulation of transcription by site-specific DNA-binding proteins involves protein-protein contacts between the regulatory factors and components of the initiation complex. Contact between proteins bound to separated sites on DNA requires deformation of the straight DNA helix into a loop. Although long DNA fragments, of several hundred to thousands of base pairs, behave like flexible chains, short DNA fragments, of ten to a few hundred base pairs, have the characteristics of stiff rods (Wang and Giaever, 1988). Therefore, interaction between proteins bound to sites on DNA separated by short distances is constrained by the unfavorable free energy of looping the intervening DNA. Factors that induce bending in intervening DNA sequences can reduce this thermodynamic barrier and facilitate protein-protein interactions. Several proteins that induce bends in the DNA helix as well as DNA sequences that contain intrinsic bends have been identified. Such DNA bends have been found in regions involved in the initiation of DNA replication (Zahn and Blattner, 1987; Baur and Knippers, 1988; Williams et al., 1988), site-specific recombination (Salvo and Grindley, 1988; Thompson and Landy, 1988; Moitoso de Vargas et al., 1989) and transcription initiation (Wu and Crothers, 1984; Kim et al., 1989; McAllister and Achberger, 1989; Bracco et al., 1989; Rojo et al., 1990; Gober and Shapiro, 1990; Hoover et al., 1990). All of these cellular processes

are mediated by multiprotein complexes that are assembled in part through a common relationship with the DNA substrate. Therefore, the conformation of the DNA substrate is likely to be important for the overall structure of the complex. The importance of DNA structure has been most clearly demonstrated for bacteriophage h integration. DNA bending induced by integration host factor (IHF) binding to sequences adjacent to the integration site promotes DNA looping by h integrase and thereby stimulates site-specific cleavage and recombination (Moitoso de Vargas et al., 1989; Kim et al., 1990). The IHF-induced DNA bend can be functionally replaced by an intrinsic DNA bend, demonstrating that the specific function of IHF in the integration complex is to bend DNA into an active conformation (Goodman and Nash, 1989). The excision reaction requires two additional proteins, Xis and FIS, both of which are also known to bend DNA, suggesting that DNA bending by these proteins influences the directionality of the recombination reaction (Moitoso de Vargas and Landy, 1991). Recent studies of gene regulation in prokaryotes indicate that DNA structure is also likely to be important for the regulation of transcription initiation. Transcription of the nitrogen fixation operons of Klebsiella pneumoniae and the flagellar genes of Caulobacter crescentus is regulated by factors that bind to regulatory elements located approximately 100 bp from the transcription start site. Activation of transcription by these factors requires IHF binding to sites located between the upstream regulatory elements and the transcription start sites (Gober and Shapiro, 1990; Hoover et al., 1990). The most likely interpretation of these results is that DNA bending by IHF is required to facilitate interactions between transcription factors bound to upstream regulatory elements and the RNA polymerase holoenzyme bound to promoter sequences. Similar processes may also contribute to the regulation of eukaryotic gene expression. The Fos and Jun families of transcription factors interact with a variety of DNA recognition sequences designated variously as AP-1, TRE, or CRE sites (Bohmann et al., 1987; Rauscher et al., 1988; Franza et al., 1988; Risse et al., 1989; Cohen et al., 1989; Ryseck and Bravo, 1991; Hai and Curran, 1991). These sequences are frequent components of complex regulatory elements, containing binding sites for multiple transcription factors that are responsive to a variety of extracellular stimuli (Lee et al., 1987; Distel et al., 1988; Sonnenberg et al., 1989). Recently, several interactions between Fos and Jun and members of the steroid receptor family have been described. In the case of the composite glucocorticoid response element from the prolactin gene, stimulation of the glucocorticoid receptor with dexamethasone results in transcription activation in the presence of Jun alone but results in transcription repression in the presence of both Fos and Jun (Diamond et al., 1990). These and other results (reviewed in Curran and Vogt, 1991) suggest that Fos and Jun can regulate

Cell 318

transcription cooperatively with other transcription factor families. The structures of the dimerization and DNA-binding domains of Fos, Jun, and several other leucine zipper/basic region proteins have been investigated using several methods. The dimerization domain has a structure reminiscent of the coiled-coil, consisting of two parallel a helices with a hydrophobic contact interface (reviewed in Kerp pola and Curran, 1991). Two different models have been proposed for the DNA-binding domain (Vinson et al., 1989; C’Neil et al., 1990). Both models postulate that an a-helical DNA contact surface lies within the major groove of a straight B-DNA helix. Circular dichroism spectroscopy has demonstrated that the DNA-binding domain undergoes a conformational transition to a structure of high a helix content in the presence of the cognate DNA-binding site (C)‘Neil et al., 1990; Pate1 et al., 1990; Weiss et al., 1990; Talanian et al., 1990). This protein conformational change induced by DNA binding prompted us to investigate whether DNA conformation was also affected by proteinDNA interaction. According to thermodynamic principles, a conformational change in one molecule induced by interaction with a second molecule should cause a complementary conformational change in the second molecule. Complementary conformational changes have been shown to occur upon DNA binding by the bacteriophage h Cro protein, in which rotation of the two Cro subunits is accompanied by bending of the DNA-binding site (Brennan et al., 1990). Consequently, DNA binding by leucine zipper/basic region proteins is predicted to induce a conformational change in the DNA helix. The nature and magnitude of this conformational change cannot be predicted from first principles, since the exact structures and energy differences between the free protein and the protein-DNA complex are not known. To investigate these changes in DNA structure, we have extended the methods of circular permutation (Wu and Crothers, 1984) and phasing analysis (Zinkel and Crothers, 1987) to determine the extent of DNA flexure and the angles and orientations of DNA bending induced by Fos and Jun.

