Journal of the Neurological Sciences 336 (2014) 263–264

Contents lists available at ScienceDirect

Journal of the Neurological Sciences journal homepage: www.elsevier.com/locate/jns

Short communication

First adult case of Helicobacter cinaedi meningitis Atsuhiko Sugiyama a, Masahiro Mori a,⁎, Naruhiko Ishiwada b, Keiichi Himuro a, Satoshi Kuwabara a a b

Department of Neurology, Graduate School of Medicine, Chiba University, Chiba, Japan Division of Control and Treatment of Infectious Diseases, Chiba University, Chiba, Japan

a r t i c l e

i n f o

Article history: Received 30 December 2012 Received in revised form 7 October 2013 Accepted 8 October 2013 Available online 16 October 2013 Keywords: Meningitis Helicobacter cinaedi Zoonosis Bacterium Adult Treatment

a b s t r a c t Helicobacter cinaedi, a gram-negative spiral bacillus that inhabits the intestinal tracts of rodents and primates, is associated with gastroenteritis in humans. H. cinaedi infection has been commonly reported in immunocompromised individuals such as human immunodeficiency virus-infected patients, but rarely in immunocompetent individuals. Prior contact with animals has attracted attention as a possible source of H. cinaedi infection. We report a case of meningitis in an immunocompetent 34-year-old woman who had daily contact with a kitten for a month. She developed acute headaches, fevers, and chills. Neurological examination revealed neck stiffness and her cerebrospinal fluid (CSF) exhibited polymorphonuclear pleocytosis and a decreased concentration of glucose. Blood and CSF cultures were negative; however, the pathogen responsible for her condition was identified as H. cinaedi by polymerase chain reaction in CSF. This is the first adult case of meningitis caused by H. cinaedi. Thus, this bacillus should be considered a possible causative agent of bacterial meningitis in healthy adults. © 2013 Published by Elsevier B.V.

1. Introduction Helicobacter cinaedi, a gram-negative spiral bacillus, inhabits the intestinal tracts of animals and humans. In humans, it was first isolated from rectal swabs collected from symptomatic homosexual men with proctocolitis and colitis [1]. Cases of bacteremia, gastroenteritis, and cellulitis caused by H. cinaedi were reported subsequently [2,3]. According to a multicenter study conducted in Japan, H. cinaedi was detected in 0.22% of blood samples with any positive culture results in all tested blood samples, indicating that this organism is not extremely rare [4]. H. cinaedi typically causes opportunistic infection in immunocompromised patients, but H. cinaedi bacteremia has also been reported in immunocompetent hosts [5]. We report here the case of an immunocompetent adult with meningitis caused by H. cinaedi. H. cinaedi meningitis has been reported previously only in a newborn case [6]. Hence, the present report is the first immunocompetent adult case of H. cinaedi meningitis. 2. Case report A 34-year-old woman with Marfan syndrome and controlled schizophrenia was admitted to the neurology department of our hospital after a 1-day course of high fever, chills, and headache. She had undergone David aortic valve-sparing operation and mitral valve repair 4months previously and, had been doing well after the operation. ⁎ Corresponding author at: Department of Neurology, Graduate School of Medicine, Chiba University, 1-8-1, Inohana, Chuo-ku, Chiba 260-8670, Japan. Tel.: +81 43 226 2129; fax: +81 43 226 2160. E-mail address: [email protected] (M. Mori). 0022-510X/$ – see front matter © 2013 Published by Elsevier B.V. http://dx.doi.org/10.1016/j.jns.2013.10.017

