CID 1992; 15 (October)
Correspondence
753
thermia necessitated more blood cultures. E. faecium was recovered from four blood cultures. The isolates were highly resistant to streptomycin but not to gentamicin, moderately resistant to penicillin (MIC, 16 ~g/mL) and sensitive to ampicillin (MIC, 2 ~g/mL). Broth microdilution and macrodilution MIC and MBC testing revealed that the MIC of vancomycin was 64 ~g/mL (MBC, >128 ~g/mL) and the MIC ofteicoplanin was 0.25 ~gl mL (MBC, 32 ~g/mL). Several stool cultures during her 1month hospitalization yielded E. faecium with the same Van B phenotype. Therapy with vancomycin was discontinued on day 19, and that with ampicillin and gentamicin was begun. All further blood cultures were negative, and her temperature rapidly returned to normal. Stool cultures done 1 and 2 months after discharge from the hospital yielded the same isolate, although the patient had no clinical infection due to E. faecium. Glycopeptide resistance was considered extremely rare until 1988, when Uttley et al. [4] described an outbreak of infection due to vancomycin-resistant enterococci in a London hospital. Since that time, additional reports on the emergence of vancomycin-resistant enterococci have appeared in the literature. Low incidences of serious infections caused by enterococci of Van B phenotype have been reported [5-7], but the failure of the diskagar diffusion test to detect this low-level resistance could explain this rare occurrence. We describe a case of colonization and subsequent bacteremia with a Van B strain occurring in a patient suffering from debilitating underlying disease. Digestive colonization by this strain obviously persisted over a longer period of time in the absence of selective antimicrobial pressure. This observation suggests that this strain can be a part of the normal flora of the digestive tract of this patient. The biochemical mechanism of vancomycin resistance is not yet understood. Leclercq et al. [8] showed that the vancomycin resistance of their Van A strains could be induced by subinhibitory concentrations of the drug. In the present report, the patient had received vancomycin for 17 days prior to detection of
the first positive blood culture. Vancomycin prophylaxis with subinhibitory concentrations appears to have provided the selective pressure for producing an organism resistant to the drug and to have led to colonization and infection with this organism. Emergence of vancomycin resistance during the course of vancomycin prophylaxis is troublesome, and the clinical and therapeutic consequences have still to be established.
Fatal Intrauterine Infection Associated with Mycoplasma hominis
strong evidence that M. hominis is linked to maternal fever postabortion and postpartum [4, 5] and is associated with chorioamnionitis, spontaneous abortion, and stillbirth [4-9]. However, it has been clearly established that healthy pregnant women delivering healthy infants are frequently asymptomatically colonized with M. hominis [1]. Accordingly, we present a case of stillbirth following intrauterine infection in which M. hominis was detected in the internal organs of the fetus by culture and by the recently developed polymerase chain reaction (PCR) [10]. A 37-year-old gravida 2 para 1 woman was admitted at 24 weeks gestation because of imminent premature labor. The pregnancy was uneventful and the patient had no history of illness. Findings of physical examination on admission were remarkable for the absence of fever or other signs of systemic infection. No uterine tenderness was detected. Amniotic membranes were intact although they were bulging through the cervical os, which was dilated to 4 cm. The peripheral white blood cell count (WBC) was 17.1 X 109IL. Ultrasonography of the fetus and uterus revealed no abnormalities. For preventing immature partus, a cerclage of the cervix was put in place. Vaginal cultures at this time yielded Gardnerella vaginalis. Two days
Correspondence: Dr. Jacques F. Meis. Department of Medical Microbiology. University Hospital Nijmegen. 6500 HB Nijmegen. The Netherlands.
Clinical Infectious Diseases 1992;15:753-4 © 1992 by The University of Chicago. All rights reserved. 1058-4838/92/1504-0048$02.00
Laboratoire de Bacteri%gie- Vir%gie. Hopita/ Pontchai//ou, Rennes. and Laboratoire de Bacteriologie- Virologie, Hopital Henri Mondor, Paris, France
References I. Johnson AP. Uttley AHC, Woodford N, George RC. Resistance to van-
2. 3.
