VECTOR-BORNE AND ZOONOTIC DISEASES Volume 15, Number 2, 2015 ª Mary Ann Liebert, Inc. DOI: 10.1089/vbz.2014.1720
First Identification of Anaplasma platys in the Blood of Dogs from French Guiana Mustapha Dahmani,1 Jean-Lou Marie´,2 Oleg Mediannikov,3 Didier Raoult,1 and Bernard Davoust1,2
Abstract
Anaplasma platys is the causative agent of infectious cyclic thrombocytopenia in dogs. This infection is worldwide and reported with a higher incidence in tropical and subtropical areas such as South America. Until now, there has been no report of this bacterium in French Guiana. The aim of this study was molecular investigation of A. platys occurrence in the blood of autochthonous dogs in this region. A total 65 blood samples were taken from the shelter dogs in the cities of Cayenne and Kourou, and from dogs of private owners in the city of Cayenne. The results show that at least 15.38% (10/65) were positive to this pathogen. The strain identified in this study has been reported worldwide. These findings should be considered in the way that local veterinarians handle suspected cases of canine anaplasmosis and ehrlichiosis. Key Words:
Anaplasma platys—Dog—French Guiana.
Introduction
A
naplasma platys is the causative agent of infectious cyclic thrombocytopenia in dogs, a disease that manifests as progressively diminishing episodes of fever and thrombocytopenia (Inokuma et al. 2007). This bacterium was first isolated from a dog in Florida, United States, in 1978 (Harvey et al. 1978). Since then, this infection has been reported worldwide, with a higher incidence in tropical and subtropical areas, such as South America. It is an emerging disease in Europe (Chomel 2011). A. platys infects platelets in the blood, and a recent report indicates that A. platys can infect megakaryocytes and promegakaryocytes of the bone marrow; symptoms were associated with dysmegakaryocytopoiesis (De Tommasi et al. 2014). Coinfection with other pathogens such as Ehrlichia canis can enhance the virulence of this bacterium by influencing the patterns and severity of hematologic and serologic findings (Gaunt et al. 2010). The DNA of this bacterium was amplified from Rhipicephalus sanguineus, but the competence of this tick to transmit this pathogen needs to be confirmed (De Tommasi et al. 2014). Other ticks, like Amblyomma cajennense in Brazil and the louse Heterodoxus spiniger in Australia, are suspected vectors on the basis of epidemiological data (Costa-Ju´nior et al. 2013). In experimental infection of R. sanguineus with A. platys,
the agent was not detected in the midgut or salivary glands of exposed adult ticks by light or transmission electron microscopy (Inokuma et al. 2007). French Guiana is a French region located on the northeastern coast of South America in which A. platys had never been reported. This is the first report of an autochthonous A. platys infection in this region. Materials and Methods
In January of 2014, study was conducted in Cayenne and Kourou. Sampling was performed from shelter dogs of each city and from some dogs of private owners after their consent in Cayenne. Blood samples were taken from apparently healthy dogs and collected by cephalic venipuncture into EDTA tubes. Data regarding infestation by ectoparasites was recorded. All samples were stored at - 20C and transported to the laboratory. DNA was extracted from 200 lL of blood, and purification performed on the BioRobot EZ1 (Qiagen, Qiagen, Courtaboeuf, France) using a commercial DNA extraction kit (QIAamp DNA Mini Kit, Qiagen, Courtaboeuf, France) according to the manufacturer’s instructions. PCR amplification was conducted targeting the 23S rRNA gene by primers and
1
Research Unit of Emerging Infectious and Tropical Diseases (URMITE) UMR CNRS 7278 IRD 198 INSERM U1095 Aix-Marseille University, Marseille, France. 2 Animal Epidemiology Working Group of the Military Health Service, Toulon, France. 3 Research Unit of Emerging Infectious and Tropical Diseases (URMITE) UMR CNRS 7278 IRD 198 INSERM U1095 Aix-Marseille University, Institute of Research for the Development, Dakar, Senegal.