The effects of Fos-Jun heterodimer and Jun homodimer binding on DNA structure were investigated by comparing the electrophoretic mobilities of protein complexes bound to different DNA fragments. During gel electrophoresis, DNA fragments are thought to reptate through the gel matrix in a snakelike fashion. Distortions, such as bends, in the DNA helix impede movement through the gel matrix and retard the mobility of the DNA fragment. Conventional theories of gel electrophoresis predict that the mobility of a polyanion is dependent on the mean square end-to-end distance of the fragment (Lerman and Frisch, 1982; Lumpkin et al., 1985). Therefore, for fragments of identical lengths, a bend at the center of the fragment would retard the mobility more than a bend at the end of the fragment. More recent computer simulation of gel electrophoresis of bent DNA fragments, using a reptation model that considers the elastic properties of DNA, has yielded similar pre-

dictions (Levene and Zimm, 1989). These electrophoretic properties of DNA can be used to investigate alterations in DNA structure that are induced by DNA-binding proteins. Fos-Jun Heterodimers and Jun Homodimers induce Flexure at the AP-1 Site Circular permutation analysis is currently the most widely applied method for the identification of DNA bends, It is based on the position-dependent effect of DNA bends on the electrophoretic mobilities of DNA fragments (Wu and Crothers, 1984). A set of DNA probes containing a single AP-1 site at different positions relative to the ends of the fragment were prepared (Figure 1A). All probes were of identical lengths and contained different circular permutations of the same nucleotide sequences. Fos-Jun heterodimers and Jun homodimers prepared from purified proteins (Abate et al., 1990b) were incubated with the probes, and the complexes were subjected to polyacrylamide gel electrophoresis. For both Fos-Jun heterodimers and Jun homodimers, complexes bound to probes on which the AP-1 site was located in the middle migrated slower than complexes bound to probes on which the AP-1 site was located at either end (Figure 1 B). This pattern of mobilities is characteristic of DNA sequences that contain a bend (Wu and Crothers, 1984), and DNA-binding proteins that induce such patterns have been operationally defined to cause a bend in DNA (Thompson and Landy, 1988; Wu and Crothers, 1984). However, it is important to recognize that structures other than a static DNA bend could cause similar alterations in electrophoretic mobilities. In particular, a location of increased flexibility with no specific orientation, such as that observed in regions of triple helix formation (Htun and Dahlberg, 1988) can affect the electrophoretic mobilities of DNA fragments. Therefore, we will refer to structures that cause a periodic variation in the mobilities of protein complexes bound to circularly permuted probes as locations of DNA flexure. The center and the extent of DNA flexure can be determined from the relationship between the relative mobilities of the complexes and the distance from the center of the binding site to the ends of the probe (Figure 1C). Fos-Jun heterodimers cause a larger variation in complex mobilities and therefore cause a greater extent of DNA flexure than do Jun homodimers. To estimate the DNA flexure angles caused by Fos-Jun heterodimers and Jun homodimers, we compared the mobility variations induced by these complexes with the mobility variations induced by intrinsically bent DNA sequences containing phased A:T tracts whose bend angles have been previously determined (Zahn and Blattner, 1987; Levene et al., 1986; Koo et al., 1990). The DNA flexure angles induced by Fos-Jun heterodimers (94O) and Jun homodimers (79O) were of the same order of magnitude as the DNA flexure angles observed previously for the prokaryotic CAP (70°-140’), FE (900), GalR (loo’-1 lo’), Xis (1400), and IHF (>140°) proteins (Thompson and Landy, 1988; Kim et al., 1989). The centers of DNA flexure for both Fos-Jun heterodimer and Jun homodimer complexes were located within one standard deviation of the center of the AP-1 site. The probes themselves displayed only minor variations in mo-

Fos and Jun Bend DNA 319

A

B

C Fos

0-p

Jun

NI M-

ADFHKMO o-

K J

Jun ADFHKMO

0.5

Isg06 e 0.7

s 08 z n” 0.9

I H G-

1

F EM 0.5

D. cB.

.I 06 2 g 0.7

A

.E 0.8 5 $ 0.9 1 f

Figure 1. Circular Permutation Analysis Heterodimers and Jun Homodimers

of DNA Flexure

o.5

by Fos-Jun

(A) The probes used for circular permutation analysis were generated by restriction endonuclease cleavage at sites within two tandem polylinker sequences flanking the AP-1 site (open box). All probes were 133 bp in length and contained different circular permutations of the same sequences. (B) Electrophoretic mobility shift analysis of Fos-Jun heterodimers and Jun homodimers bound to circularly permuted probes. Fos-Jun heterodimers or Jun homodimers were incubated with the probes shown above the lanes, and the complexes were analyzed by polyacrylamide gel electrophoresis. (C)The relative mobilities of Fos-Jun heterodimer and Jun homodimer complexes, as well as the free probes and probes into which an intrinsic DNA bend containing three phased A:T runs (dotted line) was inserted, are shown as a function of the position of the AP-1 site relative to the probe ends. The complex mobilities were corrected for slight variations in probe mobilities, normalized to the fastest mobility complex, and plotted as a function of the distance from the center of the AP-1 site to the ends of the probe. The relative mobilities represent the average from at least eight independent experiments, and the standard deviations are shown as vertical bars. The maximum is shown by an arrow, and the standard deviation of maxima from different experiments is shown by a bar at the base of the arrow. The points are connected by the calculated best fit of a cosine function to each set of data.

bilities in the absence of Fos and Jun. Therefore, the AP-1 site itself and the flanking DNA sequences do not contain significant DNA bends. The DNA flexure induced by FosJun heterodimers and Jun homodimers was not restricted to the proteins expressed in Escherichia coli, since Fos and Jun proteins translated in vitro also induced DNA flexure (data not shown). Fos-Jun Heterodimers and Jun Homodimers Bend DNA in Opposite Orientations Circular permutation analysis can be used to detect a distortion in DNA structure; however, it does not allow determination of the specific nature of the structural distortion. To determine whether the DNA flexure induced by Fos and Jun included a DNA bend and to eliminate the possibility that other DNA or protein structures might be responsible for the observed mobility variations, we extended the technique of phasing analysis (Zinkel and Crothers, 1987). Phasing analysis provides a more specific method foranalysis of DNA bending and allows discrimination between

Intrinsic

bend

.s &y 0.6 B g 0.7

.g 0.8 I Y9

---k-l /

o.5

t , ..~...

