Cell Biology International ISSN 1065-6995 doi: 10.1002/cbin.10427
SHORT COMMUNICATION
Fndc5 overexpression facilitated neural differentiation of mouse embryonic stem cells Mahboobeh Forouzanfar1,2, Farzaneh Rabiee1, Kamran Ghaedi1,2, Siamak Beheshti2, Somayeh Tanhaei1, Alireza Shoaraye Nejati1, Mohammad Jodeiri Farshbaf1, Hossein Baharvand3,4 and Mohammad Hossein Nasr-Esfahani1 1 Department of Cellular Biotechnology at Cell Science Research Center, Royan Institute for Biotechnology, ACECR, Isfahan, Iran 2 Department of Biology, School of Sciences, University of Isfahan, Isfahan, Iran 3 Department of Stem Cells and Developmental Biology at Cell Science Research Center, Royan Institute for Stem Cell Biology and Technology, ACECR, Tehran, Iran 4 Department of Developmental Biology, University of Science and Culture, ACECR, Tehran, Iran
Abstract Fndc5 has been recently recognized as a myokine which could be cleaved and secreted into blood stream. It is termed as irisin with an important role in thermogenesis and energy homeostasis. Increased expression of Fndc5 has been reported upon retinoic acid treatment during neural differentiation and its knockdown decreased neural differentiation and neurite outgrowth. This study tries to evaluate the effect of Fndc5 overexpression on rate of neural differentiation in mouse. (Thus, transduced cell line of mouse embryonic stem cell with ability to express Fndc5 under Doxycycline treatment was established. Subsequently, the effect of overexpression of Fndc5 on different stages of neural differentiation was studied). Our study showed an increase enhancement in neuronal precursor markers and mature neuron markers upon overexpression of Fndc5, concluding that Fndc5 facilitates neural differentiation. This effect might be related to increased expression of BDNF following overexpression of Fndc5. Our findings are consistent with recent studies reporting a similar role for Fndc5 in proliferation of neural cells and increase in the expression of neurotrophins like BDNF. Keywords: BDNF; gene expression; mouse embryonic stem cell; neural differentiation
Introduction Firbonectin type III domain containing 5 (Fndc5) was identified in 2002 and was initially named peroxisomal protein (PEP). This protein is composed of 209 amino acid residues. Fndc5 has two hydrophobic domains between the amino acid residues 12–31 and 151–168 and a firbronectin type III domain between 31–114 amino acid residues (Tanhaie et al., 2009). The functions of Fndc5 domains are not fully understood yet. Moreover, there is a tripeptide sequence at the C-terminus of Fndc5 and already was recognized as being
important for peroxisomal sorting of this protein (Ostadsharif et al., 2009). A recent study by Bostrom et al. (2012) showed that Fndc5 is a myokine, the expression of which is increased upon exercise and could be cleaved to a shorter fragment termed, Irisin. Fndc5 is also highly expressed in heart and skeletal muscles of adult mouse (Ferrer-Martines et al., 2002). Furthermore, previous studies by our group have revealed high amount of Fndc5 in transcriptional levels upon treatment with retinoic acid (RA) during neural differentiation of mouse embryonic stem cells (mESCS) and P19 cells (Ostadsharif et al., 2011). Recently, we have reported that Fndc5 knockdown
Corresponding authors: e-mails: [email protected] (K.G.); [email protected] (M.H.N-E); [email protected] (H.B) Abbreviations: BDNF, brain-derived neurotrophic factor; BSA, bovine serum albumin; CDS, coding sequence; DAPI, 4,6-diamidio-2-phenylindole; DMEM, dulbecco’s modified Eagle medium; Dox, doxycycline; EBs, embryoid bodies; ES-FCS, embryonic stem cells qualified-FCS; FCS, fetal calf serum; Fndc5, fibronectin type III domain containing 5; FRCP2, fibronectin type III repeat containing protein 2; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; GFAP, glial fibrillary acidic protein; HRP, horseradish peroxidase; LIF, leukemia inhibitory factor; mESC, mouse embryonic stem cell; PEP, peroxisomal protein; Pen Strep, Penicillin-Streptomycin; RA, retinoic acid; RT, room temperature; K-DMEM, knock out- DMEM; LIF, leukemia inhibitory factor; MAP2, microtubule-associated protein 2; MOI, multiplicity of infection; NP, neural progenitor; PBS, phosphate-buffered saline; PLO, poly-LOrnithine; PVDF, polyvinylidenedifluoride; SEM, standard error of mean; Sox1, SRY-box containing gene1; Sox3, SRY-box containing gene 3; TRITC, tetramethyl rhodamine isothiocyanate
Cell Biol Int 39 (2015) 629–637 © 2015 International Federation for Cell Biology
629
Fndc5 overexpression and neural differentiation
M. Forouzanfar et al.
decreases the rate of neural differentiation in mouse embryonic stem cells (Hashemi et al., 2013). Information emerging from systemic knock-out/-down studies alone is insufficient to deduce gene function. Generally, overexpression a wild-type gene provides geneticists with an alternative powerful tool to identify pathway components that might remain undetected using traditional loss-of-function analysis (Prelich, 2012). To further expand our knowledge on the role of Fndc5 during neurogenesis, we established a line of mouse embryonic stem cells (mESCs) which was stably transduced with an inducible lentiviral particles encoding mouse Fndc5. Furthermore, overexpression of Fndc5 will advance our understanding of neural differentiation of Fndc5, and whether its expression dosage could affect neural differentiation or not. Materials and methods
mESCs culture and neural differentiation We used mESCs cells (Royan B20 cells) derived from C57BL/6 mouse strain. These cells were obtained from Royan Institute for Stem Cells and Developmental Biology (Tehran, Iran) and cultured as described previously (Hassani et al., 2014). Meanwhile, neural differentiation was carried out according to Hashemi et al. (2013). The recombinant
vector pLVX-Tigh-Puro-Fndc5 was constructed as described in the Supporting Information and was used to induce the expression of Fndc5 in mESCs.
Lentiviral vector transduction for generation of stable mESCs The production of lenti-viral particles and titration was carried out as described in the Supporting Information. mESCs were seeded at a density of 2 105 cells in each well per 6-well dish (TPP, USA) (Salmon and Trono, 2006). Next day, cells were transduced with the lentiviral particles at multiplicity of infection (MOI) of 10, for producing rtTA and Fndc5 in target cells according to the protocol (Lenti-XTM Lentiviral Expression Systems User Manual, Clontech). Two days post-transduction, the cells were treated with 1 mg/ml puromycin (Sigma) and 400 mg/mL G418 (Gibco) for selection of stable transduced cells. The medium was changed on a daily basis until stable colonies appeared (after10–14 days). To ensure the isolation of stable transduced cells, genomic DNA was extracted from antibiotics resistant grown cells using DNeasy Blood and Tissue Kit (Qiagen). Approximately 150 ng of the cellsderived genome was used for PCR to detect the rtTA and puromycin encoding fragments using specific primers (Table 1B).
