MICROSCOPY RESEARCH AND TECHNIQUE 00:00–00 (2014)

Fluorescent In Situ Hybridization of Synaptic Proteins Imaged With Super-Resolution STED Microscopy 2 € WILLIAM I. ZHANG,1,2,3 HEIKO ROHSE, SILVIO O. RIZZOLI,1,2,3 AND FELIPE OPAZO1,2,3* 1

Department of Neuro- and Sensory Physiology, University of G€ ottingen, G€ ottingen, Germany STED Microscopy of Synaptic Function, European Neuroscience Institute, G€ ottingen, Germany Cluster of Excellence Nanoscale Microscopy and Molecular Physiology of the Brain (CNMPB), University of G€ ottingen, G€ ottingen, Germany

2 3

KEY WORDS

FISH; mRNA; microscopy

ABSTRACT Super-resolution fluorescence microscopy is still a developing field. One of the limitations has been that standard labeling assays, which had been developed for conventional imaging, must be adjusted and optimized for each super-resolution method. These methods are more sensitive to noise, and require more intense labeling than conventional microscopy, which is not always trivial to achieve. Here, we describe the use of stimulation-emission depletion (STED) microscopy to locate messenger RNAs (mRNAs) in single neurons with high spatial precision. We address several technical difficulties we encountered in using fluorescent in situ hybridization (FISH) for STED imaging. We optimized the experimental protocol to detect mRNAs and proteins simultaneously, by performing FISH and immunostaining on the same samples. We tested our imaging approach in primary hippocampal neurons, studying the mRNAs of three important presynaptic proteins (synaptobrevin, synaptotagmin, and synaptophysin). Our approach allowed us to relate changes in mRNA levels and localization to neuronal physiology, under different activity regimes and also during neuronal development. We conclude that FISH can be performed efficiently using super-resolution techniques. This should contribute significantly to the clarification of the molecular mechanisms that govern mRNA distribution and dynamics within cells. Microsc. Res. Tech. 00:000–000, 2014. V 2014 Wiley Periodicals, Inc. C

INTRODUCTION Conventional light microscopy is limited to a resolution of about 200–300 nm by the diffraction of light, as described by Ernst Abbe already in 1873 (Abbe, 1873). It has been recently revolutionized by the introduction of super-resolution imaging, with several techniques going beyond the diffraction limit and thus providing images with exceptional amount of detail (Toomre and Bewersdorf, 2010). Fluorescent super-resolution microscopy needed more than ten years of development to have its first biological application in 2006 (Willig et al., 2006). Since then, much of the effort has been focused on how to apply these techniques to the study of cellular details (M€ uller et al., 2012). The main problem is how to render the labeling techniques used for conventional imaging sufficiently precise for super-resolution imaging. For instance, antibodies, which have been used for decades in imaging, are too large to ensure the accurate labeling of all available epitopes, and therefore provide more punctuate, “spotty” images than smaller affinity tools such as nanobodies or aptamers (Opazo et al., 2012; Ries et al., 2012). While the super-resolution imaging of proteins has benefited from recent efforts focused on both fluorescent proteins and affinity labeling, the visualization of nucleic acids has been less thoroughly investigated. Nucleic acids can be labeled by fluorescent in situ hybridization (FISH), a methodology which takes advantage of the pairing nature of nucleic acids C V

2014 WILEY PERIODICALS, INC.

(guanidine:cytosine, adenine:thymidine, or adenine:uracil). FISH uses labeled single-stranded DNAs or RNAs whose sequence is complementary to that of the nucleic acids under investigation. This methodology had its origin in the 1960s (Hall and Spiegelman, 1961), but was only introduced to the microscopy field in 1982, when two independent groups decided to couple fluorescent dyes to their RNA probes (Langer-Safer et al., 1982; Van Prooijen-Knegt et al., 1982). FISH afterward became a major method to visualize genes in chromosomes and their aberrations, and is now used in modern clinical laboratories for the diagnostic of several genetic diseases (Trask, 2002). Since its invention, FISH has been mostly used in conventional microscopy. Several strategies have been developed to detect messenger RNAs (mRNAs) with impressive accuracy, despite the difficulties induced by diffraction-limited microscopy. One of the most Present address of Heiko R€ohse: Leica Microsystems, Vertrieb GmbH, Wetzlar, Germany. *Correspondence to: Felipe Opazo, Humboldtallee 23, 37073 G€ ottingen, Germany. E-mail: [email protected] Received 15 November 2013; accepted in revised form 27 March 2014 REVIEW EDITOR: Dr. Francesca Cella Zanacchi This article was published online on 10 April 2014. An error was subsequently identified. This notice is included in the online and print versions to indicate that both have been corrected 17 April 2014. Contract grant sponsor: Cluster of Excellence Nanoscale Microscopy and Molecular Physiology of the Brain (to SOR) and by a Starting Grant from the European Research Council, Program FP7 (NANOMAP, to SOR). DOI 10.1002/jemt.22367 Published online 00 Month 2014 in Wiley Online Library (wileyonlinelibrary.com).

2

W.I. ZHANG ET AL.