,

Probes

3 06: E

-80

-40 0 40 Position of AP-1 s!te

so

directed DNA bends and regions of increased DNAflexibility (Salvo and Grindley, 1987; Zinkel and Crothers, 1987; Snyder et al., 1989). In addition, it allows determination of the orientation of a DNA bend relative to the orientation of astandard bend. Phasing analysis is performed by placing a standard DNA bend at different distances from the structure under investigation and thereby varying the helical phasing of the two structures (Figure 2A). If the structure under investigation contains a DNA bend, the mobility of the complexes will vary such that it is lowest when the two bends cooperate to increase the overall extent of bending (Figure 2A, ii) and highest when the two bends counteract each other (Figure 2A, iii). A structure that does not contain a directed DNA bend should have a constant effect on the electrophoretic mobilities of the complexes. A set of DNA probes were prepared that contained an AP-1 site separated by a spacer of variable length from an intrinsic DNA bend (Figure 28). The length of the spacer was varied over one turn of the DNA helix to place the AP-1 site on different faces of the DNA relative to the intrinsic

Cell 320

C

A i

Fos Jun

-“-,,,

Jun

ii

/1

D j Fos:Jun

0

2

4

6

Figure 2. Phasing Analysis by Fos-Jun Heterodimers dimers

of DNA Bending and Jun Homo-

(A) Schematic diagram of the predicted structures of complexes containing an intrinsic DNA bend (i) and a protein-induced bend in phase (ii) and out of phase (iii). The overall bend angle is larger, and the end-to-end distance of the fragment is shorter, for the in phase complex (ii) than for the out of phase complex (iii). Therefore, the former should have a lower electrophoretic mobility than the latter. (B) The probes used for phasing analysis contained an AP-1 site (open box) separated by a variable length spacer (striped box) from an intrinsic DNA bend (dotted line). The probe names indicate the distance in base pairs between thecentersofthe AP-1 siteand theintrinsic DNA bend. With the exception of the variable spacer length, all probes were of the same size and contained the same sequences. (C) Electrophoretic mobility shift analysis of Fos-Jun heterodimers and Jun homodimers bound to phasing analysis probes. Fos-Jun heterodimers or Jun homodimers were incubated with the probes shown above the lanes, and the complexes were analyzed by polyacrylamide gel electrophoresis. For an autoradiogram that includes the bands corresponding to the free probes, see Figure 4A. (D) Relative mobilities of complexes as a function of spacer length. The complex mobilities were corrected for variations in probe mobilities, normalized to the average mobility of all complexes, and plotted as a function of the spacer length. The relative mobilities represent the average from at least seven independent experiments, and the standard deviations are shown asvertical bars. The maximum is shown by an arrow, and the standard deviation of maxima from different experiments is shown by a bar at the base of the arrow. The points are connected by the calculated best fit of a cosine function to each set of data.

6

Spacer length

DNA bend. Fos-Jun heterodimers and Jun homodimers were bound to these probes and subjected to polyacrylamide gel electrophoresis. For both Fos-Jun heterodimer and Jun homodimer complexes, the mobilities varied depending on the spacing between the AP-1 site and the intrinsic DNA bend (Figure 2C). This confirmed that FosJun heterodimers and Jun homodimers induce directed DNA bends. Strikingly, the probe that gave the highest mobility complex with Fos-Jun heterodimers (probe 21) gave the lowest mobility complex with Jun homodimers and vice versa (probe 26). These results imply that FosJun heterodimers and Jun homodimers bend DNA in different orientations. To determine the relative orientations of DNA bending induced by Fos-Jun heterodimers and Jun homodimers, we plotted the relative mobilities of the complexes as a

function of spacer length (Figure 2D). The orientation of DNA bending induced by each complex can be determined from the spacer length that gives the lowest complex mobility at which the protein-induced DNA bend cooperates optimally with the intrinsic DNA bend. The spacer lengths that would give the lowest mobilities for Fos-Jun heterodimer and Jun homodimer complexes differed by 6 bp. Assuming an average of 10.5 bp per turn of the DNA helix, this corresponds to a 200° difference in the relative orientationsof DNA bends induced by Fos-Jun heterodimers and Jun homodimers. Therefore, Fos-Jun heterodimers and Jun homodimers bend DNA in opposite orientations. The intrinsic DNA bend does not affect the binding of Fos and Jun to the AP-1 site, since the apparent affinities of binding to probes with or without the intrinsic bend were similar. The orientations of DNA bending induced by Fos-

Fos and Jun Bend DNA 321

Figure 3. Circular Permutation Analysis of DNA Flexure by Leucine Zipper/Basic Region Peptides

F139-211: J240-334

v.

z= EZ356

O-

ADEFGHIKLMOADEFGHIKLMO *i

jj

0.9 1

I

J240-334

-L/- f

M5 -60

Jun heterodimers and Jun homodimerswere not restricted to the proteins expressed in E. coli, since Fos and Jun proteins translated in vitro also induced opposite orientations of DNA bending (data not shown). The absolute orientations of DNA bending induced by Fos-Jun heterodimers and Jun homodimers can be determined from the phasing between the intrinsic DNA bend and the protein-induced bend in combination with the orientation of DNA bending induced by phased A:T tracts. Phased A:T tracts have been shown to bend DNA toward the minor groove at the center of the A:T tract (Zinkel and Crothers, 1987; Salvo and Grindley, 1987). The center of the middle A:T tract in the intrinsic bend was located 21 bp, or two helical turns, away from the center of the AP-1 site on the probe with no spacer. Therefore, proteins that bend DNA toward the minor groove at the center of the AP-1 site should cooperate with the intrinsic bend when bound to the probe with no spacer (probe 21) and they should counteract this bend when bound to the probe with a 5 bp spacer (probe 26). In contrast, proteins that bend DNA toward the major groove at the center of the AP-1 site should counteract the intrinsic bend when bound to the probe with no spacer (probe 21), and they should cooperate with this bend when bound to the probe with a 5 bp spacer (probe 26). Therefore, the net orientation of DNA bending induced by Fos-Jun heterodimers is toward the minor groove, whereas the net orientation of DNA bending induced by Jun homodimers is toward the major groove at the center of the AP-1 site.