Table 1 List of primers used in this study. A) Primers used for construction of pLVX-Tight-Puro-Fndc5 Gene
Forward Primer (50 –30 )
Fndc5 CDS GCGGCCGCATGCCCCCAGGG* B) Primers used for transduced mESCs line Genes Forward Primer (50 -30 ) CMV-rtTA CGCAAATGGGCGGTAGGCGTG Puromycin GCTCGACATCGGCAAGGTG C) Primers used for gene expression analysis by Q-PCR Genes Forward Primer (50 –30 ) FNDC5 TCATTGTTGTGGTCCTCTTC Olig2 CTGAACACTCCAAGGGTCTG Map2 AAGTCACTGATGGAATAAGC b-tubulin III GCCTCCTCTCACAAGTATG GFAP CTCCAAGATGAAACCAAC Pax6 TGAATGGGCGGAGTTATGAT Sox1 CAGAAGGAGGATGGGTTGTG Sox3 ACCGAAGATGAGGAGGAC Neurocan CCATCCACACCGACATCAC Nanog TGAGCTATAAGCAGGTTAAGAC Rex1 CCAGTCCAGAATACCAGAGT BDNF TGGCCCTGCGGAGGCTAAGT Gapdh TGCCGCCTGGAGAAACC
Reverse Primer (50 –30 )
AT ( C)
ACGCGATCATATCTTGCTGCGGAGGAGAC**
68
Reverse Primer (50 –30 ) AGGAGAGCACAGCGGAATG GGCGGTGACGGTGAAGCC
AT ( C) 60 54
Reverse Primer (50 –30 ) GCTCGTTGTCCTTGATGATA CTCTGCGTCTCGTCTAAGC CTCTGCGAATTGGTTCTG CCTCCGTATAGTGCCCTT GCAAACTTAGACCGATACC GGACGGGAACTGACACTC GGGAGGGGATGGGATAAGAC CAAACACCACAGCGATTC GGTCCCCAAGGAAACACTC CAATGGATGCTGGGATACTC AGCCATCTTCCTCAGTCT AGGGTGCTTCCGAGCCTTCCT TGAAGTCGCAGGAGACAACC
AT ( C) 60 63 54 54 61 58 56 54 60 55 60 55 60
Accession No NM_027402.2 NM_016967.2 NM_001039934.1 NM_023279.2 NM_001131020 NM_001244198.1 NM_009233.3 NM_009237.2 NM_007789.3 NM_028016.2 NM_009556.3 M_001048139.1 NM_008084.2
AT is annealing temperature of PCR, *Not I site is underlined, ** Mlu I site is underlined.
630
Cell Biol Int 39 (2015) 629–637 © 2015 International Federation for Cell Biology
M. Forouzanfar et al.
Induction of Fndc5 expression during neural differentiation
Fndc5 overexpression and neural differentiation
Immunocytochemistry analysis
To induce the overexpression of Fndc5, cells were treated with 750 mg/mL of Dox (Clonetech) between day 2 and day 6, during formation of neural precursor (NP) cells or from day 2 to day 14 during formation of neural precursor (NP) cells and differentiated neural cells, when mature neurons emerged. In transduced cells, rtTA was continuously expressed while rtTA activation occurred in the presence of Dox (þDox). The activated rtTA binds to the respective inducible promoter (PTight) of Fndc5, thereby resulting in over-expression of Fndc5.
Indirect immunofluorescence light microscopy was performed as already described (Ostadsharif et al., 2011). Primary antibody was anti-mouse antibodies against MapII (1:200, Sigma–Aldrich) and secondary antibody was tetramethyl rhodamine isothiocyanate (TRITC)— conjugated goat anti-mouse IgG (1:50, Chemicon). Nuclei were counterstained with 4, 6-diamidio-2-phenylindole (DAPI, Sigma–Aldrich). Stained slides were observed under a fluorescent microscope (Olympus, Japan) and images were acquired with an Olympus DP70 camera (Olympus, Japan).
Western blot
Statistical analysis
Cells were washed with PBS and lysed with TRI reagent (Sigma, USA). RNA and protein were extracted and approximately 30 mg of protein was run on SDS–PAGE and transferred to a polyvinylidenedifluoride (PVDF; Biorad, USA) membrane. Subsequently, the membranes were blocked with 10% skim milk for 1 h (W/V, Merck, USA), then incubated with primary antibody solution for 1.5 h at RT. The following antibodies were used for western blotting: monoclonal anti-microtubule associated protein 2 (MAP2) antibody (1:10,000, Sigma), monoclonal anti-b tubulin Isotype III (1:2000, Sigma) and monoclonal anti-glial fibrillary acidic protein (GFAP) antibody (1:8000, Millipore, USA) and mouse anti-glyceraldehyde-3-phosphate dehydrogenase, clone 6C5 (1:5000, Millipore). HRP-coupled IgG antibody (1:5000) (Dako, Japan) was used as secondary antibody. Finally, protein bands were visualized by an Amersham ECL Advance Western Blotting Detection Kit (GE Healthcare, Germany). Signal intensity of the visualized bands was measured using Image J processing and analysis software.
SPSS (Version 17, USA) was used for data analysis and mean standard error of mean (SEM) were reported. Oneway analysis of variance (ANOVA) was performed to identify the statistical differences between treated groups and control. Meanwhile, P 0.05 was considered to be significant.
RNA extraction and Real Time PCR The extracted RNA with TRI reagent was used for cDNA synthesis (Thermo Scientific). DNase treatment was performed with 1 mg of total RNA and cDNA was synthesized with random hexamer primer utilizing MMLV reverse transcriptase (Thermo Scientific). Fifty nanograms of cDNA was used for quantitative real time PCR (Thermal Cycler Rotor-Gene 6000, Corbett, Australia) with SYBR green (TaKaRa, Japan) using specific primers (Table 1C). Expressions of target genes were normalized with glyceraldehyde 3-phosphate dehydrogenase (Gapdh) gene expression level. The experiments were performed in triplicate and data were analyzed according to the DDCt method. Cell Biol Int 39 (2015) 629–637 © 2015 International Federation for Cell Biology
Results
Establishment of a stable transduced mESCs Data confirmed significant overexpression of Fndc5 in stable transduced mESCs cells with pLVX-Tight- Fndc5 (Figure 1A). No significant differences in expression level of stemness markers, Nanog and Rex1, were detected between transduced and control cells (Figure 1B), indicating that Fndc5 over-expression did not have an effect on the stemness properties of transduced mESCs.
Induction of Fndc5 expression during NPs formation To generate NPs, two transduced cell lines (pLVX-TightPuro-Fndc5 and pLVX-Tight-Puro) and un-transduced cells were treated with RA (1mm) for 4 days (Ostadsharif et al., 2011). Induction of Fndc5 overexpression by Dox was also simultaneously performed with the RA treatment as shown in Figure 2A. Quantitative real time PCR on day 6 indicated an increase in Fndc5 transcriptional level in the pLVX-Tight-Puro-Fndc5 transduced cell which was significantly higher than un-induced cell line (-Dox) and also with Dox treated pLVX-Tight-Puro transduced and un-transduced cell lines (Figure 2B). Of interest, the expression of early neural markers (Pax6, Sox1, Sox3) were significantly increased upon Fndc5 induced overexpression (Figure 2D). Furthermore, the transcription rate of stemness markers were significantly reduced by overexpression of Fndc5 (Figure 2C). 631
Fndc5 overexpression and neural differentiation
M. Forouzanfar et al.
Figure 1 Characterization of a transduced stable mESCs line (A) Quantitative real-time RT-PCR showed a significant increase in Fndc5expression under Doxycycline induction (þDox) relative to un-induced condition (-Dox) in pLVX-Tight -Puro-Fndc5 transduced cells. Similar alphabets indicate significant difference between same samples at P < 0.001. (B) Quantitative real time analysis of stem cell markers, Nanog (Left panel) and Rex (Right panel), expression in transduced cells. Stably transduced mESCs with pLVX-Tight -Puro-Fndc5 and pLVX-Tight -Puro showed no significant change in stem cell markers of þDox state to -Dox with respect to the un-transduced cell line (mESCs line, Royan B20 cell line). All relative expressions were quantified and normalized with Gapdh transcript level. Represented value bars are the mean of triplicate independent experiments SEM.