4. 5.
6.
7.
8.
comycin and teicoplanin: an emerging clinical problem. Clin Microbioi Rev 1990;3:280-91. Shlaes OM. AI-Obeid S, Gutmann L. Vancomycin-resistant enterococci. APUA Newsletter 1989;7:1-8. Williamson R. AI-Obeid S. ShlaesJH. Goldstein FW. Shlaes OM. Inducible resistance to vancomycin in Enterococcus faecium 0366. J Infect Dis 1989; 159: 1095-104. UttIey AHC, Collins CH, Naidoo J, George RC. Vancomycin resistant enterococci [letter]. Lancet 1988;1:57-8. Kaplan AH. Gilligan PH, Facklam RR. Recovery of resistant enterococci during vancomycin prophylaxis. J Clin Microbiol 1987; 26: 1216-8. Sahm OF. Kissinger J. Gilmore MS, et al. In vitro susceptibility studies of vancomycin-resistant Enterococcus faeca/is. Antimicrob Agents Chemother 1989;33: 1588-91. Handwerger S. Perlman DC, Altarac 0, McAuliffe V. Concomitant highlevel vancomycin and penicillin resistance in clinical isolates of enterococci. C1in Infect Dis 1992; 14:655-61. Leclercq R, Derlot E, Weber M. Duval J, Courvalin P. Transferable vancomycin and teicoplanin resistance in Enterococcus faecium. Antimicrob Agents Chemother 1989;33: 10-5.
Downloaded from http://cid.oxfordjournals.org/ at University of Bath Library & Learning Centre on June 22, 2015
SIR-Mycoplasma hominis and Ureaplasma urealyticum are generally considered commensals of the urogenital tract. The potential pathogenic role of these genital mycoplasmas in nongonococcal urethritis, pelvic inflammatory disease, and infertility has been reviewed previously [1]. Extragenital infections include septic arthritis, wound infection, prosthetic valve endocarditis, peritonitis, brain abscess, septicemia, ventriculoperitoneal shunt infection, neonatal encephalitis, and meningitis [2, 3]. The latter three infections are most likely the result of intrauterine infection or colonization during passage through the birth canal, with subsequent development of infection [4]. There is
Pascal Pouedras, Roland Leclercq, Pierre-Yves Donnio, Jean-Marie Sire, Renaud Mesnard, and Jean-Loup Avril
754
Correspondence
MYCOPLASMA HOMINIS
UREAPLASMA UREALYTICUM
following admission, she experienced painful uterine contractions. Her body temperature was elevated to 38.2°C and the WBC count was 19.6 X 109fL. Ultrasonography revealed the absence of amniotic fluid and fetal cardiac activity. Upon removal of the cerclage, the patient rapidly delivered a stillborn female infant (weight, 580 g) without macroscopic malformations. The postpartum course was remarkable only for I day of fever, and the patient was subsequently discharged in good condition on the fifth day. A culture ofcervical specimens obtained 10 days later yielded U. urealyticum. Histologic examination of the placenta revealed chorioamnionitis. Cultures of postmortem surface swabs from the fetal ears, nose, and umbilicus yielded G. vaginalis. Cultures ofaseptically removed lung, spleen, and liver specimens yielded a pure growth ofnonhemolytic pinpoint colonies after 4 days ofincubation on blood agar. No organisms were seen in gram-stained smears of the colonies, thereby suggesting mycoplasmas. The isolated strain was identified by the growth-inhibition test as M. hominis [1]. RNA was extracted from lung, spleen, and liver tissues by standard techniques [10]. DNA was amplified with use of the peR after reverse transcription of 16S rRNA sequences using primers specific to M. hominis and U. urealyticum species as described previously [10]. M. hominis was detected in the lungs, spleen, and liver, whereas U. urealyticum was detected only in the lungs (figure 1). In the case presented herein the stillbirth is most likely attrib-