~40 0 40 Poslt!on of A?-1 s,te

60

(A) Etectrophoretic mobility shift analysis of Fos(139-21 f)Jun(240-334) heterodimers and Jun(240-334) homodimers bound to circularly permuted probes. The dimers indicated above the lanes were incubated with the probes described in Figure lA, and the complexes were analyzed by polyacrylamide gel electrophoresis. In the left panel, intrinsic bend standards containing two, three, five, or six phased A:T runs in the middle (M2, M3, M5, M6) or three phased A:T runs at the end (E) of the fragment were analyzed on the same gel. (6) The relative mobilities of Fos(139-211)Jun(240-334) and Jun(240-334) complexes were plotted as in Figure 1C using averages from at least three independent experiments. Other peptides encompassing the dimerization and DNA-binding domains gave identical results.

Peptides Encompassing the Fos and Jun Dimerization and DNA-Binding Domains Induce DNA Bends in the Same Orientations As the Full-Length Proteins The dimerization and DNA-binding functions of Fos and Jun reside in short peptide segments containing a leucine zipper and a region rich in basic residues (reviewed in Kerppola and Curran, 1991). We wished to determine whether the dimerization and DNA-binding domains alone would be sufficient to cause DNA bending or whether additional regions of the protein were involved. Toward this end, heterodimers and homodimers were prepared from purified Fos and Jun peptides encompassing the DNAbinding and dimerization domains of both proteins. Two different peptides from each protein, corresponding to residues 116-211 and 139-211 of Fos and 224-334 and 240334 of Jun (Abate et al., 1991), were used. There were no significant differences between the results obtained using either of the two Fos or the two Jun peptides. Circular permutation analysis of Fos(l39-21 l)-Jun(240334) heterodimers and Jun(240-334) homodimers demonstrated that both complexes caused DNA flexure (Figures 3A and 38). The DNA flexure angles induced by Fos(139-21 l)-Jun(240-334) heterodimers (57O) and Jun (240-334) homodimers (53O) were significantly smaller than those induced by the full-length proteins. The centers of DNA flexure for both peptide complexes were located near the center of the AP-1 site. Phasing analysis of Fos(139-21 l)-Jun(240-334) heterodimers and Jun(240334) homodimers indicated that both complexes induced

Cell 322

DNA-binding domains were smaller than those induced by the full-length proteins, suggesting that additional regions of Fos and Jun could influence DNA bending. To map the regions of these proteins that affected the extent of bending, we analyzed DNA bending by complexes containing deletion derivatives (Abate et al., 1991) of Fos and Jun. Initial results from these studies suggest that the regions that increase the DNA bend angle correspond to domains that have been previously shown (Abate et al., 1991) to contribute to transcriptional activation (T. Curran and T. Kerppola, unpublished data). The DNA flexure and bend angles induced by these complexes exhibited no correlation with the molecular mass or the overall charge of the complex.

F139-211: J240-334 v

t J240-334

t

P-

0 2 4

6

6

Spacerlength

Figure 4. Phasing Region Peptides

Analysis

of DNA Bending

by Leucine

Discussion

10

Zipper/Basic

(A) Electrophoretic mobility shift analysis of Fos(139-21 l)-Jun(240334) heterodimers and Jun(240-334) homodimers bound to phasing analysis probes. The dimers indicated above the lanes were incubated with the probes described in Figure 28, and the complexes were analyzed by polyacrylamide gel electrophoresis. The upper panel shows the mobilities of the complexes and the free probes (P) after xylene cyanol had migrated 4 cm. The lower panel shows the mobilities of the complexes after xylene cyanol had migrated 20 cm. (B) The relative mobilities of Fos(139-21 l)-Jun(240-334) and Jun (240-334) complexes were plotted as in Figure 2D using averages of at least three independent experiments. Other peptides encompassing the dimerization and DNA-binding domains gave identical results.

directed DNA bends (Figures 4A and 4B). The orientations of DNA bends induced by Fos(139-21 l)-Jun(240-334) heterodimers and Jun(240-334) homodimers were virtually identical to those induced by the full-length proteins. These results indicated that the dimerization and DNAbinding domains of Fos and Jun were sufficient to induce DNA bends in the same orientations as the full-length proteins but that the DNA flexure angles induced by the peptides were smaller. The Fos(139-21 l)-Jun(224-334) heterodimer and the Jun(224-334) homodimer complexes contained peptides of similar sizes and similar primary structures; however, they induced opposite orientations of DNA bending. In contrast, Fos and Jun peptides of different sizes induced similar DNA bends. These results reaffirm that the conformational effects studied in this article are the result of protein-induced bends in the DNA helix rather than a consequence of unusual protein structures. The DNA flexure and DNA bend angles induced by Fos and Jun peptides encompassing the dimerization and

The role of DNA structure in transcription regulation has become the focus of renewed interest as a result of recent observations that sequences containing intrinsic DNA bends as well as proteins that induce DNA bending can regulate transcription initiation in prokaryotes (McAllister and Achberger, 1989; Braccoet al., 1989; Rojoet al., 1990; Gober and Shapiro, 1990; Hoover et al., 1990). These findings suggest that DNA bending serves an important role in facilitating interactions among components of the transcription complex that are bound to different sites on DNA and in promoting DNA looping to allow single proteins to contact multiple DNA sequence elements. In this article, we offer a general approach to the analysis of DNA bending by transcription factors that distinguishes directed DNA bends from regions of increased flexibility and other DNA distortions. This analysis provides information about the structural properties of DNA within macromolecular complexes that are too large to be studied by traditional methods of structure determination. The information gained represents the average properties of protein-DNA complexes under conditions that resemble the physiological environment in which transcription factors operate. Given the likely importance of DNA bending in gene regulation in both prokaryotes and eukaryotes, this type of analysis could be of broad utility in the investigation of transcription factor functions. Several transcription regulatory proteins in both prokaryotes and eukaryotes have been shown to distort DNA by circular permutation analysis (Kim et al., 1989; Rojo et al., 1990; Gustafson et al., 1989; Vignais and Sentenac, 1989; Schreck et al., 1990). However, circular permutation analysis does not specifically detect DNA bends, as such analysis can be affected by other distortions in DNA structure. Indeed, both we (T. K. K. and T. C., unpublished data) and others (Gartenberg et al., 1990) have found that some complexes that induce little or no directed DNA bending, based on phasing analysis, can cause significant DNA flexure, as determined by circular permutation analysis. Such complexes may cause increased DNA flexibility or may induce some other structure that has a positiondependent effect on complex mobility. In the case of Fos and Jun, however, the phasing analysis clearly demonstrates that both Fos-Jun heterodimers and Jun homodi-