prominent strategies is to use tens of fluorescent probes that hybridize to adjacent regions of a single mRNA sequence, which result in large enough signal-to-noise ratios to mathematically determine its position with exquisite precision (Femino et al., 1998; Mueller et al., 2013; Raj et al., 2008). A second strategy has been focused on exploiting the high affinity of an RNA binding protein (RBP) of the bacteriophage MS2 for a specific RNA hairpin motif (LeCuyer et al., 1996). This methodology relies on modified mRNAs tagged with several of such hairpin motifs in tandem (6–24). Simultaneously, the RBP of MS2 phage needs to be fused to green fluorescent protein (GFP) or split-GFP, and must be coexpressed to detect the engineered mRNA (Bertrand et al., 1998; Lionnet et al., 2011; Rackham et al., 2004). Finally, a novel strategy developed by Jaffrey and collaborators is based on RNA sequences that are able to selectively turn on the fluorescence of a particular fluorophore (Paige et al., 2011). Therefore, RNAs tagged with such a sequence can be easily followed in living cells. Surprisingly, only few studies combined superresolution microscopy with genomic FISH (Markaki et al., 2012; M€ uller et al., 2010; Weiland et al., 2011). These pioneering investigations focused principally on chromosomal DNA, and thus offered an important proofof-principle for the application of super-resolution microscopy to nucleic acid studies. However, to our knowledge, mRNA molecules, which represent the source of all cellular proteins, have never been investigated using super-resolution microscopy. The localization of mRNAs in different cells, and especially in neurons, is actively discussed (Jung et al., 2012). This is an important issue especially since neurons are long-lived, nondividing cells, with highly specialized morphology. They require abundant mRNA and protein production, and rely on correct sorting and trafficking of various elements through large distances—sometimes longer than 1 m for neurons of the peripheral nervous system. Here, we show that mRNAs can be visualized at nanometer precision when combining stimulatedemission depletion (STED) microscopy with FISH (STED-FISH). We have systematically optimized a FISH protocol to detect mRNAs using STED. As a proof of principle, we followed the distribution and abundance of mRNAs during neuronal development, for three important presynaptic (axonal) proteins (synaptobrevin, synaptotagmin, and synaptophysin). Our observations suggest that the mRNAs of these synaptic proteins grow in numbers until achieving neuronal maturity. They are predominantly located in the cell body, although some minor amounts can be detected in the neuronal processes. The advantage of superresolution microscopy over conventional techniques lies mostly in the fact that many of the mRNA “spots” observed with diffraction-limited optics have actually been shown by STED microscopy to be collections of multiple transcripts. This suggests that STED (or any other comparable super-resolution microscopy technique) can significantly contribute to get a more accurate understanding of RNA biology. MATERIAL AND METHODS Cell Culture Primary hippocampal neurons of newborn rats were seeded on a previously grown layer of astrocytes on

poly-L-lysine (PLL)-coated coverslips (Sigma-Aldrich). The neurons were cultured in Neurobasal A (Invitrogen) supplemented with 2% B27 (Invitrogen), 1% glutamax-I (Invitrogen), 60 U/mL penicillin, and 20 U/ mL streptomycin (Lonza). Neurons were kept at 37 C and 5% CO2 in a humidified incubator. COS-7 cells were cultured in standard Dulbecco’s modified Eagle medium (Lonza) supplemented with 10% fetal calf serum (PAA), 2 mM L-glutamine (SigmaAldrich), and 100 U/mL each of penicillin and streptomycin. COS-7 cells were kept at 37 C and 5% CO2 in a humidified incubator. Cells were seeded on PLL-coated coverslips 24 h before transfection. Mammalian expression plasmids driving expression with CMV promoters were used. Plasmids encoded for rat synaptobrevin-2 (NCBI reference sequence: NM_012663) and synaptophysin gene (NCBI reference sequence: NM_012664) were fused to the pH sensitive GFP termed pHuorin (Miesenb€ock et al., 1998); synaptotagmin-2 (NCBI reference sequence: NM_012665) was fused to the GFP variant Citrine (Lalkens et al., 2011). Transfections were performed with Lipofectamin 2000V as suggested by the manufacturer (Invitrogen, 11668). R

Probe Design All fluorescently labeled DNA oligonucleotides (probes) were purchased from Eurofins (Eurofins Scientific GmbH, Hamburg, Germany). Probes were designed to have similar hybridization properties. A custom MatLab (The Mathworks Inc) routine was used to find all possible nonoverlapping sequences of 55 nucleotides with a GC content ranging between 45.5% and 56.4%. Those candidates were further checked by aligning their sequences against the rat mRNA database (RefSeq, NCBI database). All probes that hybridized more than 25% of their sequences to unspecific targets were removed. Probes covering contiguous exons were preferred, since they allowed us to detect specifically mature mRNAs. The probes were labeled with one Atto647N fluorophore at each end, to increase signal without inducing self-quenching of the synthetic fluorophore, and also to avoid modification of the DNA hybridization properties. Three such probes were chosen for each target (which implies that, in theory, one mRNA molecule will be detected by simultaneously imaging 6 fluorophores). The probes used during the study are listed subsequently (all sequences from 50 to 30 ) Beta-actin (coding sequence): act#1 ttctccatatcgtcccagttggttacaatgccgtgttcaatggggt acttcaggg act#2 aggtctcaaacatgatctgggtcatcttttcacggttggccttag ggttcagagg act#3 accagacagcactgtgttggcatagaggtctttacggatgtcaa cgtcacacttc Synaptophysin (coding sequence): syp#1: ttgaacacgaaccataagttgccaacccagagcaccaggttc aggaagccaaaca syp#2: gtgtagctgccacacgtagcaaaggcgaagatggcaaagac ccactgcagcacct syp#3: gcatctccttgataatgttctctgggtccgtggccatcttcacat cggacaggcc Synaptophysin (UTR): syp_utr#1 aacagcaaagacagttagggtctcctgggttgaggggt ggagacctaggatatgg Microscopy Research and Technique