Following overexpression of Fndc5 during RA induction (day 2–6), treated NPs were plated for 8 more days in order for neural differentiation to take place (Figure 3A) (Hashemi et al., 2013). The expression levels of mature neuronal markers (Map2, b-tubulinIII and Neurocan) and astrocyte marker (Gfap) significantly increased in Fndc5 expressing cells compared to controls, while no significant difference was detected for oligodendrocyte marker (Olig2). To confirm the data of the real time PCR, western blot was also carried out by utilizing antibodies against Map2, btubulinIII and Gfap and similar results were obtained and supported real time PCR data (Figure 3C). Interestingly, the expression level of BDNF as neuroprotective marker was also significantly increased by overexpression of Fndc5 (Figure 3D).
Induction in Fndc5 expression during and post formation of NPs To further define the overexpression of Fndc5 during neurogenesis, its overexpression was performed from day 2 to day 14 by treating with Dox, as illustrated in Figure S3A. The overexpression of Fndc5 was significantly higher in 632
pLVX-Tight-Puro-Fndc5 cell line in comparison with the controls (Figure S3B). The over expression of Fndc5 resulted in a significant increase in the expression level of neuronal and astrocyte markers (Figure S3C). However, the difference in the expression of oligodendrocyte marker was not significant between the overexpressed and the control groups (Figure S3C). The neurons differentiated from Fndc5 over-expressing neurospherse emerged more extended neuritis than controls (Figure 4, right top panel; þDox treated sample). Also, immunostaining of the cells with an antibody against Map2 confirmed the data obtained by real time PCR, as an intense stained growing neurospheres with more extended neurite outgrowth were observed in Dox treated sample of pLVX-Tight -Puro-Fndc5 cell line (Figure 4, right bottom panel ; þDox treated sample). The neurons differentiated from Fndc5 over-expressing neurospheres emerged more extended neurites than controls (Figure S4). Discussion Recently, it was reported Fndc5 can be cleaved to form Irisin, which is a myokine hormone. This hormone plays an Cell Biol Int 39 (2015) 629–637 © 2015 International Federation for Cell Biology
M. Forouzanfar et al.
Fndc5 overexpression and neural differentiation
Figure 2 Fndc5 overexpression during NPs formation. (A) Schematic protocol for NPs formation and Doxycycline treatment in order to increase Fndc5 expression level during NPs formation. Early embryoid bodies (EBs; day 2) were cultured in the presence of 1 mM RA and Dox for an additional four days as described. (B) Quantitative real time analysis for Fndc5 expression in treated stable cell lines with Doxycycline and un-transduced cells. (C) Expression level assessment of stemness markers. In stable transduced cells with pLVX-Tight -Puro-Fndc5, Nanog and Rex transcript levels were decreased significantly compare to transduced cell line with pLVX-Tight -Puro and un-transduced cells. (D) Analysis of NPs markers, Pax6, Sox1and Sox3. The expression levels of aforementioned markers significantly increased upon overexpression of Fndc5 in pLVX-Tight -Puro-Fndc5 transduced cell line. All expressions were quantified and normalized with Gapdh transcription level. Represented value bars are the mean of triplicate independent experiments SEM. Similar alphabets indicate significant difference between same samples at P < 0.05.
Cell Biol Int 39 (2015) 629–637 © 2015 International Federation for Cell Biology
633
Fndc5 overexpression and neural differentiation
M. Forouzanfar et al.
Figure 3 The effect of Fndc5 overexpression on mature neural cell markers. (A) Schematic protocol for induction of Fndc5 before neural mature cells formation. (B) Quantitative real time PCR analysis of mature neural cells markers, Map2, b-tubulin III, Neurocan, Gfap and Olig2 expressions after induced over expression of Fndc5. Results indicated that expression of neuronal marker and astrocyte markers significantly increased in pLVX-Tight -Puro-Fndc5 cell line compare to pLVX-Tight-Puro transduced cell line and control cells. However, such significant difference was not observed for oligodendrocyte marker, Olig2. All expressions were quantified and normalized with Gapdh transcript level. (C) Western blot analysis of mature neuronal markers (b-tubulinIII, Map2), and the astrocyte marker (Gfap) compared with Gapdh in transduced cell lines. The protein content of aforementioned markers increased significantly in pLVX-Tight-Puro-Fndc5 transduced cell line compares to pLVX-Tight-Puro transduced cells. (D) Quantitative real time PCR analysis of neuroprotective marker, BDNF expression after induced over expression of Fndc5. Results indicated that expression of this neuroprotective marker significantly increased in pLVX-Tight -Puro-Fndc5 transduced cell line compare to pLVX-Tight-Puro transduced cell line and control cells. All expressions were quantified and normalized with Gapdh levels. Represented value bars are the mean of triplicate independent experiments SEM. Similar alphabets indicate significant difference between same samples at P < 0.05.
634
Cell Biol Int 39 (2015) 629–637 © 2015 International Federation for Cell Biology
M. Forouzanfar et al.
Fndc5 overexpression and neural differentiation
Figure 4 Immunofluorescence staining of neurospheres. Upper panel: Phase contrast of maturating neural cells in þDox and -Dox samples. Bar, 100 mm. Lower panel: Immunostaining of Map2 (mature neuron marker) in mature neurons in pLVX-Tight -Puro-Fndc5 transduced cell line compared to pLVX-Tight-Puro transduced cells in presence/absence of Dox treatment. The nuclei were counterstained with DAPI. Bar, 1000 mm.