utable to M. hominis infection acquired in utero. The first report describing the isolation of M. hominis from internal organs of aborted fetuses was published 25 years ago [6]. Since then, there have been several case reports describing the isolation of both M. hominis and U. urealyticum from fetal lung tissue [4, 7-9]. Whether the microorganisms invade via intact fetal membranes or following rupture is not always clear, but both routes have been reported for U. urealyticum [4]. In previously published reports of extragenital M. hominis infections, several cases occurred after genitourinary instrumentation [2, 3]. We speculate that the patient in this report may have become infected due to bacteremia induced by the cerclage placement. With the exception of the genitourinary tract, it is widely accepted that isolation of M. hominis, in the absence ofother pathogens, constitutes evidence of infection [2, 3]. As described in this report, cultures of lung, spleen, and liver specimens from aseptically collected fetal tissues yielded abundant growth of M. hominis, indicating invasive systemic disease. The presence of U. urealyticum in both lungs, as detected by PCR, could be the result of the ingestion ofamniotic fluid, representing mere colonization of the cervix. Furthermore, this organism is frequently present together with M. hominis in the vagina and is often associated with nonspecific vaginosis and infection with Chlamydia trachomatis [1]. Indeed, vaginal cultures from the patient also yielded G. vaginalis and U. urealyticum during and after delivery, possibly as copathogens. This case illustrates that invasion of the fetal bloodstream with M. hominis may be a cause of stillbirth. This report, we believe, represents the first instance in which PCR has contributed to the clarification of the pathogenic role of M. hominis in the perinatal period.
Jacques F. Meis, Frank J. van Kuppeveld, Jan A. Kremer, Jan G. Nijhuis, and Willem J. Melchers Departments of Medical Microbiology and Gynecology and Obstetrics. University Hospital. Nijmegen. The Netherlands References I. Taylor-Robinson D, McCormack WM. The genital mycoplasmas. N Engl J Med 1980;302: 1003- 10. 2. Madotf S, Hooper DC. Nongenitourinary infections caused by Mycoplasma hominis in adults. Rev Infect Dis 1988; 10:602-13. 3. McMahon DK. Dummer JS. Pasculle AW. Cassell G. Extragenital Mycoplasma hominis infection in adults. Am J Med 1990;89:275-81. 4. Cassell GH. Waites KB. Crouse DT. Perinatal mycoplasmal infections. C1in Perinatol 1991; 18:241-62. 5. Wallace RJ. Alpert S, Browne K, Lin JS, McCormack WM. Isolation of Mycoplasma hominis from blood cultures in patients with post-partum fever. Obstet Gynecol 1978;51: 181-5. 6. Jones OM. Mycoplasma hominis in abortion. BMJ 1967;1:338-40. 7. Brunell PA. Dische RM. Walker MB. Mycoplasma. amnionitis, and respiratory distress syndrome. JAMA 1969;207:2097-9. 8. Dische MR, Quinn PA, Czegledy-Nagy E. Sturgess JM. Genital mycoplasma infection. Intrauterine infection: pathologic study of the fetus and placenta. Am J C1in PathoI1979;72: 167-74. 9. Christensen KK. Hagerstrand I, Mardh PA. Late spontaneous abortion associated with Mycoplasma hominis infection of the fetus. Scand J Infect Dis 1982;14:73-4. 10. van Kuppeveld FJM. van der Logt JTM. Angulo AF, et al. Genus and species specific identification of mycoplasmas by 16S rRNA amplification. Appl Env Microbiol 1992;58:2606-15.