STED-FISH

syp_utr#2 tcctctctctacagaggttatctcctctctgcccgtttcacccaagcctcctcca syp_utr#3 gagcccgctgtgtttaagccacacccctcctagaaccact ctctctggtcactta Synaptotagmin (coding sequence): syt#1 cataaacttctgcttcagcttggaaaaggcatcttccttcccttcc ccaggactg syt#2 ctggagatcacgccactcctcggtcacatggccaaaatccacgg tgttcatagga syt#3 gccccagtgctgttgtaaccaacgaagactttgccgatggcgtc gttcttgccaa Synaptotagmin (UTR): syt_utr#1 caaagtcttccgatctgactgcggatgttggttgctcaagc gctttcaagtcttc syt_utr#2 ctcggaatctttcttcaatcttaatgagacgttctggtggc gctctggggatggc syt_utr#3 acagatactggctaaagagcactatgtgggcagatgc agaaaggcttcgttttcc Synaptobrevin (coding sequence): syb#1 agatgatcatcatcttgaggtttttccaccagtatttgcgcttga gcttggctgc syb#2 catccacctgggcctgggtctgctgcagtctcctgttactggtaa gatttggagg syb#3 cgatcatccagttccgatagcttctggtcccgctccaggaccttt ccacattca Synaptobrevin (UTR): syb_utr#1 taacagctggctatttacagggggcacacacacggaca cacacacacacggatcc syb_utr#2 ggggtttgctctgtttggggagggtctggaattgtacag ggaagataggggaagg syb_utr#3 gaggctcccaagggatacaaagatgcaacctatggaag cctagacaggtggggtg Random control probes: rnd#1 ttaaacacaacgacgaccgggaacaatcattatggcacgcg gagcaatggctaac rnd#2 agacgcaacaagattacgtacgcgaacgaagtacgcacgtca ggttcaaatcgca rnd#3 gacctaatacgtaccacccgaagggtacgtgtaaagataggc cgactacgaaaca Fluorescent In Situ Hybridization We have optimized the main parameters that affect the success and specificity of the FISH procedure. These are number of probes per mRNA molecule, the formamide concentration and the temperature of the hybridization and washing steps. The closer the hybridization temperature is to the melting temperature of the probe, the more specific becomes the hybridization. Formamide stabilizes single-stranded nucleic acids and thereby decreases the hybridization temperature. Excess amounts of probe increase the probability that all targets are detected. However, high amounts of probe also increase background. We tested different hybridization temperatures (25–60 C, in steps of 5 C), different formamide concentrations (30– 50%, in steps of 10%) and finally different probe concentrations (1 ng/lL or 2 ng/lL, as total for all three probes, or 1 ng/mL of each probe). We obtained the following optimized protocol. Cells were fixed in 4% paraformaldehyde (PFA; Merck Millipore) in phosphate buffered saline (PBS, 137 mM NaCl, 2.7 mM KCl, 8mM Na2HPO4; Invitrogen) at pH 7.5 for 20 min at room temperature. Remaining aldehyde groups were quenched with 0.1 M glycine (Merck Millipore) in PBS, for 10 min at room temperature. Cells were briefly Microscopy Research and Technique

3

rinsed in 23 standard saline citrate (SSC, 0.3 M NaCl, 30 mM sodium citrate, pH 7.0; Invitrogen), and were then equilibrated for 5 min in 23 SSC supplemented with 40% formamide (Invitrogen), 10 mM Vanadyl complex (New England Biolabs), and 13 Denhardt’s solution (Invitrogen). Prior to hybridization, cells were incubated in prehybridization buffer consisting of 40% formamide, 10 lg/lL of DNAse/RNAse-free bovine serum albumin (BSA; Invitrogen), 0.5 lg/lL yeast transfer RNA (Invitrogen), 0.5 lg/lL sheared salmon sperm DNA (Invitrogen), 10 mM Vanadyl complex, 13 Denhardt’s solution in 23 SSC for 1 h at 42 C. Only 1 or all 3 probes per target mRNA were added to a new volume of prehybridization buffer to achieve a total concentration of 1.2 ng/lL. Cells were hybridized for 16 h at 42 C. Samples were sealed between two sheets of parafilmV M (Pecheney Plastics Packaging), to avoid drying. After hybridization, coverslips were washed first with 40% formamide in 23 SSC for 30 min, followed by 2 washings of 40% formamide in 13 SSC for 10 and 20 min, respectively. All washing steps were performed at 42 C. If no immunostaining was performed, cells were directly embedded in Mowi€ol (6 g glycerol; Merck Millipore, 6 mL deionized water, 12 mL 0.2 M Tris buffer pH 8.5, Merck Millipore, 2.4 g Mowiol 4–88; Merck Millipore), dried briefly, and stored at 4 C until imaging. R

Immunostaining (After FISH) After the last washing with 13 SSC during the FISH procedure, cells were fixed once again with 4% PFA and quenched as described previously. Cells were permeabilized with 0.1% Triton-X (Merck Millipore) in 13 PBS for 5 min. Primary and secondary antibodies were diluted in 1.5% BSA and 0.1% Triton-X in 13 PBS at 1:250 and 1:1,000, respectively. Guinea pig polyclonal anti–synaptophysin antibodies (Synaptic Systems, 101004) and mouse monoclonal anti-MAP2 antibodies (Abcam, ab11267) were incubated with the samples for 1 h at room temperature. After extensive washings with PBS, fluorescently labeled secondary antibodies were applied for 1 h. After washing thoroughly specimens were embedded and stored as described above. Propidium Iodide Staining As described in Figure 4, nucleic acids of primary hippocampal cultures were stained for 30 min with 500 nM of propidium iodide (PI) (Sigma-Aldrich) in PBS. Neuronal cultures were first fixed and quenched as described above. Different times of fixation (10, 20, and 30 min) and permeabilization with 0.1% Triton X100 were tested. A set of samples was treated with 1 mg/mL of DNase-free RNase A (Thermo Scientific) for 60 min at room temperature. After extensive washing, coverslips were mounted in Mowi€ol as described above. Synaptic Homeostasis Neuronal cultures were prepared as described above. Sister cultures (from the same animal) of 14 days in vitro (div) were treated for one week with 0.5 mM tetrodotoxin (TTX) or 0.5 mM 4-aminopyridine (4AP). To compensate for the degradation of the drugs, they were replenished every second day (days 1, 3, 5,

4

W.I. ZHANG ET AL.