important role in thermogenesis and energy expenditure in mice (Bostrom et al., 2012). Furthermore, it was demonstrated that Irisin in pharmacological concentrations increases cell proliferation in mouse H19–7 HN cell line without changing in Map2 expression but Irisin could not promote neural differentiation in hippocampal cells (Moon et al., 2013). Our previous study showed that Fndc5 expression level increased during neural differentiation in mESCs, once treated with RA (Figure 5A) (Ostadsharif et al., 2011). Meanwhile, it also highlighted the importance of Fndc5 during neural differentiation of mouse embryonic stem cells through Fndc5 knockdown. Reduction in the expression level of Fndc5, significantly decreased astrocyte and mature neuronal expression level and neurite outgrowth (Hashemi et al., 2013). BDNF has an important role in the neuronal cell survival, differentiation and migration. BDNF also stimulates proliferation of neural stem cells through Trk-B receptors (Islam et al., 2009; Park & Poo, 2013). Very recently, it was shown that exercise enhances Fndc5 gene expression and leads to increase expression of BDNF in the hippocampus. In addition, it has been shown that BDNF engages in a negative feedback loop to balance Fndc5 Cell Biol Int 39 (2015) 629–637 © 2015 International Federation for Cell Biology
expression (Wrann et al., 2013). Not only our previous work but also these data confirmed that Fndc5 has high potential in neuronal development based on the fact that BDNF is a developmental factor in neural development of Substantia nigra and hippocampus. Therefore, considering the neuroprotective feature of Fndc5, it could be considered as a key factor in future management of neurological disorders. Overexpression based on recombinant viral vectors is one of the best choices for efficient gene overexpression in mammalian cell lines. Lentiviral vectors have several advantages compare to the onco-retroviral vectors. The genome inserted fragments by lentiviral vectors are more resistant to transcriptional silencing compared to retroviral vectors (Pfeifer et al., 2002). Therefore, for conditional Fndc5 overexpression during neural differentiation, lentiviral inducible system was chosen in this study. Here, we have shown that overexpression of Fndc5 during NPs formation caused an increase in the expression level of neural precursor cell markers (Sox1 and Pax6) and neuronal markers (Map2, b-tubulinIII and Neurocan) as well as the astrocyte marker (Gfap) without changing in oligodendrocyte marker (Olig2) (Figure 5B) compared to the control groups. Hence, we 635
Fndc5 overexpression and neural differentiation
M. Forouzanfar et al.
Figure 5 The effect of Fndc5 overexpression during neural differentiation. Induced overexpression of Fndc5 had a significant increase in rate of neural differentiation which improved the expression of mature neuronal and astrocyte markers.
concluded an enhancement in neuronal precursor markers and mature neuron and astrocyte markers upon overexpression of Fndc5, confirming the fact that Fndc5 has an important role in neural differentiation. Our results are in agreement with our previous findings (Ostadsharif et al., 2011; Hashemi et al., 2013) emphasizing the importance of Fndc5 during neurogenesis. Overexpression of Fndc5 significantly increases expression level of BDNF as a neuroprotective marker and our findings confirm previous report (Wrann et al., 2013) and probably have significant therapeutic implications. This therapeutic strategy should be validated by analysis of 636
upstream and downstream pathways of Fndc5. Our research confirmed that Fndc5 may play critical roles in neural development, therefore it could be considered as a great candidate for further researches in treatment of neurodegenerative disorders. Acknowledgments and funding This study was funded by a grant-in-aid of research from Royan Institute awarded to K.G. as the Principal Investigator, and in support of M.F. for obtaining her M.Sc. degree from the University of Isfahan. Cell Biol Int 39 (2015) 629–637 © 2015 International Federation for Cell Biology
M. Forouzanfar et al.
Conflict of interest None. References Bostrom P, Wu J, Jedrychowski MP, Korde A, Ye L, Lo JC, Rasbach KA, Boström EA, Choi JH, Long JZ, Kajimura S, Zingaretti MC, Vind BF, Tu H, Cinti S, H jlund K, Gygi SP, Spiegelman BM (2012) A PGC1-a-dependent myokine that drives brown-fat-like development of white fat and thermogenesis. Nature 481: 463–8. Ferrer-Martines A, Ruiz-Lozano P, Chein KR (2002) Mouse PeP: a novel peroxisomal protein linked to myoblast differentiation and development. Dev Dyn 224: 154–67. Hashemi MS, Ghaedi K, Salamian A, Karbalaei K, Emadi-Baygi M, Tanhaei S, Nasr-Esfahani MH, Baharvand H (2013) Fndc5 Knockdown significantly decreased neural differentiation rate of mouse embryonic stem cells. Neuroscience 231: 296–304. Hassani S-N, Totonchi M, Sharifi-Zarchi A, Mollamohammadi S, Pakzad M, Moradi S, Samadian A, Masoudi N, Mirshahvaladi S, Farrokhi A, Greber BJ, Araúzo-Bravo Marcos, Sabour D, Sadeghi M, Hosseini Salekdeh, Gourabi HR, Schöler Hans, Baharavand H (2014) Inhibition of TGFb signaling promotes ground state pluripotency. Stem Cell Rev 10: 16–30. Islam O, Loo TX, Heese K Brain-derived neurotrophic factor (BDNF) has proliferative effects on neural stem cells through the truncated TRK-B receptor, MAP kinase, AKT, and STAT-3 signaling pathways. Curr Neurovasc Res 6: 42–53. Moon HS, Dincer F, Mantzoros CS (2013) Pharmacological concentrations of Irisin increase cell proliferation without influencing markers of neurite outgrowth and synaptogenesis in mouse H19–7 hippocampal cell lines. Metabolism 62: 19–7. Ostadsharif M, Ghaedi K, Nasr-Esfahani MH, Parivar K, Tanhaie S, KarbalaieK Baharvand (2009) Cytosolic localization of mouse peroxisomal protein/DSKI fused with enhanced green fluorescent protein into Chinese hamster ovary-K1 and P19 cells. Yakhteh Med J 11: 154–9. Ostadsharif M, Ghaedi K, Nasr-Esfahani MH, Mojbafan M, Tanhaie S, Karbalaie K, Baharvand H (2011) The expression of
Cell Biol Int 39 (2015) 629–637 © 2015 International Federation for Cell Biology
Fndc5 overexpression and neural differentiation
peroxisomal protein transcripts increased by retinoic acid during neural differentiation. Differentiation 81: 127–32. Park H, Poo MM (2013) Neurotrophin regulation of neural circuit development and function. Nat Rev Neurosci 14: 7–23. Pfeifer A, Ikava M, Dayn Y, Verma IM (2002) Transgenesis by lentiviral vectors: Lack of gene silencing in mammalian embryonic stem cells and preimplantation. Proc Natl Acad Sci USA 99: 2140–5. Prelich G (2012) Gene overexpression: uses, mechanisms, and interpretation. Genetics 190: 841–54. Salmon P, Trono D (2006) Production and Titration of Lentiviral Vectors. In: Gerfen CR, Holmes A, Sibley D, Skolnick P, Wray S, eds. Current Protocols in Neuroscience. New York: John Wiley & Sons. Tanhaie S, Ghaedi K, Karbalaii K, Razavi S, Ostadsharif M, Nazari-Jahantigh M, Rabeei F, Nematollahi M, Baharvand H, Nasr-Esfahani MH (2009) Mouse peroxisomal protein cDNA cloning and characterization of its intraclleular localization. Yakhteh Med J 11: 196–203. Wrann CD, White JD, Salogiannnis J, Laznik-Bogoslavski D, Wu J, Ma D, Lin JD, Greenberg ME, Spiegelman BM (2013) Exercise Induces Hippocampal BDNF through a PGC-1a/ FNDC5 Pathway. Cell Metab 18: 1–11. Received 2 June 2014; accepted 19 December 2014. Final version published online 2 February 2015.
Supporting Information Additional supporting information may be found in the online version of this article at the publisher’s web-site. Figure S1: Schematic representation of the vectors. Figure S2: Establishment of a transduced stable cell line of mESCs with lentiviral vectors. Figure S3: Fndc5 overexpression during the whole process of neural differentiation. Figure S4: The effect of Fndc5 overexpression on overall neural differentiation.