170
A. platys IN FRENCH GUIANAN DOGS
171
Table 1. Primers and Probes Targeting the 23S rRNA Gene Used in This Study Primers and probes qPCR TtAna-f TtAna-r TtAna-s Conventional PCR Ana23S-212f Ana23S-908r
Sequences 5¢/3¢
Amplicon size
Annealing temperature
169 bp
60C
500 bp
55C
TGACAGCGTACCTTTTGCAT TGGAGGACCGAACCTGTTAC FAM-GGATTAGACCCGAAACCAAG-TAMRA ATAAGCTGCGGGGAATTGTC GTAACAGGTTCGGTCCTCCA
probes that amplify most of the bacteria belonging to the Anaplasmataceae family (Dahmani, unpublished data) (Table 1). Primers and a Taqman probe were used to screen all the samples. All of the positive results were amplified using conventional PCR. The amplicon obtained was sequenced on a Biosystems 3130xl Genetic Analyzer (Qiagen, France) by using the DNA sequencing BigDye Terminator Kit (PerkinElmer, Waltham, MA) as described by the manufacturer. The sequences obtained were assembled using ChromasPro 1.7 (Technelysium Pty Ltd., Tewantin, Australia) and compared with Anaplasmataceae sequences in the GenBank database using BLAST. In total, 65 blood samples were collected. Among dogs sampled, 11 were from private owners in Cayenne, and, respectively, 32 and 22 samples were from the shelter dogs of Cayenne and Kourou. One dog from a private owner was infested with ticks, and three from the shelter dogs of Cayenne were infested with fleas. Results and Discussion
The screening by qPCR showed that the blood of 18/65 (27.7%) dogs contained DNA of bacteria belonging to the Anaplasmataceae family. Using conventional PCR, a PCR product of the expected size was obtained from only 10 of 18 positives by qPCR. Six were from the shelter dogs of Cayenne, and four were from the shelter dogs of Kourou. Dogs infested with ectoparasites were all negative. The other eight samples were positive by qPCR and negative in conventional PCR; a probable explanation for this could be a low DNA quantity. Real-time amplification of those samples showed high cycle threshold numbers between 36 and 41. Sequencing analysis was concluding for A. platys. This sequence was identical in all positive amplicons and showed 100% identity with A. platys sequences available in GenBank and amplified from dog blood in France (KM021412), Algeria (KM021427), and New Caledonia (KM021424) (personal data). This sequence of A. platys was deposited in GenBank as accession number KM021414. This is the first report of A. platys in dogs from French Guiana. Prior to this study, this region, like many countries in tropical regions, was suspected to be endemic for canine anaplasmosis, such as in Brazil (Dantas-Torres 2008). We confirmed the presence of a strain of A. platys worldwide reported. Considering the sampling of our study, the prevalence was 15.38% (10/65). However, comparing with the results reported in other countries in South America, the difference could be explained by parameters such as the dog population under sampling, type and number of specimens tested, extent of tick infestation, and methods of diagnosis. In
Brazil, in a sample of 199 dogs, 7/53 (13.20%) stray dogs and 21/146 (14.38%) of dogs that had owners, but were living outdoors, were positive by PCR (Lasta et al. 2013). In the same study, 19/196 (9.7%) dogs were positive by enzymelinked immunosorbent assay (ELISA). There was no positive association between the PCR and ELISA results (Lasta et al. 2013). In Panama, in a sample of 201 dogs tested with clinically potential signs compatible with ehrlichiosis, A. platys was identified in 21.4% on blood smear examination. Specific inclusion in platelets was observed in 12 dogs (Santamaria et al. 2014). Our finding is in agreement with those reported in studies cited above. However the real prevalence in the population of dogs from French Guiana requires a larger study, representative of the canine population of this area. Recently there was a description of persistence of A. platys in the blood of two family members and her dog coinfected with other Ehrlichia bacteria (Breitschwerdt et al. 2014). The involvement of dogs in human infection by A. platys was not demonstrated. In our study, all dogs sampled from private owners were negative. However, examining sick dogs, local veterinarians from French Guiana should consider a coinfection by E. canis and A. platys, particularly if the dogs show symptoms of thrombocytopenia. Acknowledgments
We thank The Foundation Me´diterrane´e Infection for funding this study and the French Forces Medical Service for its support. We also thank G. Hyvert, V. Pommier de Santi, T. Lamour, and D. Blanchet for their assistance. Author Disclosure Statement
No competing financial interests exist. References
Breitschwerdt EB, Hegarty BC, Qurollo BA, Saito TB, et al. Intravascular persistence of Anaplasma platys, Ehrlichia chaffeensis, and Ehrlichia ewingii DNA in the blood of a dog and two family members. Parasit Vectors 2014; 7:298. Chomel B. Tick-borne infections in dogs-an emerging infectious threat. Vet Parasitol 2011; 179:294–301. Costa-Ju´nior LM, Rembeck K, Passos LMF, Ribeiro MFB. Factors associated with epidemiology of Anaplasma platys in dogs in rural and urban areas of Minas Gerais State, Brazil. Prev Vet Med 2013; 109:321–326. Dantas-Torres F. Canine vector-borne diseases in Brazil. Parasit Vectors 2008; 1:25. De Tommasi AS, Baneth G, Breitschwerdt EB, Stanneck D, et al. Anaplasma platys in bone marrow megakaryocytes of young dogs. J Clin Microbiol 2014; 52:2231–2234.