and 7). Cultures were healthy prior fixation (as determined by examination by transmission-light microscopy). After the treatment, cells were processed for FISH as described above and imaged in the STED microscope. Microscopy and Image Analysis Confocal and STED images were taken with a Leica TCS STED system (Leica Microsystems) with a 1003 oil objective (1.4 numerical aperture, NA, 1003 HCX PL APO CS oil; Leica Microsystems). A 635 nm diode laser was used for excitation and a Spectra-Physics MaiTai multiphoton laser at 750 nm (Newport Spectra-Physics) produced the depletion donut (130 mW with the 1003 objective). Confocal and STED images were obtained at 1,024 3 1,024 or 2,048 3 2,048 pixels (with a pixel size of 20 nm) and photons were collected using a photomultiplier for confocal images, or an avalanche photodiode for STED images (Leica Microsystems). Scans were performed at 1,000 Hz and final images represent an average of 16 (confocal) or 96 scans (STED) (average performed line-by-line). Pinhole was kept at Airy 1 (150 mm with the 1003 objective), for both confocal and STED images. Epifluorescence images (Figs. 3 and 4) were taken with an Olympus IX71 microscope (Olympus, Hamburg, Germany), with an F-View II charge-coupled device camera (1,376 3 1,032 pixels with a pixel size of 6.45 3 6.45 mm) and a 1003 oil TIRFM objective (1.45 NA; Olympus). A Cy5 filter was used for the detection of Atto647N fluorophores (AHF, T€ ubingen, Germany). For display purposes, all images of FISH stainings presented in Figures 1, 2, and 5 were deconvolved with Huygens Essential software (Scientific Volume Imaging), using the built-in routines recommended by the company. All image analyses were performed on the raw data. RESULTS FISH in Primary Hippocampal Cultures Currently, several variations in the original FISH methodology can be performed. Among the most relevant aspects to take into consideration are the types of targets (chromosomes, mRNA, long noncoding RNAs, etc.), probes and detection methods. The nature and length of the hybridizing probes depends largely if chromosomes or RNAs are the target molecules. Traditionally, probes detecting chromosomal DNA are large DNA fragments (0.2–1 kb), prepared from genomic libraries (in plasmids). The probes to detect RNAs are commonly complementary RNA sequences of the target RNAs generated by in vitro transcription (Pinkel et al., 1988). These types of probes are typically tagged by incorporation of biotin or digoxigenin molecules by a procedure called nick translation (Mora et al., 2006). Alternatively, these probes have also been directly labeled with fluorescent organic dyes at random positions (Kato et al., 2006). A more recent strategy to generate FISH probes relies in the automated synthesis of oligonucleotides. This technology allows the incorporation of fluorophores (or other molecules) at defined positions of the probe sequence. We have decided to use fluorescently labeled DNA oligonucleotides of 55 bases with 2 fluorophores, one at each end, to keep a defined intensity per probe and

avoid self-quenching of the fluorophores. The probe design is critical for the success of FISH, especially if short oligonucleotides are used. Therefore, we first screened in silico the target sequences using a customwritten routine (see Methods) to ensure specificity of the probes. Additionally, we chose probes with similar physicochemical characteristics (e.g., the content of guanidine (G) and cytosine (C)), which enabled us to optimize the FISH methodology simultaneously for all probes. The selected sequences were then blasted against the rat (Rattus norvegicus) mRNA sequence database (NIH, Blast RefSeq). Probes that complemented more than 25% to other targets in the databases were discarded, due to their high probability of generating unspecific signal. If the objective is to detect mature mRNAs (Light and Elofsson, 2013), the ideal probes should anneal to contiguous exons (adjacent after the splicing of an intron, Fig. 1A). If nascent mRNAs or immature mRNAs are the target, probes should ideally be designed to anneal to introns. Using only one probe to detect specific mRNA molecules was not possible. Although signal was detected in confocal and STED microscopy for such samples, it was impossible to discriminate the fluorescence coming from annealed (specific signal) probes from that of unbound probes (unspecific signal; Fig. 1B). To solve this problem, we relied on the simultaneous detection of single mRNAs by multiple probes (Fig. 1A). The unspecific binding of any of the probes to the background can be easily discriminated from the increased signal provided by the binding of several probes to the same target mRNA (Figs. 1A and 1B). We found that the use of three probes, each coupled to two fluorophores, provides a sufficiently large signal-to-noise ratio, allowing the unbiased detection of the mRNAs of interest (Fig. 1B). Hybridization of primary hippocampal neurons with probes annealing to synaptophysin mRNA resulted in a robust cytosolic signal (Fig. 1C). Interestingly, several of the single spots that were observed in conventional confocal microscopy were actually found to contain multiple mRNAs when observed with enhanced resolution (STED, Fig. 1C, red circles). We applied this FISH methodology to successfully detect also mRNAs of other presynaptic proteins like synaptotagmin, synaptobrevin (Fig. 1D). To monitor whether we were detecting a representative population of mRNAs, we tested also a new set of probes that hybridize to the untranslated regions (UTRs) of the same mRNAs. We compared the density of spots given by STED-FISH experiments performed with the original probes, which anneal to the coding regions, or with the new, UTR-binding probes. The spot densities found in cell bodies of neurons were not different between the two sets of probes, for each individual protein (Fig. 1E). This suggests that our methodology was able to detect most of the mRNAs present in the neurons. The size of the spots observed with our STED-FISH approach was limited by the resolution of our STED set up (50 nm). Interestingly, we noted that the size of spots was not uniform across the different FISH experiments. The most noticeable difference was that the spot size and intensity of beta-actin mRNAs were larger than those of the synaptic protein mRNAs (Fig. Microscopy Research and Technique