On admission, she had a body temperature of 38.9 °C, a pulse rate of 92 beats/min, a blood pressure of 130/57 mm Hg, and a respiration rate of 20/min. Physical examination revealed a pansystolic precordial murmur, but no sign of splinter hemorrhages, skin nodules, or enlarged lymph nodes. Neurological examination revealed neck stiffness and bilateral gaze-evoked nystagmus. No other focal neurological signs were noted. Routine laboratory tests showed an elevated leukocyte count of 11.7 × 103/mm3 (upper normal limit, 9.0 × 103/mm3) with 88.5% neutrophils, a platelet count of 157 × 103/mm3 (upper normal limit, 350 × 103/mm3), and a C-reactive protein level of 8.7 mg/dl (normal range, b 0.3 mg/dl). Serological tests for syphilis and human immunodeficiency virus (HIV), and blood cultures were negative. Brain computed tomography showed no abnormal findings. Transesophageal echocardiography disclosed no vegetation on the valves. Her cerebrospinal fluid (CSF) had a turbid color, a slightly high opening pressure (190 mmH2O), and an increased leukocyte count (789/mm3: neutrophils, 94%; lymphocytes, 6%). The concentration of glucose in CSF was 37 mg/dl (blood glucose, 108 mg/dl), and the protein level was 93 mg/dl. Gram staining revealed the presence of gram-negative spiral rods in a CSF smear; however, both blood and CSF cultures were negative. CSF culture was done on trypticase soy agar containing 5% sheep blood (Japan Becton Dickinson and Company, Tokyo, Japan); plates were incubated for 7 days at 37 °C in a moist, microaerobic atmosphere (5.5 to 12% oxygen, 6.7 to 14.2% carbon dioxide, 0% hydrogen) created by anaerobe pouches (Mitsubishi Gas Chemical company, Tokyo, Japan). Polymerase chain reaction (PCR) was performed on CSF (not performed on blood) as described previously [7] using the AGGG ATTCCACAAAGTGAGC and TCTTGTCCTGTGCGTTCATC primer sequences to amplify the gyrB gene region. The PCR experiment definitively identified the gyrB gene region from H. cinaedi in the CSF sample of the

264

A. Sugiyama et al. / Journal of the Neurological Sciences 336 (2014) 263–264

patient. At this point, we obtained information about the patient's pet because H. cinaedi is a pathogen typically associated with animals. She had been living with a kitten for 1 month before the onset of symptoms. Her husband had made rice balls with his hands just after touching the cat, without washing them. Although she mentioned daily close contact with the kitten and experiences of being scratched, there was no history of infected scratches, pustules or abscesses. Before the identification of H. cinaedi, treatment with vancomycin and ceftriaxone was started for the management of bacterial meningitis. Her symptoms of meningitis improved gradually, but after 8 days of treatment, a rise in her serum creatinine (to 1.75 mg/dl; baseline, 0.70 mg/dl). Vancomycin was discontinued subsequently and changed to meropenem. Follow-up CSF performed on day 18 after the onset of symptoms showed improvement (leukocyte count, 3/mm3). The patient was afebrile on the 22th day from the onset of symptoms. She had no recurrence of her symptoms. 3. Discussion H. cinaedi bacteremia occurs primarily in immunocompromised hosts, particular in HIV-infected men. Less commonly, bacteremia, arthritis and cellulitis have been described in immunocompetent patients. Prior contact with animals has been reported in H. cinaediinfected immunocompetent patients [2,8], suggesting that contact with carrier animals may be a source of acquisition of this pathogen. Our patient started living with a cat 1 month before the onset of symptoms and had close contact with the pet. We assumed that the pet served as a reservoir for the transmission of this microorganism to the patient. H. cinaedi is a fastidious and slow-growing organism, which are characteristics that hamper microbiological diagnosis. It usually takes 5 to 7 days to detect the organism in blood culture bottles and up to ten days in some cases. The bacillus is unlikely to grow in a carbon dioxide environment which is employed for the growth of common bacterial strains. Growth is enhanced by the presence of hydrogen gas in a microaerobic atmosphere and incubation on rich, non-selective media (blood or chocolate agar) at 37 °C [2,9]. More recently the diagnosis is mainly established via gene amplification techniques such as PCR and subsequent sequencing. In our case, gram staining of a CSF sample revealed the presence of spiral-shaped gramnegative rods that we could not grow upon subculture. Using PCR, we definitively demonstrated the presence of the gyrB gene region, which is specific to H. cinaedi, in CSF samples of the patient [9]. Therefore, we identified the pathogen causing meningitis in this case as H. cinaedi. PCR was not performed on blood, so we couldn't definitely clarify whether bacteremia existed or not. No guidelines have been established regarding the choice or duration of antibiotics against H. cinaedi. In vitro studies show that some human strains of H. cinaedi are resistant to clindamycin, erythromycin and ciprofloxacin [10]. Penicillin, tetracyclines, aminoglycosides, ciprofloxacin, rifampicin, and ceftazidime have been used to treat infection with this pathogen, and their effectiveness has been reported [2,5,8,11]. A review of 23 cases of H. cinaedi-associated bacteremia reported that penicillins, tetracyclines, and aminoglycosides are more effective than cephalosporins, erythro-