637
SHORT COMMUNICATION
Fndc5 overexpression facilitated neural differentiation of mouse embryonic stem cells Mahboobeh Forouzanfar1,2, Farzaneh Rabiee1, Kamran Ghaedi1,2, Siamak Beheshti2, Somayeh Tanhaei1, Alireza Shoaraye Nejati1, Mohammad Jodeiri Farshbaf1, Hossein Baharvand3,4 and Mohammad Hossein Nasr-Esfahani1 1 Department of Cellular Biotechnology at Cell Science Research Center, Royan Institute for Biotechnology, ACECR, Isfahan, Iran 2 Department of Biology, School of Sciences, University of Isfahan, Isfahan, Iran 3 Department of Stem Cells and Developmental Biology at Cell Science Research Center, Royan Institute for Stem Cell Biology and Technology, ACECR, Tehran, Iran 4 Department of Developmental Biology, University of Science and Culture, ACECR, Tehran, Iran
Abstract Fndc5 has been recently recognized as a myokine which could be cleaved and secreted into blood stream. It is termed as irisin with an important role in thermogenesis and energy homeostasis. Increased expression of Fndc5 has been reported upon retinoic acid treatment during neural differentiation and its knockdown decreased neural differentiation and neurite outgrowth. This study tries to evaluate the effect of Fndc5 overexpression on rate of neural differentiation in mouse. (Thus, transduced cell line of mouse embryonic stem cell with ability to express Fndc5 under Doxycycline treatment was established. Subsequently, the effect of overexpression of Fndc5 on different stages of neural differentiation was studied). Our study showed an increase enhancement in neuronal precursor markers and mature neuron markers upon overexpression of Fndc5, concluding that Fndc5 facilitates neural differentiation. This effect might be related to increased expression of BDNF following overexpression of Fndc5. Our findings are consistent with recent studies reporting a similar role for Fndc5 in proliferation of neural cells and increase in the expression of neurotrophins like BDNF. Keywords: BDNF; gene expression; mouse embryonic stem cell; neural differentiation
Introduction Firbonectin type III domain containing 5 (Fndc5) was identified in 2002 and was initially named peroxisomal protein (PEP). This protein is composed of 209 amino acid residues. Fndc5 has two hydrophobic domains between the amino acid residues 12–31 and 151–168 and a firbronectin type III domain between 31–114 amino acid residues (Tanhaie et al., 2009). The functions of Fndc5 domains are not fully understood yet. Moreover, there is a tripeptide sequence at the C-terminus of Fndc5 and already was recognized as being
important for peroxisomal sorting of this protein (Ostadsharif et al., 2009). A recent study by Bostrom et al. (2012) showed that Fndc5 is a myokine, the expression of which is increased upon exercise and could be cleaved to a shorter fragment termed, Irisin. Fndc5 is also highly expressed in heart and skeletal muscles of adult mouse (Ferrer-Martines et al., 2002). Furthermore, previous studies by our group have revealed high amount of Fndc5 in transcriptional levels upon treatment with retinoic acid (RA) during neural differentiation of mouse embryonic stem cells (mESCS) and P19 cells (Ostadsharif et al., 2011). Recently, we have reported that Fndc5 knockdown
Corresponding authors: e-mails: [email protected] (K.G.); [email protected] (M.H.N-E); [email protected] (H.B) Abbreviations: BDNF, brain-derived neurotrophic factor; BSA, bovine serum albumin; CDS, coding sequence; DAPI, 4,6-diamidio-2-phenylindole; DMEM, dulbecco’s modified Eagle medium; Dox, doxycycline; EBs, embryoid bodies; ES-FCS, embryonic stem cells qualified-FCS; FCS, fetal calf serum; Fndc5, fibronectin type III domain containing 5; FRCP2, fibronectin type III repeat containing protein 2; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; GFAP, glial fibrillary acidic protein; HRP, horseradish peroxidase; LIF, leukemia inhibitory factor; mESC, mouse embryonic stem cell; PEP, peroxisomal protein; Pen Strep, Penicillin-Streptomycin; RA, retinoic acid; RT, room temperature; K-DMEM, knock out- DMEM; LIF, leukemia inhibitory factor; MAP2, microtubule-associated protein 2; MOI, multiplicity of infection; NP, neural progenitor; PBS, phosphate-buffered saline; PLO, poly-LOrnithine; PVDF, polyvinylidenedifluoride; SEM, standard error of mean; Sox1, SRY-box containing gene1; Sox3, SRY-box containing gene 3; TRITC, tetramethyl rhodamine isothiocyanate
Cell Biol Int 39 (2015) 629–637 © 2015 International Federation for Cell Biology
629
Fndc5 overexpression and neural differentiation
M. Forouzanfar et al.
decreases the rate of neural differentiation in mouse embryonic stem cells (Hashemi et al., 2013). Information emerging from systemic knock-out/-down studies alone is insufficient to deduce gene function. Generally, overexpression a wild-type gene provides geneticists with an alternative powerful tool to identify pathway components that might remain undetected using traditional loss-of-function analysis (Prelich, 2012). To further expand our knowledge on the role of Fndc5 during neurogenesis, we established a line of mouse embryonic stem cells (mESCs) which was stably transduced with an inducible lentiviral particles encoding mouse Fndc5. Furthermore, overexpression of Fndc5 will advance our understanding of neural differentiation of Fndc5, and whether its expression dosage could affect neural differentiation or not. Materials and methods
mESCs culture and neural differentiation We used mESCs cells (Royan B20 cells) derived from C57BL/6 mouse strain. These cells were obtained from Royan Institute for Stem Cells and Developmental Biology (Tehran, Iran) and cultured as described previously (Hassani et al., 2014). Meanwhile, neural differentiation was carried out according to Hashemi et al. (2013). The recombinant
vector pLVX-Tigh-Puro-Fndc5 was constructed as described in the Supporting Information and was used to induce the expression of Fndc5 in mESCs.
Lentiviral vector transduction for generation of stable mESCs The production of lenti-viral particles and titration was carried out as described in the Supporting Information. mESCs were seeded at a density of 2 105 cells in each well per 6-well dish (TPP, USA) (Salmon and Trono, 2006). Next day, cells were transduced with the lentiviral particles at multiplicity of infection (MOI) of 10, for producing rtTA and Fndc5 in target cells according to the protocol (Lenti-XTM Lentiviral Expression Systems User Manual, Clontech). Two days post-transduction, the cells were treated with 1 mg/ml puromycin (Sigma) and 400 mg/mL G418 (Gibco) for selection of stable transduced cells. The medium was changed on a daily basis until stable colonies appeared (after10–14 days). To ensure the isolation of stable transduced cells, genomic DNA was extracted from antibiotics resistant grown cells using DNeasy Blood and Tissue Kit (Qiagen). Approximately 150 ng of the cellsderived genome was used for PCR to detect the rtTA and puromycin encoding fragments using specific primers (Table 1B).