STED-FISH

5

Fig. 1. Detection of neuronal mRNAs using Fluorescent in situ hybridization (FISH) and stimulated-emission depletion (STED) microscopy. A: Scheme representing the FISH strategy used to detect mRNAs. Three probes (with two fluorophores each) were designed to hybridize without overlapping to a single mRNA. B: Neurons were labeled by STED-FISH using single fluorescent probes or mixtures of three probes. The graph is a histogram of the intensities of all STED spots we detected in a typical experiment. Black line, sense probes (which should provide only nonspecific binding to the preparation). Gray line, single probes for synaptobrevin (syb). Red line, a mixture of three probes for synaptobrevin. No significant differences were detected between the intensity distributions of control spots or spots of single probes (P 5 0.425). The intensity of the spots provided by the three-probe mixture was significantly higher than those of the singleprobe ones (P < 0.001 in both cases; all comparisons were performed with a Kolmogorov–Smirnov test). C: Synaptophysin mRNAs and proteins were detected by FISH and immunofluorescence (IF), respec-

tively. The white square represents the area zoomed in the two panels on the right, in both confocal and STED mode. Note that some of the single spots observed with confocal microscopy were resolved as multiple spots with STED microscopy (red circles). D: Examples of STEDFISH results for the synaptic proteins synaptobrevin and synaptotagmin, as well as for a control reaction in which probes with randomized sequences were used (see Methods). White squares represent areas zoomed in the lower panels. The dashed line in the control FISH denotes the contour of the cell. All images of FISH stainings were deconvolved for display purposes (see Methods). E: A different sets of probes were designed against the untranslated regions (UTRs) of the synaptic protein mRNAs (see Methods). The density of the mRNA spots was determined by STED-FISH for both the normal probes and for the UTR probes. Similar numbers of spots were detected for all three genes, indicating that the STED-FISH measurements are sufficiently accurate to detect most mRNAs. Bars represent the mean6 s.e.m. from 5 to 6 independent experiments.

2). This observation confirms previous suggestions that beta-actin mRNAs in cultured neurons are found in mRNA granules (Bassell et al., 1998).

Specificity of the Signal The accuracy of the signal in FISH is principally determined by the quality of the probes and by the

Microscopy Research and Technique

6

W.I. ZHANG ET AL.

strong promoter of the plasmids (see Methods). The demonstration of the probe specificity was evident when transfected cells were compared to untransfected neighboring cells (Fig. 3): the former contain the hybridization probes, the others do not. Additionally, control or sense oligonucleotides were generated for every FISH probe, termed sense probe, since they have the same sequence of the mRNA, and hence should not anneal to the target. Interestingly, several sense probes had some background signal on transfected cells. This is most likely due to the direct hybridization of the sense probe to the transfected plasmids, which contain both the sense and anti-sense sequences. This observation suggests that the FISH parameters (formamide concentration, temperature, time, etc.) and the design of our probes resulted in specific signals from the investigated mRNAs.

Fig. 2. The spot size of mRNAs detected by STED-FISH. The spots sizes were determined by line scans (white lines on images) performed on the STED images. Lorentzian fits were obtained (red lines in graphs) and the full width at half maximum (FWHM) calculated. Note that the spot size of the synaptic proteins mRNAs is close to the maximum resolution our instrument can achieve, aside from the larger spots found for beta-actin, which suggests that beta-actin mRNAs are present in granule-like complexes.

hybridization conditions. Therefore, if FISH is performed for quantitative or precise localization studies, a major effort has to be made to validate them. Despite all the precaution taken during the probe design and the fact that no signal was detected in other cell types present in the hippocampal cultures (neurospecific FISH, see Methods), such problems cannot be excluded. We performed therefore a more directed control, which we consider important for all FISH studies employing novel probes or staining conditions. COS-7 cells (fibroblasts with no neuronal lineage) were transiently transfected with plasmids coding for the presynaptic proteins (synaptobrevin, synaptophysin, and synaptotagmin), fused to EGFP moieties. Transfected cells overexpressed the chimeric protein, and presented high levels of mRNA, driven by the

Minimizing the Loss of mRNAs FISH is typically performed on aldehyde-fixed tissue or cells, and is often combined with detergent permeabilization to perform immunostainings. However, little attention has been paid to the issue of whether mRNA molecules are lost during these treatments. The preservation of mRNAs by aldehyde fixatives is poorly documented. However, PFA has been shown to react better with RNA than glutaraldehyde, at least at room temperature (Hopwood, 1975; Urieli-Shoval et al., 1992). To minimize the loss of mRNA from cultured neurons, we tested several fixation times and permeabilization conditions. PI was used to follow the amount of nucleic acids. Due to the high levels of mRNAs and ribosomes in neurons, we were able to easily discriminate them from astrocytes by observing the intensity of the PI staining (Fig. 4A). RNA preservation in cultured neurons was maximal after 20 min of incubation with 4% PFA (Fig. 4B). Importantly, 15 min of permeabilization (see Methods) was sufficient to eliminate 25% of PI signal (RNA) even after 20 or 30 min of fixation. To verify that we were mainly looking at RNA with the PI staining, we also incubated samples with RNAse A before staining with PI (Fig. 4B). Localization of Presynaptic Proteins mRNAs in Hippocampal Neurons For the past few years, a large amount of evidence has accumulated suggesting that particular mRNAs coding for postsynaptic proteins can be differentially sorted and transported to dendrites (Cougot et al., 2008; Mikl et al., 2011). However, localization of mRNAs in axons has only been shown during axonal growth or axonal regeneration (Bassell et al., 1998; Taylor et al., 2009; Vogelaar et al., 2009). We applied our STED-optimized FISH protocol to study the localization of mRNAs coding for presynaptic (axonal) proteins, in mature neuronal cultures. As expected, the vast majority of mRNAs were found in the neuronal soma and in very rare occasions FISH signal was observed in dendrites, discriminated by the presence of the protein MAP2 (Fig. 5). Additionally, and in agreement with classical studies, none of the mRNAs we tested were found in mature axons Microscopy Research and Technique

STED-FISH

7

Fig. 3. Testing the specificity of the probes. COS-7 cells were transfected with plasmids coding for the neuronal proteins synaptophysin, synaptobrevin, and synaptotagmin, fused to fluorescent proteins (GFP; see Methods). FISH signal was observed for each probe in transfected cell but not in the untransfected neighboring cells. Exam-

ple images for one probe and its control (sense probe) are displayed, for each protein. A: Synaptophysin (probe syp#1 and its sense probe). B: Synaptobrevin (syph#1 and its sense probe). C: Synaptotagmin (stg#1 and its sense probe). Epifluorescence images were equally scaled, to allow a direct comparison.