mycin, or ciprofloxacin [2]. The presence of erythromycin-resistant strains [12] and repeated exacerbations after quinolone administration have also been reported [13]. In our case, a course of 1 week combined antibiotherapy with ceftriaxone and vancomycin, followed by 2 weeks of meropenem, eliminated the symptoms of H. cinaedi meningitis completely. We reported here an immunocompetent adult case of meningitis caused by H. cinaedi. Physicians should consider H. cinaedi as a possible pathogen in adults who present septic meningitis and CSF specimens don't show growth under normal laboratory conditions. Conflict of interest None of the authors have anything to disclose and authors declare no conflicts of interest. Acknowledgments The authors wish to thank Associate Professor Kiyofumi Ohkusu (Department of Microbiology Regeneration and Advanced Medical Science, Graduate School of Medicine, Gifu University) for performing the PCR experiment that identified H. cinaedi. We also wish to thank Mr. Masaharu Watanabe, Ms. Akiko Miyabe and Ms. Tomoko Saito (Department of Microbiology, Chiba University Hospital) for expert technical assistance. References [1] Quinn TC, Goodell SE, Fennell C, Wang SP, Schuffler MU, Holmes KK, et al. Infections with Campylobacter jejuni and Campylobacter-like organisms in homosexual men. Ann Intern Med 1984;101:187–92. [2] Kiehlbauch JA, Tauxe RV, Baker CN, Wachsumth IK. Helicobacter cinaedi-associated bacteremia and cellulitis in immunocompromised patients. Ann Intern Med 1994;121:90–3. [3] Kitamura T, Kawamura Y, Ohkusu K, Masaki T, Iwashita H, Sawa T, et al. Helicobacter cinaedi cellulitis and bacteremia in immunocompetent hosts after orthopaedic surgery. J Clin Microbiol 2007;45:31–8. [4] Matsumoto T, Goto M, Murakami H, Tanaka T, Nishiyama H, Ono E, et al. Multicenter study to evaluate bloodstream infection by Helicobacter cinaedi in Japan. J Clin Microbiol 2007;45:2853–7. [5] Holst H, Andresen K, Blom J, Hojlyng N, Kemp M, Krogelt KA, et al. A case of Helicobacter cinaedi bacteraemia in a previously healthy person with cellulitis. Open Microbiol J 2008;2:29–31. [6] Orlicek SL, Welch DF, Kuhls TL. Septicemia and meningitis caused by Helicobacter cinaedi in a neonate. J Clin Microbiol 1993;31:569–71. [7] Ohkusu K, Ezaki T. Helicobacter cinaedi infection. Kansen Ensho Meneki 2007;37:336–9. [8] Lasry S, Simon J, Marais A, Pouchot J, Vinceneux P, Boussougant Y, et al. Helicobacter cinaedi septic arthritis and bacteremia in an immunocompetent patient. Clin Infect Dis 2000;31:201–2. [9] Minauchi K, Takahashi S, Sakai T. The nosocomial transmission of Helicobacter cinaedi infections in immunocompromised patients. Intern Med 2010;49:1733–9. [10] Kiehlbauch JA, Brenner DJ, Cameron DN. Genotypic and phenotypic characterization of Helicobacter cinaedi and Helicobacter fennelliae strains isolated from humans and animals. J Clin Microbiol 1995;33:2940–7. [11] Van Genderen PJ, Goessens WH, Petit PL. Helicobacter cinaedi-associated bacteremia and erysipelas in an immunocompetent host: a diagnostic challenge. Scand J Infect Dis 2005;37:382–5. [12] Kuijper EJ, Stevens S, Imamura T, De Wever B, Claas EC. Genotypic identification of erythromycin-resistant Campylobacter isolates as Helicobacter species and analysis of resistance mechanism. J Clin Microbiol 2003;41:3732–6. [13] Murakami H, Goto M, Ono E, Sawabe E, Iwata M, Okuzumi K, et al. Isolation of Helicobacter cinaedi from blood of an immunocompromised patient in Japan. J Infect Chemother 2003;9:344–7.