172
Gaunt S, Beall M, Stillman B, Lorentzen L, et al. Experimental infection and co-infection of dogs with Anaplasma platys and Ehrlichia canis: Hematologic, serologic and molecular findings. Parasit Vectors 2010; 3:33. Harvey JW, Simpson CF, Gaskin JM. Cyclic thrombocytopenia induced by a Rickettsia-like agent in dogs. J Infect Dis 1978; 137:182–188. Inokuma H. Vectors and reservoir hosts of Anaplasmataceae. In: Raoult D, Parola P, eds. Rickettsial Disease. New York: Taylor Grancis Group LLC, 2007: 199–212. Lasta CS, Pires A, Messick JB, Oliveira ST, et al. Molecular detection of Ehrlichia canis and Anaplasma platys in dogs in southern Brazil Rev Bras Parasitol Vet 2013; 22:360–366.
DAHMANI ET AL.
Santamaria A, Calzada JE, Saldan˜a A, Yabsley MJ, et al. Molecular diagnosis and species identification of Ehrlichia and Anaplasma infections in dogs from Panama, Central America. Vector Borne Zoonotic Dis. 2014; 14:368–370.
Address correspondence to: Bernard Davoust URMITE Faculte´ de me´decine 27, Bd Jean Moulin 13385 Marseille Cedex 05 France E-mail: [email protected]
First Identification of Anaplasma platys in the Blood of Dogs from French Guiana Mustapha Dahmani,1 Jean-Lou Marie´,2 Oleg Mediannikov,3 Didier Raoult,1 and Bernard Davoust1,2
Abstract
Anaplasma platys is the causative agent of infectious cyclic thrombocytopenia in dogs. This infection is worldwide and reported with a higher incidence in tropical and subtropical areas such as South America. Until now, there has been no report of this bacterium in French Guiana. The aim of this study was molecular investigation of A. platys occurrence in the blood of autochthonous dogs in this region. A total 65 blood samples were taken from the shelter dogs in the cities of Cayenne and Kourou, and from dogs of private owners in the city of Cayenne. The results show that at least 15.38% (10/65) were positive to this pathogen. The strain identified in this study has been reported worldwide. These findings should be considered in the way that local veterinarians handle suspected cases of canine anaplasmosis and ehrlichiosis. Key Words:
Anaplasma platys—Dog—French Guiana.