(Kleiman et al., 1994). Our STED-FISH methodology allowed us to reliably detect mRNAs in different neuronal regions (recognized by region specific immunostainings) and confirms previous mRNA localization observations (Jung et al., 2012; Kleiman et al., 1990).

Further Biological Applications of STED-FISH Primary hippocampal neurons are a commonly used tool in the research field of neuroscience. However, these in vitro cultured neurons experience profound changes between plating and synaptic maturity,

Microscopy Research and Technique

8

W.I. ZHANG ET AL.

Fig. 4. mRNA retention after aldehyde fixation and detergent permeabilization. Neuronal cultures were chemically fixed for different time periods, and the retention of RNAs was determined by staining with propidium iodide (PI). A: Neurons displayed a brighter PI staining in the cytoplasm (indicated by solid arrowheads) than in the cell nucleus (*). In contrast, neighboring astrocytes (hollow arrowhead) showed a weak PI staining in the cytosol, dimmer than the nucleus.

B: Quantification of intensities from PI stainings on neurons. Incubation with DNase-free RNase A resulted in a large reduction in neuronal PI staining, which indicates that most of the PI signal represented neuronal RNAs. Note permeabilization of cell membranes with 0.1% of Triton X-100 for 15 min induces a significant loss of RNAs. Bars indicate mean with s.e.m. (n from left to right: 20, 29, 8, 32, 34, 8, 33, 34, 7 images).

Fig. 5. Localization of presynaptic protein mRNAs. Cultured hippocampal neurons of 14 div were used. FISH (cyan) and immunofluorescence (IF, red) stainings were performed successively. Images displaying the FISH signal were deconvolved as explained in Methods. Example images show the STED-FISH signal of synaptobrevin mRNAs (syb), predomi-

nantly in the cell body of a neuron (top left panel). Immunofluorescence against the neuronal marker synaptophysin (syp) stained the periphery of the neuronal cell body (merged images; top right). mRNAs of presynaptic synaptobrevin were rarely found in MAP2 positive dendrites (bottom panels), and were typically within a few micrometers from the cell body.

Microscopy Research and Technique

STED-FISH

9

Fig. 6. STED-FISH in biological applications. A: Different mRNAs were followed during in vitro development of hippocampal cultures. FISH was performed in neurons from the same batch (sister cultures), at different time points. Each point represents the mean 6 s.e.m. independent experiments with 6–10 STED-FISH images per time point. Comparisons were made by one-way ANOVA and a Bonferroni post

hoc test. P values with respect to div3 are depicted (*P < 0.05). B: Cultured neurons of 14 div were chronically inhibited with 0.5 mM TTX, chronically stimulated with 0.5 mM 4-aminopiridine (4-AP) or not treated (Ctrl) for 7 days. STED-FISH was performed and the density of synaptobrevin (syb) and beta-actin mRNAs was calculated. Each bar represents the mean of 3 independent experiments 6 s.e.m.

during about 30 days in vitro (div). We followed the mRNA levels of different proteins for up to 28 div. As expected, developing neurons need large amounts of structural proteins, which is suggested by the high levels of beta-actin mRNA already found at div 3 (Fig. 6A). On the other hand, synapse formation and neuronal maturity is slowly reached, at around div 10–14. Our observations suggest that the mRNA levels synaptotagmin and synaptobrevin (essential proteins for synaptic vesicle release) were stabilized at the div 10. However, the levels of the mRNA of our third synaptic target, synaptophysin, reached a maximum level much later, at 21 div (Fig. 6A). The association of synaptophysin to the synaptic activity is not yet clear, despite its strict neuronal and synaptic vesicle localization. These results suggest that the expression of different synaptic vesicle proteins is not closely coregulated, despite the fact that they are all needed only for the formation of one organelle, the synaptic vesicle. It has also been proposed that silencing neurons for a period of time resulted in presynaptic strengthening (Wierenga et al., 2006). This activity dependent adaptation of the synapse was termed synaptic homeostasis. Interestingly, the observed increase in firing rates after sustained inhibition was associated to an increment in transcription (mRNA production), but not in protein translation (Han and Stevens, 2009). Therefore, we decided to monitor with STED-FISH the variations in mRNA levels in chronically stimulated or silenced neurons. Neuronal cultures were treated for 7 days with TTX (neuronal activity inhibitor) or 4-AP (neuronal stimulator, Miller and Heuser, 1984). As expected, no differences were observed in the mRNA levels of the cytoskeletal protein betaactin. However, the mRNA levels of the presynaptic protein synaptobrevin also remained similar to the control cultures (Fig. 6B). Our observations that presynaptic proteins are not affected by chronically stimulating or inhibiting neurons indicate that the homeostatic control of the synapse might take place primarily at the postsynaptic side, at least, in this type of cultured neuron.

DISCUSSION We adapted and optimized conventional FISH experiments here to match the imaging requirements of the STED imaging. Our methodology allows reliable detection of endogenous mRNAs in neurons. Interestingly, the enhanced resolution obtained by STED microscopy revealed that several of the diffractionlimited spots that have often been described in the literature as single mRNAs were actually assemblies of multiple mRNAs (Fig. 1C), which should open new directions of investigation in the mRNA organization field. Our STED-FISH approach has increased the conventional spatial resolution of mRNA detection. We have shown that STED-FISH can be used for biological questions (Figs. 5 and 6). Importantly, our methodology can detect endogenous levels of low abundance mRNAs, and does not need the overexpression of engineered mRNAs (Fusco et al., 2003; Paige et al., 2011). Some of the previous approaches to detect single mRNAs used dozens of fluorescent probes simultaneously (Femino et al., 1998; Mueller et al., 2013; Raj et al., 2008), since higher signals were necessary than in our study. We were able to detect with high spatial resolution mRNA molecules using only three probes for each target. We expect that the use of only three probes will allow the investigation of short RNA molecules that otherwise are not able to allocate dozens of probes. Despite the identification of mRNA spots of at most 50–60 nm in diameter (Fig. 2), which was easily achieved with STED microscopy, it is still difficult to determine whether every one of the spots we identified represents a single mRNA molecule. Nevertheless, unlike conventional microscopy, STED provides a more accurate size of the mRNA spot—which was evidently larger for beta-actin, when compared with the other three mRNAs analyzed (Fig. 2). This proves that STED-FISH could be an important addition to the study of mRNA complexes or granules during their storage and transport in cells. We also monitored the mRNA densities at different ages of neuronal cultures (Fig. 6A). Interestingly, we observed that the vesicular protein synaptophysin,