Fos and Jun 323

Bend DNA

plexes of leucine zipper/basic region proteins (Vinson et al., 1989; O’Neil et al., 1990). The opposite orientations of DNA bending induced by Fos-Jun heterodimers and Jun homodimers suggest that the topologies of the two complexes differ considerably. Consideration of the DNA helix trajectories in combination with the a-helical secondary structures of the DNA-binding domains and the predicted DNA contact regions has allowed the construction of molecular models of the Fos-Jun-DNA and Jun-DNA complexes that satisfy all of the currently available data (T. K. K. and T. C., unpublished data).

mers cause directed DNA bends. Surprisingly, the two complexes display diametrically opposing phasing with the intrinsic DNA bend and therefore bend DNA in opposite orientations. Phase-sensitive detection has been previously used for the analysis of DNA bends induced by CAP (Zinkel and Crothers, 1987), y8 resolvase (Salvo and Grindley, 1988) and IHF (Snyder et al., 1989). However, we show that Fos and Jun can induce opposite orientations of bending at the same DNA sequence.

Role of DNA Bending in Sequence-Specific DNA Binding The AP-1 and CRE sites are recognized by a variety of leucine zipper/basic region proteins including the Fos-, Jun-, CREB-, and ATF-related proteins as well as GCN4. These proteins do not form a single subfamily within the leucine zipper/basic region protein family, based on analysis of sequence similarities within the DNA-binding domain (Kerppola and Curran, 1991). Nor do these proteins share any unique set of amino acid residues in the basic region apart from those conserved throughout the leucine zipper/ basic region protein family. The AP-1 and CRE sites may therefore have a unique structural flexibility that allows DNA distortion by leucine zipper/basic region proteins. Initial studies of DNA distortion by GCN4 suggested that GCN4 induces a structural distortion but does not cause a directed DNA bend (Gartenberg et al., 1990). Additional studies of DNA distortion and bending by different AP-1 binding proteins will be required to determine the role of DNA flexibility in sequence-specific DNA binding by this protein family.

Structures of the Fos-Jun Heterodimer and Jun Homodimer DNA-Binding Complexes B-DNA has figured prominently in the construction of molecular models of DNA-binding complexes of proteins for which no X-ray crystal structure of the protein-DNA complex has been available. Indeed, previously proposed models for the DNA-binding complexes of leucine zipper/ basic region proteins assume a canonical B-DNA-binding site (Vinson et al., 1989; O’Neil et al., 1990). However, the X-ray crystal structures of protein-DNA complexes that have been solved show that the DNA structures frequently deviate from standard B-DNA (Steitz, 1990 and references therein). These deviations range from changes in the local structures of the bases to changes in the overall twisting and bending of the DNA helix. The DNA bend angles and bend orientations determined here for the Fos-Jun heterodimer and Jun homodimer complexes provide information about the path of the DNA helix within the protein-DNA complexes. Shown in Figure 5 are the predicted DNA helix trajectories for Fos-Jun heterodimer and Jun homodimer complexes bound to probes containing either no intrinsic bend, an intrinsic bend centered 21 bp from the center of the AP-1 site, or an intrinsic bend centered 28 bp from the center of the AP-1 site. These DNA helix trajectories are difficult to reconcile with existing models for the DNA-binding com-

Role of DNA Bending in Transcription Regulation Protein-induced DNA bending provides a mechanism that can regulate the interaction of factors bound to separate sites on DNA (Moitoso de Vargas et al., 1989; Kim et al., 1990). Furthermore, by changing the orientation and magnitude of the bend, DNA-bending proteins can select among different potential protein-protein interactions in a region containing multiple factors bound to DNA (Moitoso de Vargas and Landy, 1991). DNA-bending proteins have been shown to participate in the regulation of several prokaryotic promoters containing upstream regulatory elements (Gober and Shapiro, 1990; Hoover et al., 1990). Thus, DNA-bending proteins can function cooperatively with other DNA-binding proteins to regulate transcription. Fos and Jun have been shown to act cooperatively with the glucocorticoid receptor to regulate transcription of the prolactin gene (Diamond et al., 1990). Interestingly, in combination with the glucocorticoid receptor, Fos and Jun have opposite effects on transcriptional activity. We show here that Fos-Jun heterodimers and Jun homodimers bend DNA in opposite orientations. Peptides containing the dimerization and DNA-binding domains of Fos and Jun induced DNA bends in the same orientations as the full-length proteins, suggesting that the region determining bend orientation was located in these domains. These same regions of the proteins are sufficient to confer oppo-

Figure 5. Schematic Diagrams of the DNA Trajectories Heterodimers and Jun Homodimers Bound to Different The DNA trajectories of Jun homodimer (A, B, and heterodimer (D, E, and F) complexes bound to probes no intrinsic bend (A and D), an intrinsic bend (dotted bp from the center of the AP-I site (B and E), or centered 26 bpfrom the AP-I site (C and F) predicted function amplitudes.

for Fos-Jun Probes

C) and Fos-Jun containing either line) centered 21 an intrinsic bend based on phasing