Table 1 List of primers used in this study. A) Primers used for construction of pLVX-Tight-Puro-Fndc5 Gene
Forward Primer (50 –30 )
Fndc5 CDS GCGGCCGCATGCCCCCAGGG* B) Primers used for transduced mESCs line Genes Forward Primer (50 -30 ) CMV-rtTA CGCAAATGGGCGGTAGGCGTG Puromycin GCTCGACATCGGCAAGGTG C) Primers used for gene expression analysis by Q-PCR Genes Forward Primer (50 –30 ) FNDC5 TCATTGTTGTGGTCCTCTTC Olig2 CTGAACACTCCAAGGGTCTG Map2 AAGTCACTGATGGAATAAGC b-tubulin III GCCTCCTCTCACAAGTATG GFAP CTCCAAGATGAAACCAAC Pax6 TGAATGGGCGGAGTTATGAT Sox1 CAGAAGGAGGATGGGTTGTG Sox3 ACCGAAGATGAGGAGGAC Neurocan CCATCCACACCGACATCAC Nanog TGAGCTATAAGCAGGTTAAGAC Rex1 CCAGTCCAGAATACCAGAGT BDNF TGGCCCTGCGGAGGCTAAGT Gapdh TGCCGCCTGGAGAAACC
Reverse Primer (50 –30 )
AT ( C)
ACGCGATCATATCTTGCTGCGGAGGAGAC**
68
Reverse Primer (50 –30 ) AGGAGAGCACAGCGGAATG GGCGGTGACGGTGAAGCC
AT ( C) 60 54
Reverse Primer (50 –30 ) GCTCGTTGTCCTTGATGATA CTCTGCGTCTCGTCTAAGC CTCTGCGAATTGGTTCTG CCTCCGTATAGTGCCCTT GCAAACTTAGACCGATACC GGACGGGAACTGACACTC GGGAGGGGATGGGATAAGAC CAAACACCACAGCGATTC GGTCCCCAAGGAAACACTC CAATGGATGCTGGGATACTC AGCCATCTTCCTCAGTCT AGGGTGCTTCCGAGCCTTCCT TGAAGTCGCAGGAGACAACC
AT ( C) 60 63 54 54 61 58 56 54 60 55 60 55 60
Accession No NM_027402.2 NM_016967.2 NM_001039934.1 NM_023279.2 NM_001131020 NM_001244198.1 NM_009233.3 NM_009237.2 NM_007789.3 NM_028016.2 NM_009556.3 M_001048139.1 NM_008084.2
AT is annealing temperature of PCR, *Not I site is underlined, ** Mlu I site is underlined.
630
Cell Biol Int 39 (2015) 629–637 © 2015 International Federation for Cell Biology
M. Forouzanfar et al.
Induction of Fndc5 expression during neural differentiation
Fndc5 overexpression and neural differentiation
Immunocytochemistry analysis
To induce the overexpression of Fndc5, cells were treated with 750 mg/mL of Dox (Clonetech) between day 2 and day 6, during formation of neural precursor (NP) cells or from day 2 to day 14 during formation of neural precursor (NP) cells and differentiated neural cells, when mature neurons emerged. In transduced cells, rtTA was continuously expressed while rtTA activation occurred in the presence of Dox (þDox). The activated rtTA binds to the respective inducible promoter (PTight) of Fndc5, thereby resulting in over-expression of Fndc5.
Indirect immunofluorescence light microscopy was performed as already described (Ostadsharif et al., 2011). Primary antibody was anti-mouse antibodies against MapII (1:200, Sigma–Aldrich) and secondary antibody was tetramethyl rhodamine isothiocyanate (TRITC)— conjugated goat anti-mouse IgG (1:50, Chemicon). Nuclei were counterstained with 4, 6-diamidio-2-phenylindole (DAPI, Sigma–Aldrich). Stained slides were observed under a fluorescent microscope (Olympus, Japan) and images were acquired with an Olympus DP70 camera (Olympus, Japan).
Western blot
Statistical analysis
Cells were washed with PBS and lysed with TRI reagent (Sigma, USA). RNA and protein were extracted and approximately 30 mg of protein was run on SDS–PAGE and transferred to a polyvinylidenedifluoride (PVDF; Biorad, USA) membrane. Subsequently, the membranes were blocked with 10% skim milk for 1 h (W/V, Merck, USA), then incubated with primary antibody solution for 1.5 h at RT. The following antibodies were used for western blotting: monoclonal anti-microtubule associated protein 2 (MAP2) antibody (1:10,000, Sigma), monoclonal anti-b tubulin Isotype III (1:2000, Sigma) and monoclonal anti-glial fibrillary acidic protein (GFAP) antibody (1:8000, Millipore, USA) and mouse anti-glyceraldehyde-3-phosphate dehydrogenase, clone 6C5 (1:5000, Millipore). HRP-coupled IgG antibody (1:5000) (Dako, Japan) was used as secondary antibody. Finally, protein bands were visualized by an Amersham ECL Advance Western Blotting Detection Kit (GE Healthcare, Germany). Signal intensity of the visualized bands was measured using Image J processing and analysis software.
SPSS (Version 17, USA) was used for data analysis and mean standard error of mean (SEM) were reported. Oneway analysis of variance (ANOVA) was performed to identify the statistical differences between treated groups and control. Meanwhile, P 0.05 was considered to be significant.
RNA extraction and Real Time PCR The extracted RNA with TRI reagent was used for cDNA synthesis (Thermo Scientific). DNase treatment was performed with 1 mg of total RNA and cDNA was synthesized with random hexamer primer utilizing MMLV reverse transcriptase (Thermo Scientific). Fifty nanograms of cDNA was used for quantitative real time PCR (Thermal Cycler Rotor-Gene 6000, Corbett, Australia) with SYBR green (TaKaRa, Japan) using specific primers (Table 1C). Expressions of target genes were normalized with glyceraldehyde 3-phosphate dehydrogenase (Gapdh) gene expression level. The experiments were performed in triplicate and data were analyzed according to the DDCt method. Cell Biol Int 39 (2015) 629–637 © 2015 International Federation for Cell Biology
Results
Establishment of a stable transduced mESCs Data confirmed significant overexpression of Fndc5 in stable transduced mESCs cells with pLVX-Tight- Fndc5 (Figure 1A). No significant differences in expression level of stemness markers, Nanog and Rex1, were detected between transduced and control cells (Figure 1B), indicating that Fndc5 over-expression did not have an effect on the stemness properties of transduced mESCs.
Induction of Fndc5 expression during NPs formation To generate NPs, two transduced cell lines (pLVX-TightPuro-Fndc5 and pLVX-Tight-Puro) and un-transduced cells were treated with RA (1mm) for 4 days (Ostadsharif et al., 2011). Induction of Fndc5 overexpression by Dox was also simultaneously performed with the RA treatment as shown in Figure 2A. Quantitative real time PCR on day 6 indicated an increase in Fndc5 transcriptional level in the pLVX-Tight-Puro-Fndc5 transduced cell which was significantly higher than un-induced cell line (-Dox) and also with Dox treated pLVX-Tight-Puro transduced and un-transduced cell lines (Figure 2B). Of interest, the expression of early neural markers (Pax6, Sox1, Sox3) were significantly increased upon Fndc5 induced overexpression (Figure 2D). Furthermore, the transcription rate of stemness markers were significantly reduced by overexpression of Fndc5 (Figure 2C). 631
Fndc5 overexpression and neural differentiation
M. Forouzanfar et al.
Figure 1 Characterization of a transduced stable mESCs line (A) Quantitative real-time RT-PCR showed a significant increase in Fndc5expression under Doxycycline induction (þDox) relative to un-induced condition (-Dox) in pLVX-Tight -Puro-Fndc5 transduced cells. Similar alphabets indicate significant difference between same samples at P < 0.001. (B) Quantitative real time analysis of stem cell markers, Nanog (Left panel) and Rex (Right panel), expression in transduced cells. Stably transduced mESCs with pLVX-Tight -Puro-Fndc5 and pLVX-Tight -Puro showed no significant change in stem cell markers of þDox state to -Dox with respect to the un-transduced cell line (mESCs line, Royan B20 cell line). All relative expressions were quantified and normalized with Gapdh transcript level. Represented value bars are the mean of triplicate independent experiments SEM.