Microscopy Research and Technique

10

W.I. ZHANG ET AL.

which does not yet have a clear function in the synapses, reaches higher mRNA levels at a later div (21) than the other presynaptic proteins (div 10). One putative role of synaptophysin is in coordinating the biogenesis of synaptic vesicles (Pennuto et al., 2003), which may imply a need for high levels of synaptophysin even after the neurons reach maturity. An additional and unresolved question is if the amounts of mRNAs are influenced by neuronal activity. As this question is relevant to the field of synaptic homeostasis, we investigated it by using STED-FISH. Surprisingly, we observed no changes in the levels of mRNAs of presynaptic proteins. This suggests that the adaptation to higher or lower neuronal activity might occur mainly postsynaptically (Fig. 6B), with the presynaptic side being less affected by activity, at least in hippocampal cultures. Techniques like quantitative PCR or deep sequencing are capable to detect mRNA amounts with high quantitative precision, even at a single cell scale (Livak et al., 2013; Shapiro et al., 2013). However, these techniques miss the cellular localization of the detected transcripts, which makes it difficult to study mRNA regulators and interactors. Moreover, accurate localization of both mRNAs and proteins is especially important for the study of mRNA sorting and transport within the complex morphology of neurons (Piper and Holt, 2004). We suggest that this methodology will be valuable in the molecular understanding of mRNA granules (Anderson and Kedersha, 2006; Kiebler and Bassell, 2006) and of local translation in neurons (Martin and Zukin, 2006; Piper and Holt, 2004), especially if multiple super-resolved colors can be used to estimate molecular interactions within subcellular compartments. ACKNOWLEDGMENT We thank Christina Sch€ afer for technical assistance. REFERENCES Abbe E. 1873. Beitr€ age zur Theorie des Mikroskops und der mikroskopischen Wahrnehmung. Archiv f mikrosk Anatomie 9:413–418. Anderson P, Kedersha N. 2006. RNA granules. JCB 172:803–808. Bassell GJ, Zhang H, Byrd AL, Femino AM, Singer RH, Taneja KL, Lifshitz LM, Herman IM, Kosik KS. 1998. Sorting of beta-actin mRNA and protein to neurites and growth cones in culture. J Neurosci 18:251–265. Bertrand E, Chartrand P, Schaefer M, Shenoy SM, Singer RH, Long RM. 1998. Localization of ASH1 mRNA particles in living yeast. Mol Cell 2:437–445. Cougot N, Bhattacharyya SN, Tapia-Arancibia L, Bordonn e R, Filipowicz W, Bertrand E, Rage F. 2008. Dendrites of mammalian neurons contain specialized P-body-like structures that respond to neuronal activation. J Neurosci 28:13793–13804. Femino AM, Fay FS, Fogarty K, Singer RH. 1998. Visualization of single RNA transcripts in situ. Science 280:585–590. Fusco D, Accornero N, Lavoie B, Shenoy SM, Blanchard JM, Singer RH, Bertrand E. 2003. Single mRNA molecules demonstrate probabilistic movement in living mammalian cells. Curr Biol 13:161– 167. Hall BD, Spiegelman S. 1961. Sequence complementarity of T2-DNA and T2-specific RNA. Proc Natl Acad Sci USA 47:137–163. Han EB, Stevens CF. 2009. Development regulates a switch between post- and presynaptic strengthening in response to activity deprivation. Proc Natl Acad Sci USA 106:10817–10822. Hopwood D. 1975. The reactions of glutaraldehyde with nucleic acids. Histochem J 7:267–276. Jung H, Yoon BC, Holt CE. 2012. Axonal mRNA localization and local protein synthesis in nervous system assembly, maintenance and repair. Nat Rev Neurosci 13:308–324.