Cell 324

site transcriptional effects in combination with the glucocorticoid receptor (K. Yamamoto, personal communication). Additional regions outside the dimerization and DNAbinding domains of both Fos and Jun influence the magnitude of the DNA bend angle. These regions correspond to domains that have been previously shown (Abate et al., 1991) to contribute to transcription activation. The regions outside the dimerization and DNA-binding domains did not affect the orientation of bending, and there are no differences in the DNA contacts between the full-length proteins and the leucine zipper/basic region peptides (Abate et al., 1991). Therefore, we propose that these domains influence DNA bending by altering the conformation of the leucine zipper/basic region rather than by directly affecting DNA structure. This interpretation is consistent with previous observations indicating that domains outside of the leucine zipper and basic regions influence the affinity of DNA binding (Abate et al., 1991; Cohen and Curran, 1990). This correspondence between regions of Fos and Jun that influence the orientation and angle of DNA bending and domains that contribute to transcriptional activity supports a role for DNA structure in transcription activation by Fos and Jun but does not exclude the possibility that other mechanisms may also be involved. Experimental

Procedures

Plasmid Construction and Probe Preparation Plasmid pTK401 was prepared by insertion of the synthetic oligonucleotide CTAGATGCTGACTCATTGTCGA, containing the AP-I site found in the human collagenase gene, between the Xbal and Sall restriction sites in plasmid pBend2 (Kim et al., 1989). Plasmids pTK401-21, pTK401-23, pTK401-26, pTK401-28, and pTK401-30 were constructed by inserting the following oligonucleotides between the same sites in the pBend2 vector: CTAGATGCTGACTCATTGGCAAAAACGGGCAAAAACGGGCAAAAACGGTCGA; CTAGATGCTGACTCATTGTCGCAAAAACGGGCAAAAACGGGCAAAAACGGTCGA; CTAGATGCTGACTCATTGTCGACGCAAAAACGGGCAAAAACGGGCAAAAACTCGA; CTAGATGCTGACTCATTGTCGACACGCAAAAACGGGCAAAAACGGGCAAAAACTCGA; and CTAGATGCTGACTCATTGTCGACTGACGCAAAAACGGGCAAAAACGGGCAAAAACTCGA, respectively. DNA probes for electrophoretic mobility shift analysis were prepared both by restriction enzyme cleavage of plasmid DNA and by polymerase chain reaction (PCR) amplification of the tandem duplication, using primers complementary to flanking sequences in the presence of radioactive deoxynucleotides. The PCR amplification product was purified by isolation from a polyacrylamide gel and digested with the appropriate restriction endonucleases to prepare probes for circular permutation analysis or used for phasing analysis. There were no differences in the mobility patterns obtained for probes prepared from plasmid DNA or from PCR-amplified fragments. Preparation of Proteins Full-length Fos and Jun proteins and peptides corresponding to amino acid residues 116-211 and 139-211 of Fos, as well as 224-334 and 240-334 of Jun, were expressed as hexahistidine fusion proteins in E. coli and purified to greater than 90% homogeneity by nickel chelate affinity chromatography as previously described (Abate et al.: 1990a, 1990b). Dimeric protein complexes were prepared by association of the appropriate proteins under the conditions previously described (Abate et al., 1990b), with the exception that the protein concentrations in the association reaction were 1 nM for each protein.

relative mobilities of the protein-DNA complexes were analyzed by polyacrylamide gel electrophoresis (7.76% acrylamide:0.24% bisacrylamide) in a 25 mM Tris, 195 mM glycine (pH 8.9) buffer. Electrophoresis was performed at 4OC at a field strength of 7 V/cm. Some of the experiments were performed in a temperature-controlled gel apparatus, in which the gel was submerged in a constant temperature buffer chamber. However, no change in gel temperature or in the mobility patterns was observed when the gel was not submerged, and thus the majority of experiments were performed in a standard electrophoresis apparatus at 4°C. Calculation of DNA Bend Parameters For circular permutation analysis, the complex mobilities were normalized to the mobility of the fastest migrating complex and plotted as a function of the distance from the center of the AP-I site to the ends of the probe. To facilitate quantitative analysis, the best fit of the relative mobilities to a cosine function was determined. We will use the term circular permutation function to refer to this best fit relationship. The center of DNA flexure was determined from the maximum of the circular permutation function. The DNA flexure angles were determined from the amplitude of the circular permutation function by comparison with the mobility variations induced by intrinsic DNA bend standards. Two sets of standards containing intrinsically bent DNA sequences were used to calibrate the relationship between bend angle and mobility variation. The first set of standards were provided by Thompson and Landy and contain from two to nine phased A:T tracts inserted between tandem repeats of heterologous sequences (plasmids pJTl70-n; n = 2-9) (Thompson and Landy, 1988). The mobility anomalies induced by these intrinsic bends followed a cosine function of the bend angle, as shown previously (Thompson and Landy, 1988). However, the lengths and sequences of this set of standards differed from those used in the circular permutation analysis. To correct for differences in lengths and sequences, we used the circular permutation function amplitudes of a second set of standards containing three phased A:T tracts at different positions adjacent to the AP-1 site in the circular permutation analysis plasmids (plasmids pTK401-21, 23, 26, 28, and 30 described above). For phasing analysis, the complex mobilities were corrected for variations in probe mobilities and then normalized to the average mobility of all complexes and plotted as a function of the length of the spacer between the AP-1 site and the intrinsic DNA bend. The best fit of the relative mobilities to a cosine function was determined. We use the term phasing function to refer to this best fit relationship. The orientation of DNA bending was determined from the minima of the phasing function, which are predicted to be the spacer lengths at which the protein-induced DNA bend maximally cooperates with the intrinsic DNA bend. Identical results were obtained by using the maxima of the phasing function, at which the protein-induced bend counteracts the intrinsic bend. The helical periodicity of the sequences between the intrinsic bend and the center of the AP-I site was assumed to be 10.5 bp per turn of the DNA helix; however, variations in periodicity such as those observed for different DNA sequences (9.9-11 .O) (Peck and Wang, 1981; Rhodes and Klug, 1981) and protein-DNA complexes (10.1-l 1.2) (Steitz, 1990 and references therein) are not sufficiently large to significantly affect the predicted bend orientations. Acknowledgments We wish to thank Cory Abate for help and advice on protein purification using nickel chelate affinity chromatography and for providing Fos and Jun DNA-binding domain peptides for these experiments. We are also grateful to Donald Nuss and Craig Rosen for critical reading of the manuscript. T. K. K. is supported by a postdoctoral fellowship from the Helen Hay Whitney Foundation. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 USC Section 1734 solely to indicate this fact. Received

Electrophoretic Analysis of DNA Conformation The protein dimers were incubated with the probes under the conditions previously described (Abate et al., 1990b). The final dimer and probe concentrations were 0.1 nM and 0.01 uM, respectively. The

March

21, 1991; revised

May 30, 1991.