Introduction
A
naplasma platys is the causative agent of infectious cyclic thrombocytopenia in dogs, a disease that manifests as progressively diminishing episodes of fever and thrombocytopenia (Inokuma et al. 2007). This bacterium was first isolated from a dog in Florida, United States, in 1978 (Harvey et al. 1978). Since then, this infection has been reported worldwide, with a higher incidence in tropical and subtropical areas, such as South America. It is an emerging disease in Europe (Chomel 2011). A. platys infects platelets in the blood, and a recent report indicates that A. platys can infect megakaryocytes and promegakaryocytes of the bone marrow; symptoms were associated with dysmegakaryocytopoiesis (De Tommasi et al. 2014). Coinfection with other pathogens such as Ehrlichia canis can enhance the virulence of this bacterium by influencing the patterns and severity of hematologic and serologic findings (Gaunt et al. 2010). The DNA of this bacterium was amplified from Rhipicephalus sanguineus, but the competence of this tick to transmit this pathogen needs to be confirmed (De Tommasi et al. 2014). Other ticks, like Amblyomma cajennense in Brazil and the louse Heterodoxus spiniger in Australia, are suspected vectors on the basis of epidemiological data (Costa-Ju´nior et al. 2013). In experimental infection of R. sanguineus with A. platys,
the agent was not detected in the midgut or salivary glands of exposed adult ticks by light or transmission electron microscopy (Inokuma et al. 2007). French Guiana is a French region located on the northeastern coast of South America in which A. platys had never been reported. This is the first report of an autochthonous A. platys infection in this region. Materials and Methods
In January of 2014, study was conducted in Cayenne and Kourou. Sampling was performed from shelter dogs of each city and from some dogs of private owners after their consent in Cayenne. Blood samples were taken from apparently healthy dogs and collected by cephalic venipuncture into EDTA tubes. Data regarding infestation by ectoparasites was recorded. All samples were stored at - 20C and transported to the laboratory. DNA was extracted from 200 lL of blood, and purification performed on the BioRobot EZ1 (Qiagen, Qiagen, Courtaboeuf, France) using a commercial DNA extraction kit (QIAamp DNA Mini Kit, Qiagen, Courtaboeuf, France) according to the manufacturer’s instructions. PCR amplification was conducted targeting the 23S rRNA gene by primers and
1
Research Unit of Emerging Infectious and Tropical Diseases (URMITE) UMR CNRS 7278 IRD 198 INSERM U1095 Aix-Marseille University, Marseille, France. 2 Animal Epidemiology Working Group of the Military Health Service, Toulon, France. 3 Research Unit of Emerging Infectious and Tropical Diseases (URMITE) UMR CNRS 7278 IRD 198 INSERM U1095 Aix-Marseille University, Institute of Research for the Development, Dakar, Senegal.
170
A. platys IN FRENCH GUIANAN DOGS
171
Table 1. Primers and Probes Targeting the 23S rRNA Gene Used in This Study Primers and probes qPCR TtAna-f TtAna-r TtAna-s Conventional PCR Ana23S-212f Ana23S-908r
Sequences 5¢/3¢
Amplicon size
Annealing temperature
169 bp
60C
500 bp
55C
TGACAGCGTACCTTTTGCAT TGGAGGACCGAACCTGTTAC FAM-GGATTAGACCCGAAACCAAG-TAMRA ATAAGCTGCGGGGAATTGTC GTAACAGGTTCGGTCCTCCA
probes that amplify most of the bacteria belonging to the Anaplasmataceae family (Dahmani, unpublished data) (Table 1). Primers and a Taqman probe were used to screen all the samples. All of the positive results were amplified using conventional PCR. The amplicon obtained was sequenced on a Biosystems 3130xl Genetic Analyzer (Qiagen, France) by using the DNA sequencing BigDye Terminator Kit (PerkinElmer, Waltham, MA) as described by the manufacturer. The sequences obtained were assembled using ChromasPro 1.7 (Technelysium Pty Ltd., Tewantin, Australia) and compared with Anaplasmataceae sequences in the GenBank database using BLAST. In total, 65 blood samples were collected. Among dogs sampled, 11 were from private owners in Cayenne, and, respectively, 32 and 22 samples were from the shelter dogs of Cayenne and Kourou. One dog from a private owner was infested with ticks, and three from the shelter dogs of Cayenne were infested with fleas. Results and Discussion