Kato A, Albert PS, Vega JM, Birchler JA. 2006. Sensitive fluorescence in situ hybridization signal detection in maize using directly labeled probes produced by high concentration DNA polymerase nick translation. Biotech Histochem 81:71–78. Kiebler MA, Bassell GJ. 2006. Neuronal RNA granules: Movers and makers. Neuron 51:685–690. Kleiman R, Banker G, Steward O. 1990. Differential subcellular localization of particular mRNAs in hippocampal neurons in culture. Neuron 5:821–830. Kleiman R, Banker G, Steward O. 1994. Development of subcellular mRNA compartmentation in hippocampal neurons in culture. J Neurosci 14:1130–1140. Lalkens B, Testa I, Willig KI, Hell SW. 2012. MRT letter: Nanoscopy of protein colocalization in living cells by STED and GSDIM. Microsc Res Tech 75:1–6. Langer-Safer PR, Levine M, Ward DC. 1982. Immunological method for mapping genes on Drosophila polytene chromosomes. Proc Natl Acad Sci USA 79:4381–4385. LeCuyer KA, Behlen LS, Uhlenbeck OC. 1996. Mutagenesis of a stacking contact in the MS2 coat protein-RNA complex. EMBO J 15:6847–6853. Light S, Elofsson A. 2013. The impact of splicing on protein domain architecture. Curr Opin Struct Biol 23:451–458. Lionnet T, Czaplinski K, Darzacq X, Shav-Tal Y, Wells AL, Chao JA, Park HY, de Turris V, Lopez-Jones M, Singer RH. 2011. A transgenic mouse for in vivo detection of endogenous labeled mRNA. Nat Methods 8:165–170. Livak KJ, Wills QF, Tipping AJ, Datta K, Mittal R, Goldson AJ, Sexton DW, Holmes CC. 2013. Methods for qPCR gene expression profiling applied to 1440 lymphoblastoid single cells. Methods 59: 71–79. Markaki Y, Smeets D, Fiedler S, Schmid VJ, Schermelleh L, Cremer T, Cremer M. 2012. The potential of 3D-FISH and super-resolution structured illumination microscopy for studies of 3D nuclear architecture: 3D structured illumination microscopy of defined chromosomal structures visualized by 3D (immuno)-FISH opens new perspectives for studies of nuclear architecture. Bioessays 34:412–426. Martin KC, Zukin RS. 2006. RNA trafficking and local protein synthesis in dendrites: An overview. J Neurosci 26:7131–7134. Miesenb€ ock G, De Angelis DA, Rothman JE. 1998. Visualizing secretion and synaptic transmission with pH-sensitive green fluorescent proteins. Nature 394:192–195. Mikl M, Vendra G, Kiebler MA. 2011. Independent localization of MAP2, CaMKIIa and b-actin RNAs in low copy numbers. EMBO Rep 12:1077–1084. Miller TM, Heuser JE. 1984. Endocytosis of synaptic vesicle membrane at the frog neuromuscular junction. J Cell Biol 98:685–698. Mora JR, Knoll JHM, Rogan PK, Getts RC, Wilson GS. 2006. Dendrimer FISH detection of single-copy intervals in acute promyelocytic leukemia. Mol Cell Probes 20:114–120. Mueller F, Senecal A, Tantale K, Marie-Nelly H, Ly N, Collin O, Basyuk E, Bertrand E, Darzacq X, Zimmer C. 2013. FISH-quant: Automatic counting of transcripts in 3D FISH images. Nat Methods 10:277–278. M€ uller P, Schmitt E, Jacob A, Hoheisel J, Kaufmann R, Cremer C, Hausmann M. 2010. COMBO-FISH enables high precision localization microscopy as a prerequisite for nanostructure analysis of genome loci. Int J Mol Sci 11:4094–4105. M€ uller T, Schumann C, Kraegeloh A. 2012. STED microscopy and its applications: New insights into cellular processes on the nanoscale. ChemPhysChem 13:1986–2000. Opazo F, Levy M, Byrom M, Sch€ afer C, Geisler C, Groemer TW, Ellington AD, Rizzoli SO. 2012. Aptamers as potential tools for superresolution microscopy. Nat Methods 9:938–939. Paige JS, Wu KY, Jaffrey SR. 2011. RNA mimics of green fluorescent protein. Science 333:642–646. Pennuto M, Bonanomi D, Benfenati F, Valtorta F. 2003. Synaptophysin I controls the targeting of VAMP2/synaptobrevin II to synaptic vesicles. Mol Biol Cell 14:4909–4919. Pinkel D, Landegent J, Collins C, Fuscoe J, Segraves R, Lucas J, Gray J. 1988. Fluorescence in situ hybridization with human chromosome-specific libraries: Detection of trisomy 21 and translocations of chromosome 4. Proc Natl Acad Sci USA 85:9138–9142. Piper M, Holt C. 2004. RNA translation in axons. Annu Rev Cell Dev Biol 20:505–523. Rackham O, Rackham O, Brown CM, Brown CM. 2004. Visualization of RNA–protein interactions in living cells: FMRP and IMP1 interact on mRNAs. EMBO J 23:3346–3355. Raj A, van den Bogaard P, Rifkin SA, van Oudenaarden A, Tyagi S. 2008. Imaging individual mRNA molecules using multiple singly labeled probes. Nat Methods 5:877–879.

Microscopy Research and Technique

STED-FISH Ries J, Kaplan C, Platonova E, Eghlidi H, Ewers H. 2012. A simple, versatile method for GfP-based super-resolution microscopy via nanobodies. Nat Methods 1–6. Shapiro E, Biezuner T, Linnarsson S. 2013. Single-cell sequencingbased technologies will revolutionize whole-organism science. Nat Rev Genet 14:618–630. Taylor AM, Berchtold NC, Perreau VM, Tu CH, Li Jeon N, Cotman CW. 2009. Axonal mRNA in uninjured and regenerating cortical mammalian axons. J Neurosci 29:4697–4707. Toomre D, Bewersdorf J. 2010. A new wave of cellular imaging. Annu Rev Cell Dev Biol 26:285–314. Trask BJ. 2002. Human cytogenetics: 46 chromosomes, 46 years and counting. Nat Rev Genet 3:769–778. Urieli-Shoval S, Meek RL, Hanson RH, Ferguson M, Gordon D, Benditt EP. 1992. Preservation of RNA for in situ hybridization: Carnoy’s versus formaldehyde fixation. J Histochem Cytochem 40: 1879–1885.

Microscopy Research and Technique

11

Van Prooijen-Knegt AC, Van Hoek JF, Bauman JG, Van Duijn P, Wool IG, van der Ploeg M. 1982. In situ hybridization of DNA sequences in human metaphase chromosomes visualized by an indirect fluorescent immunocytochemical procedure. Exp Cell Res 141:397–407. Vogelaar CF, Gervasi NM, Gumy LF, Story DJ, Raha-Chowdhury R, Leung K-M, Holt CE, Fawcett JW. 2009. Axonal mRNAs: Characterisation and role in the growth and regeneration of dorsal root ganglion axons and growth cones. Mol Cell Neurosci 42:102–115. Weiland Y, Lemmer P, Cremer C. 2011. Combining FISH with localisation microscopy: Super-resolution imaging of nuclear genome nanostructures. Chromosome Res 19:5–23. Wierenga CJ, Walsh MF, Turrigiano GG. 2006. Temporal regulation of the expression locus of homeostatic plasticity. J Neurophysiol 96: 2127–2133. Willig KI, Rizzoli SO, Westphal V, Jahn R, Hell SW. 2006. STED microscopy reveals that synaptotagmin remains clustered after synaptic vesicle exocytosis. Nature 440:935–939.