Following overexpression of Fndc5 during RA induction (day 2–6), treated NPs were plated for 8 more days in order for neural differentiation to take place (Figure 3A) (Hashemi et al., 2013). The expression levels of mature neuronal markers (Map2, b-tubulinIII and Neurocan) and astrocyte marker (Gfap) significantly increased in Fndc5 expressing cells compared to controls, while no significant difference was detected for oligodendrocyte marker (Olig2). To confirm the data of the real time PCR, western blot was also carried out by utilizing antibodies against Map2, btubulinIII and Gfap and similar results were obtained and supported real time PCR data (Figure 3C). Interestingly, the expression level of BDNF as neuroprotective marker was also significantly increased by overexpression of Fndc5 (Figure 3D).
Induction in Fndc5 expression during and post formation of NPs To further define the overexpression of Fndc5 during neurogenesis, its overexpression was performed from day 2 to day 14 by treating with Dox, as illustrated in Figure S3A. The overexpression of Fndc5 was significantly higher in 632
pLVX-Tight-Puro-Fndc5 cell line in comparison with the controls (Figure S3B). The over expression of Fndc5 resulted in a significant increase in the expression level of neuronal and astrocyte markers (Figure S3C). However, the difference in the expression of oligodendrocyte marker was not significant between the overexpressed and the control groups (Figure S3C). The neurons differentiated from Fndc5 over-expressing neurospherse emerged more extended neuritis than controls (Figure 4, right top panel; þDox treated sample). Also, immunostaining of the cells with an antibody against Map2 confirmed the data obtained by real time PCR, as an intense stained growing neurospheres with more extended neurite outgrowth were observed in Dox treated sample of pLVX-Tight -Puro-Fndc5 cell line (Figure 4, right bottom panel ; þDox treated sample). The neurons differentiated from Fndc5 over-expressing neurospheres emerged more extended neurites than controls (Figure S4). Discussion Recently, it was reported Fndc5 can be cleaved to form Irisin, which is a myokine hormone. This hormone plays an Cell Biol Int 39 (2015) 629–637 © 2015 International Federation for Cell Biology
M. Forouzanfar et al.
Fndc5 overexpression and neural differentiation
Figure 2 Fndc5 overexpression during NPs formation. (A) Schematic protocol for NPs formation and Doxycycline treatment in order to increase Fndc5 expression level during NPs formation. Early embryoid bodies (EBs; day 2) were cultured in the presence of 1 mM RA and Dox for an additional four days as described. (B) Quantitative real time analysis for Fndc5 expression in treated stable cell lines with Doxycycline and un-transduced cells. (C) Expression level assessment of stemness markers. In stable transduced cells with pLVX-Tight -Puro-Fndc5, Nanog and Rex transcript levels were decreased significantly compare to transduced cell line with pLVX-Tight -Puro and un-transduced cells. (D) Analysis of NPs markers, Pax6, Sox1and Sox3. The expression levels of aforementioned markers significantly increased upon overexpression of Fndc5 in pLVX-Tight -Puro-Fndc5 transduced cell line. All expressions were quantified and normalized with Gapdh transcription level. Represented value bars are the mean of triplicate independent experiments SEM. Similar alphabets indicate significant difference between same samples at P < 0.05.
Cell Biol Int 39 (2015) 629–637 © 2015 International Federation for Cell Biology
633
Fndc5 overexpression and neural differentiation
M. Forouzanfar et al.
Figure 3 The effect of Fndc5 overexpression on mature neural cell markers. (A) Schematic protocol for induction of Fndc5 before neural mature cells formation. (B) Quantitative real time PCR analysis of mature neural cells markers, Map2, b-tubulin III, Neurocan, Gfap and Olig2 expressions after induced over expression of Fndc5. Results indicated that expression of neuronal marker and astrocyte markers significantly increased in pLVX-Tight -Puro-Fndc5 cell line compare to pLVX-Tight-Puro transduced cell line and control cells. However, such significant difference was not observed for oligodendrocyte marker, Olig2. All expressions were quantified and normalized with Gapdh transcript level. (C) Western blot analysis of mature neuronal markers (b-tubulinIII, Map2), and the astrocyte marker (Gfap) compared with Gapdh in transduced cell lines. The protein content of aforementioned markers increased significantly in pLVX-Tight-Puro-Fndc5 transduced cell line compares to pLVX-Tight-Puro transduced cells. (D) Quantitative real time PCR analysis of neuroprotective marker, BDNF expression after induced over expression of Fndc5. Results indicated that expression of this neuroprotective marker significantly increased in pLVX-Tight -Puro-Fndc5 transduced cell line compare to pLVX-Tight-Puro transduced cell line and control cells. All expressions were quantified and normalized with Gapdh levels. Represented value bars are the mean of triplicate independent experiments SEM. Similar alphabets indicate significant difference between same samples at P < 0.05.
634
Cell Biol Int 39 (2015) 629–637 © 2015 International Federation for Cell Biology
M. Forouzanfar et al.
Fndc5 overexpression and neural differentiation
Figure 4 Immunofluorescence staining of neurospheres. Upper panel: Phase contrast of maturating neural cells in þDox and -Dox samples. Bar, 100 mm. Lower panel: Immunostaining of Map2 (mature neuron marker) in mature neurons in pLVX-Tight -Puro-Fndc5 transduced cell line compared to pLVX-Tight-Puro transduced cells in presence/absence of Dox treatment. The nuclei were counterstained with DAPI. Bar, 1000 mm.