References Abate, C., Luk, D., and Curran,

T. (1990a).

Aubiquitous

nuclear

protein

Fos and Jun Bend DNA 325

stimulates the DNA-binding Growth Diff. 7, 455-462. Abate, C., Expression domains of Natl. Acad.

activity

of fos and jun indirectly.

Ceil

Rauscher, F. J., III, Gentz, R., and Curran, T. (1990b). and purification of the leucine zipper and the DNA-binding Fos and Jun: both Fos and Jun directly contact DNA. Proc. Sci. USA 87, 1032-1036.

Abate, C., Luk, D., and Curran, T. (1991). Transcriptional by Fos and Jun in vitro: interaction among multiple activator latory domains. Mol. Cell. Biol. 77, 3624-3632.

regulation and regu-

Baur, C-P., and Knippers, R. (1988). Protein-induced bending of the simian virus 40 origin of replication. J. Mol. Biol. 203, 1009-1019. Bohmann, D., Bos, T. J., Admon, A., Nishimura, T., Vogt, P. K., and Tjian, R. (1987). Human proto-oncogene c-jun encodes a DNA binding protein with structural and functional properties of transcription factor AP-1. Science 238, 1386-1392. Bracco, L., Kotlarz, D., Kolb, A., Diekmann, S., and But, Synthetic curved DNA sequences can act as transcriptional in Escberichia co/i. EMBO J. 8, 4289-4296.

H. (1989). activators

Brennan, R. G., Roderick, S. L., Takeda, Y., and Matthews, B. W. (1990). Protein-DNA conformational changes in the crystal structure of a h Cro-operator complex. Proc. Natl. Acad. Sci. USA 87, 81658169. Cohen, D. R., and Curran, T. (1990). Analysis of dimerization and DNA binding functions in Fos and Jun by domain-swapping: involvement of residues outside the leucine zipper/basic region. Oncogene 5, 929939. Cohen, D. R., Ferreira, P. C. P., Gentz, R., Franza, B. R., Jr., and Curran, T. (1989). The product of a Fos-related gene Fra-1 binds cooperatively to the AP-1 site with Jun: transcription factor AP-I is comprised of multiple protein complexes. Genes Dev. 3, 173-1.84. Curran, T., and Vogt, P. K. (1991). Dangerous liaisons: Fos and Junoncogenic transcription factors. In Transcription Regulation, K. Yamamoto and S. McKnight, eds. (Cold Spring Harbor, New York: Cold Spring Harbor Laboratory), in press. Diamond, M. I., Miner, J. N., Yoshinaga, S. K., and Yamamoto, K. R. (1990). cJun and c-Fos levels specify positive or negative glucocorticoid regulation from a composite GRE. Science 249, 1266-1272. Distel, R. J., Ro, H.-S., Rosen, B. S., Groves, D. L., and Spiegelman, B. M. (1988). Nucleoprotein complexes that regulate gene expression in adipocyte differentiation: direct participation of c-fos. Cell 49, 835844. Franza, (1988). quence 1153.

B. R., Jr., Rauscher, F. J., Ill, Josephs, S. F., and Curran, T. The Fos complex and Fos-related antigens recognize seelements that contain API binding sites. Science 239, 1150-

Gartenberg, M. R., Ampe, C., Steitz, T. A., and Crothers, D. M. (1990). Molecular characterization of the GCN4-DNA complex. Proc. Natl. Acad. Sci. USA 87, 6034-6038. Gober, J. W., and Shapiro, L. (1990). for the activation of developmentally Genes Dev. 4, 1494-1504.

Integration regulated

host factor is required genes in Caulobacter.

Goodman, S. D., and Nash, H. A. (1989). Functional replacement of a protein-induced bend in a DNA recombination site. Nature 347,251254. Gustafson, T. A., Taylor, A., and Kedes, L. (1989). DNA bending is induced by a transcription factor that interacts with the human c-fos and a-actin promoters. Proc. Natl. Acad. Sci. USA 86, 2162-2166. Hai, T., and Curran, T. (1991). FosNun and ATF/CREB cross-family dimerization alters DNA binding specificity. Proc. Natl. Acad. Sci. USA 88,3720-3724. Hoover, T. R., Santero, E., Porter, S., and Kustu, S. (1990). The integration host factor stimulates interaction of RNA polymerase with NIFA, the transcriptional activator for nitrogen fixation operons. Cell 63, 1 l22. Htun, H., and Dahlberg, J. E. (1988). Single strands, and kinks in H-DNA. Science 247, 1791-1796.

triple strands,

by gene-regulatory proteins: vector. Gene 85, 15-23.

construction

and use of a DNA bending

Kim, S., Moitoso de Vargas, L., Nunes-Dtiby, S. E., and Landy, A. (1990). Mapping of a higher order protein-DNA complex: two kinds of long-range interactions in h artL. Cell 63, 773-781. Koo, H.-S., Drak, J., Rice, J. A., and Crothers, D. M. (1990). tion of the extent of DNA bending by an adenine-thymine chemistry 29, 4227-4234.