The screening by qPCR showed that the blood of 18/65 (27.7%) dogs contained DNA of bacteria belonging to the Anaplasmataceae family. Using conventional PCR, a PCR product of the expected size was obtained from only 10 of 18 positives by qPCR. Six were from the shelter dogs of Cayenne, and four were from the shelter dogs of Kourou. Dogs infested with ectoparasites were all negative. The other eight samples were positive by qPCR and negative in conventional PCR; a probable explanation for this could be a low DNA quantity. Real-time amplification of those samples showed high cycle threshold numbers between 36 and 41. Sequencing analysis was concluding for A. platys. This sequence was identical in all positive amplicons and showed 100% identity with A. platys sequences available in GenBank and amplified from dog blood in France (KM021412), Algeria (KM021427), and New Caledonia (KM021424) (personal data). This sequence of A. platys was deposited in GenBank as accession number KM021414. This is the first report of A. platys in dogs from French Guiana. Prior to this study, this region, like many countries in tropical regions, was suspected to be endemic for canine anaplasmosis, such as in Brazil (Dantas-Torres 2008). We confirmed the presence of a strain of A. platys worldwide reported. Considering the sampling of our study, the prevalence was 15.38% (10/65). However, comparing with the results reported in other countries in South America, the difference could be explained by parameters such as the dog population under sampling, type and number of specimens tested, extent of tick infestation, and methods of diagnosis. In
Brazil, in a sample of 199 dogs, 7/53 (13.20%) stray dogs and 21/146 (14.38%) of dogs that had owners, but were living outdoors, were positive by PCR (Lasta et al. 2013). In the same study, 19/196 (9.7%) dogs were positive by enzymelinked immunosorbent assay (ELISA). There was no positive association between the PCR and ELISA results (Lasta et al. 2013). In Panama, in a sample of 201 dogs tested with clinically potential signs compatible with ehrlichiosis, A. platys was identified in 21.4% on blood smear examination. Specific inclusion in platelets was observed in 12 dogs (Santamaria et al. 2014). Our finding is in agreement with those reported in studies cited above. However the real prevalence in the population of dogs from French Guiana requires a larger study, representative of the canine population of this area. Recently there was a description of persistence of A. platys in the blood of two family members and her dog coinfected with other Ehrlichia bacteria (Breitschwerdt et al. 2014). The involvement of dogs in human infection by A. platys was not demonstrated. In our study, all dogs sampled from private owners were negative. However, examining sick dogs, local veterinarians from French Guiana should consider a coinfection by E. canis and A. platys, particularly if the dogs show symptoms of thrombocytopenia. Acknowledgments
We thank The Foundation Me´diterrane´e Infection for funding this study and the French Forces Medical Service for its support. We also thank G. Hyvert, V. Pommier de Santi, T. Lamour, and D. Blanchet for their assistance. Author Disclosure Statement
No competing financial interests exist. References
Breitschwerdt EB, Hegarty BC, Qurollo BA, Saito TB, et al. Intravascular persistence of Anaplasma platys, Ehrlichia chaffeensis, and Ehrlichia ewingii DNA in the blood of a dog and two family members. Parasit Vectors 2014; 7:298. Chomel B. Tick-borne infections in dogs-an emerging infectious threat. Vet Parasitol 2011; 179:294–301. Costa-Ju´nior LM, Rembeck K, Passos LMF, Ribeiro MFB. Factors associated with epidemiology of Anaplasma platys in dogs in rural and urban areas of Minas Gerais State, Brazil. Prev Vet Med 2013; 109:321–326. Dantas-Torres F. Canine vector-borne diseases in Brazil. Parasit Vectors 2008; 1:25. De Tommasi AS, Baneth G, Breitschwerdt EB, Stanneck D, et al. Anaplasma platys in bone marrow megakaryocytes of young dogs. J Clin Microbiol 2014; 52:2231–2234.
172
Gaunt S, Beall M, Stillman B, Lorentzen L, et al. Experimental infection and co-infection of dogs with Anaplasma platys and Ehrlichia canis: Hematologic, serologic and molecular findings. Parasit Vectors 2010; 3:33. Harvey JW, Simpson CF, Gaskin JM. Cyclic thrombocytopenia induced by a Rickettsia-like agent in dogs. J Infect Dis 1978; 137:182–188. Inokuma H. Vectors and reservoir hosts of Anaplasmataceae. In: Raoult D, Parola P, eds. Rickettsial Disease. New York: Taylor Grancis Group LLC, 2007: 199–212. Lasta CS, Pires A, Messick JB, Oliveira ST, et al. Molecular detection of Ehrlichia canis and Anaplasma platys in dogs in southern Brazil Rev Bras Parasitol Vet 2013; 22:360–366.
DAHMANI ET AL.
Santamaria A, Calzada JE, Saldan˜a A, Yabsley MJ, et al. Molecular diagnosis and species identification of Ehrlichia and Anaplasma infections in dogs from Panama, Central America. Vector Borne Zoonotic Dis. 2014; 14:368–370.
Address correspondence to: Bernard Davoust URMITE Faculte´ de me´decine 27, Bd Jean Moulin 13385 Marseille Cedex 05 France E-mail: [email protected]