important role in thermogenesis and energy expenditure in mice (Bostrom et al., 2012). Furthermore, it was demonstrated that Irisin in pharmacological concentrations increases cell proliferation in mouse H19–7 HN cell line without changing in Map2 expression but Irisin could not promote neural differentiation in hippocampal cells (Moon et al., 2013). Our previous study showed that Fndc5 expression level increased during neural differentiation in mESCs, once treated with RA (Figure 5A) (Ostadsharif et al., 2011). Meanwhile, it also highlighted the importance of Fndc5 during neural differentiation of mouse embryonic stem cells through Fndc5 knockdown. Reduction in the expression level of Fndc5, significantly decreased astrocyte and mature neuronal expression level and neurite outgrowth (Hashemi et al., 2013). BDNF has an important role in the neuronal cell survival, differentiation and migration. BDNF also stimulates proliferation of neural stem cells through Trk-B receptors (Islam et al., 2009; Park & Poo, 2013). Very recently, it was shown that exercise enhances Fndc5 gene expression and leads to increase expression of BDNF in the hippocampus. In addition, it has been shown that BDNF engages in a negative feedback loop to balance Fndc5 Cell Biol Int 39 (2015) 629–637 © 2015 International Federation for Cell Biology
expression (Wrann et al., 2013). Not only our previous work but also these data confirmed that Fndc5 has high potential in neuronal development based on the fact that BDNF is a developmental factor in neural development of Substantia nigra and hippocampus. Therefore, considering the neuroprotective feature of Fndc5, it could be considered as a key factor in future management of neurological disorders. Overexpression based on recombinant viral vectors is one of the best choices for efficient gene overexpression in mammalian cell lines. Lentiviral vectors have several advantages compare to the onco-retroviral vectors. The genome inserted fragments by lentiviral vectors are more resistant to transcriptional silencing compared to retroviral vectors (Pfeifer et al., 2002). Therefore, for conditional Fndc5 overexpression during neural differentiation, lentiviral inducible system was chosen in this study. Here, we have shown that overexpression of Fndc5 during NPs formation caused an increase in the expression level of neural precursor cell markers (Sox1 and Pax6) and neuronal markers (Map2, b-tubulinIII and Neurocan) as well as the astrocyte marker (Gfap) without changing in oligodendrocyte marker (Olig2) (Figure 5B) compared to the control groups. Hence, we 635
Fndc5 overexpression and neural differentiation
M. Forouzanfar et al.
Figure 5 The effect of Fndc5 overexpression during neural differentiation. Induced overexpression of Fndc5 had a significant increase in rate of neural differentiation which improved the expression of mature neuronal and astrocyte markers.
concluded an enhancement in neuronal precursor markers and mature neuron and astrocyte markers upon overexpression of Fndc5, confirming the fact that Fndc5 has an important role in neural differentiation. Our results are in agreement with our previous findings (Ostadsharif et al., 2011; Hashemi et al., 2013) emphasizing the importance of Fndc5 during neurogenesis. Overexpression of Fndc5 significantly increases expression level of BDNF as a neuroprotective marker and our findings confirm previous report (Wrann et al., 2013) and probably have significant therapeutic implications. This therapeutic strategy should be validated by analysis of 636
upstream and downstream pathways of Fndc5. Our research confirmed that Fndc5 may play critical roles in neural development, therefore it could be considered as a great candidate for further researches in treatment of neurodegenerative disorders. Acknowledgments and funding This study was funded by a grant-in-aid of research from Royan Institute awarded to K.G. as the Principal Investigator, and in support of M.F. for obtaining her M.Sc. degree from the University of Isfahan. Cell Biol Int 39 (2015) 629–637 © 2015 International Federation for Cell Biology
M. Forouzanfar et al.
Conflict of interest None. References Bostrom P, Wu J, Jedrychowski MP, Korde A, Ye L, Lo JC, Rasbach KA, Boström EA, Choi JH, Long JZ, Kajimura S, Zingaretti MC, Vind BF, Tu H, Cinti S, H jlund K, Gygi SP, Spiegelman BM (2012) A PGC1-a-dependent myokine that drives brown-fat-like development of white fat and thermogenesis. Nature 481: 463–8. Ferrer-Martines A, Ruiz-Lozano P, Chein KR (2002) Mouse PeP: a novel peroxisomal protein linked to myoblast differentiation and development. Dev Dyn 224: 154–67. Hashemi MS, Ghaedi K, Salamian A, Karbalaei K, Emadi-Baygi M, Tanhaei S, Nasr-Esfahani MH, Baharvand H (2013) Fndc5 Knockdown significantly decreased neural differentiation rate of mouse embryonic stem cells. Neuroscience 231: 296–304. Hassani S-N, Totonchi M, Sharifi-Zarchi A, Mollamohammadi S, Pakzad M, Moradi S, Samadian A, Masoudi N, Mirshahvaladi S, Farrokhi A, Greber BJ, Araúzo-Bravo Marcos, Sabour D, Sadeghi M, Hosseini Salekdeh, Gourabi HR, Schöler Hans, Baharavand H (2014) Inhibition of TGFb signaling promotes ground state pluripotency. Stem Cell Rev 10: 16–30. Islam O, Loo TX, Heese K Brain-derived neurotrophic factor (BDNF) has proliferative effects on neural stem cells through the truncated TRK-B receptor, MAP kinase, AKT, and STAT-3 signaling pathways. Curr Neurovasc Res 6: 42–53. Moon HS, Dincer F, Mantzoros CS (2013) Pharmacological concentrations of Irisin increase cell proliferation without influencing markers of neurite outgrowth and synaptogenesis in mouse H19–7 hippocampal cell lines. Metabolism 62: 19–7. Ostadsharif M, Ghaedi K, Nasr-Esfahani MH, Parivar K, Tanhaie S, KarbalaieK Baharvand (2009) Cytosolic localization of mouse peroxisomal protein/DSKI fused with enhanced green fluorescent protein into Chinese hamster ovary-K1 and P19 cells. Yakhteh Med J 11: 154–9. Ostadsharif M, Ghaedi K, Nasr-Esfahani MH, Mojbafan M, Tanhaie S, Karbalaie K, Baharvand H (2011) The expression of
Cell Biol Int 39 (2015) 629–637 © 2015 International Federation for Cell Biology
Fndc5 overexpression and neural differentiation
peroxisomal protein transcripts increased by retinoic acid during neural differentiation. Differentiation 81: 127–32. Park H, Poo MM (2013) Neurotrophin regulation of neural circuit development and function. Nat Rev Neurosci 14: 7–23. Pfeifer A, Ikava M, Dayn Y, Verma IM (2002) Transgenesis by lentiviral vectors: Lack of gene silencing in mammalian embryonic stem cells and preimplantation. Proc Natl Acad Sci USA 99: 2140–5. Prelich G (2012) Gene overexpression: uses, mechanisms, and interpretation. Genetics 190: 841–54. Salmon P, Trono D (2006) Production and Titration of Lentiviral Vectors. In: Gerfen CR, Holmes A, Sibley D, Skolnick P, Wray S, eds. Current Protocols in Neuroscience. New York: John Wiley & Sons. Tanhaie S, Ghaedi K, Karbalaii K, Razavi S, Ostadsharif M, Nazari-Jahantigh M, Rabeei F, Nematollahi M, Baharvand H, Nasr-Esfahani MH (2009) Mouse peroxisomal protein cDNA cloning and characterization of its intraclleular localization. Yakhteh Med J 11: 196–203. Wrann CD, White JD, Salogiannnis J, Laznik-Bogoslavski D, Wu J, Ma D, Lin JD, Greenberg ME, Spiegelman BM (2013) Exercise Induces Hippocampal BDNF through a PGC-1a/ FNDC5 Pathway. Cell Metab 18: 1–11. Received 2 June 2014; accepted 19 December 2014. Final version published online 2 February 2015.
Supporting Information Additional supporting information may be found in the online version of this article at the publisher’s web-site. Figure S1: Schematic representation of the vectors. Figure S2: Establishment of a transduced stable cell line of mESCs with lentiviral vectors. Figure S3: Fndc5 overexpression during the whole process of neural differentiation. Figure S4: The effect of Fndc5 overexpression on overall neural differentiation.
637