Determinatract. Bio-

Lee, W., Mitchell, P., and Tjian, R. (1987). Purified transcription factor AP-1 interacts with TPA-inducible enhancer elements. Cell 49, 741752. Lerman, L. S., and Frisch, H. L. (1982). Why does the electrophoretic mobility of DNA in gels vary with the length of the molecule? Biopoly mers 27, 995-997. Levene, S. D., and Zimm, 8. H. (1989). Understanding electrophoresis of bent DNA molecules: a reptation 245, 396-399. Levene, flexibility

S. D., Wu, H.-M., and Crothers, of kinetoplast DNA. Biochemistry

the anomalous model. Science

D. M. (1986). Bending 25, 3988-3995.

Lumpkin, 0. J., Dejardin, P., and Zimm, B. H. (1985). electrophoresis of DNA. Biopolymers 24, 1573-1593.

Theory

and of gel

McAllister, C. F., and Achberger, E. C. (1989). Rotational orientation of upstream curved DNA affects promoter function in Bacillus subtilis. J. Biol. Chem. 264, 10451-10456. Moitoso de Vargas, L., and Landy, A. (1991). A switch of alternative DNA loops modulates h site-specific Proc. Natl. Acad. Sci. USA 88, 588-592.

in the formation recombination.

Moitoso de Vargas, L., Kim, S., and Landy, A. (1989). DNA looping generated by DNA bending protein IHF and the two domainsof lambda integrase. Science 244, 1457-1461. C’Neil, K. T., Hoess, DNA-binding peptides 774-778.

R. H., and DeGrado, W. F. (1990). Design of based on the leucine zipper motif. Science 249,

Patel, L., Abate, C., and Curran, T. (1990). Jun results in altered protein conformation.

DNA binding by Fos and Nature 347, 572- 574.

Peck, L. J., and Wang, J. C. (1981). Sequence dependence helical repeat of DNA in solution. Nature 292, 375-378.

of the

Rauscher, F. J., Ill, Cohen, D. R., Curran, T., Bos, T. J., Vogt, P. K., Bohmann, D., Tjian, R., and Franza Jr., B. R. (1988). Fos-associated protein p39 is the product of the iun proto-oncogene. Science 240, 1010-1016. Rhodes, D., and Klug, A. (1981). Sequence-dependent ity of DNA. Nature 292, 378-380.

helical periodic-

Risse, G., Jooss, K., Neuberg, M., Bruller, H.-J., and Miiller, R. (1989). Asymmetrical recognition of the palindromic API binding site (TRE) by Fos protein complexes. EMBO J. 8, 3825-3832. Rojo, F., Zaballos, A., and Salas, M. (1990). Bend induced by the phage rp29 transcriptional activator in the viral late promoter is required for activation. J. Mol. Biol. 277, 713-725. Ryseck, R.-P., and Bravo, R. (1991). c-Jun, Jun B, and Jun D differ in their binding affinities to AP-I and CRE consensus sequences: effect of Fos proteins. Oncogene 6, 533-542. Salvo, J. J., and Grindley, N. D. F. (1987). Helical DNA bends and the determination of bend direction. 15, 9771-9779. Salvo, J. J., and Grindley, N. D. F. (1988). They6 res site into a recombinogenic complex. EMBO

phasing between Nucl. Acids Res.

resolvase bends the J. 7, 3609-3616.

Schreck, R., Zorbas, H., Winnacker, E.-L., and Baeuerle, P. A. (1990). The NF-KB transcription factor induces DNA bending which is modulated by its 65kD subunit. Nucl. Acids Res. 78, 6497-6502. Snyder, U. K., Thompson, J. F., and Landy, protein-induced DNA bends in a recombination 255-257.

A. (1989). Phasing of complex. Nature 347,

Kerppola, T. K., and Curran, T. (1991). Transcription factor interactions: basics on zippers. Curr. Opinion Struct. Biol. 7, 71-79.

Sonnenberg, J. L., Rauscher, F. J., Ill, Morgan, J. I., and Curran, T. (1989). Regulation of proenkephalin by Fos and Jun. Science 246, 1622-l 625.

Kim, J., Zwieb,

Steitz, T. A. (1990).

C., Wu, C., and Adhya,

S. (1989).

Bending

of DNA

Structural

studies

of protein-nucleic

acid interac-

Cell 326

tion: the sources 23, 205-280.

of sequence-specific

binding.

Quart.

Rev. Biophys.

Talanian, Ft. V., McKnight, C. J., and Kim, P. S. (1990). Sequencespecific DNA binding by a short peptide dimer. Science 249,769-771. Thompson, J. F., and Landy, A. (1988). Empirical estimation induced DNA bending angles: applications to h site-specific nation complexes. Nucl. Acids Res. 16, 9687-9705.

of proteinrecombi-

Vignais, M.-L., and Sentenac, A. (1989). Asymmetric DNA bending induced by the yeast multifunctional factor TUF. J. Biol. Chem. 264, 8463-8466. Vinson, C. R., Sigler, P. B., and McKnight, S. L. (1989). model for DNA recognition by a family of leucine zipper ence 246, 91 I-91 6. Wang, J. C., and Giaever, G. N. (1988). DNA. Science 240, 300-304.

Action

Scissors-grip proteins. Sci-

at a distance

along a

Weiss, M. A., Ellenberger, T. E., Wobbe, C. Ft., Lee, J. P., Harrison, S. C., and Struhl, K. (1990). Folding transition in the DNA-binding domain of GCN4 on specific binding to DNA. Nature 347, 575-578. Williams, J. S., Eckdahl, functions as a replication Cell. Biol. 8, 2763-2769.

T. T., and Anderson, J. N. (1988). Bent DNA enhancer in Saccharomyces cerevisiae. Mol.

Wu, H.-M., and Crothers, D. M. (1984). Thelocusof sequence-directed and protein-induced DNA bending. Nature 308, 509-513. Zahn, K., and Blattner, F. R. (1987). Direct evidence for DNA bending at the lambda replication origin. Science 236, 416-422. Zinkel, S. S., and Crothers, D. M. (1987). DNA bend direction sensitive detection. Nature 328, 178-l 81.

by phase