Downloaded from http://cid.oxfordjournals.org/ at University of Bath Library & Learning Centre on June 22, 2015
Figure 1. Agarose gel electrophoresis of DNA amplified by the polymerase chain reaction (PCR) with Mycoplasma hominis primers (lanes 1-8) or Ureaplasma urealyticum primers (lanes 9-16) with reversed transcribed 16S rRNA isolated from fetal tissues and controls. Lanes 1 and 9: left lung; lanes 2 and 10: right lung; lanes 3 and 11: liver; lanes 4 and 12: spleen; lanes 5 and 13: control lung; lanes 6 and 14: control lung; lanes 7 and 15: water; lane 8: M. hominis DNA; and lane 15: U. urealyticum DNA. (M. hominis: primer I, 5'-TGAAAGGCGGCTGTAAGGCGC, and primer 2, GTCTGCAATCATTTCCTATTGCAAA, producing a PCR product of 281 base pairs. U. urealyticum: primer I, 5'TAAATGTCGGCTCGAACGAG-3', and primer 2, 5'-GCAGTATCGCTAGAAAAGCAAC-3', producing a PCR product of 311 base pairs; the thermal profile involved 40 cycles of denaturation at 94°C for I minute, primer annealing at 55°C for I minute, and extension at 72°C for 2 minutes.) The results of the PCR were confirmed by Southern blot analysis (not shown) with species-specific [,),_32 p]ATP-end-Iabeled oligonucleotides directed against the internal portion of the amplified product. (M. hominis probe: 5'· ACTCCTACGGGAGGCAGCAGTA-3'; u. urealyticum probe: 5'-CTTAAAGGAATTGACGGGAACCCG-3'.)
CIO 1992; 15 (October)
Correspondence
753
thermia necessitated more blood cultures. E. faecium was recovered from four blood cultures. The isolates were highly resistant to streptomycin but not to gentamicin, moderately resistant to penicillin (MIC, 16 ~g/mL) and sensitive to ampicillin (MIC, 2 ~g/mL). Broth microdilution and macrodilution MIC and MBC testing revealed that the MIC of vancomycin was 64 ~g/mL (MBC, >128 ~g/mL) and the MIC ofteicoplanin was 0.25 ~gl mL (MBC, 32 ~g/mL). Several stool cultures during her 1month hospitalization yielded E. faecium with the same Van B phenotype. Therapy with vancomycin was discontinued on day 19, and that with ampicillin and gentamicin was begun. All further blood cultures were negative, and her temperature rapidly returned to normal. Stool cultures done 1 and 2 months after discharge from the hospital yielded the same isolate, although the patient had no clinical infection due to E. faecium. Glycopeptide resistance was considered extremely rare until 1988, when Uttley et al. [4] described an outbreak of infection due to vancomycin-resistant enterococci in a London hospital. Since that time, additional reports on the emergence of vancomycin-resistant enterococci have appeared in the literature. Low incidences of serious infections caused by enterococci of Van B phenotype have been reported [5-7], but the failure of the diskagar diffusion test to detect this low-level resistance could explain this rare occurrence. We describe a case of colonization and subsequent bacteremia with a Van B strain occurring in a patient suffering from debilitating underlying disease. Digestive colonization by this strain obviously persisted over a longer period of time in the absence of selective antimicrobial pressure. This observation suggests that this strain can be a part of the normal flora of the digestive tract of this patient. The biochemical mechanism of vancomycin resistance is not yet understood. Leclercq et al. [8] showed that the vancomycin resistance of their Van A strains could be induced by subinhibitory concentrations of the drug. In the present report, the patient had received vancomycin for 17 days prior to detection of
the first positive blood culture. Vancomycin prophylaxis with subinhibitory concentrations appears to have provided the selective pressure for producing an organism resistant to the drug and to have led to colonization and infection with this organism. Emergence of vancomycin resistance during the course of vancomycin prophylaxis is troublesome, and the clinical and therapeutic consequences have still to be established.
Fatal Intrauterine Infection Associated with Mycoplasma hominis
strong evidence that M. hominis is linked to maternal fever postabortion and postpartum [4, 5] and is associated with chorioamnionitis, spontaneous abortion, and stillbirth [4-9]. However, it has been clearly established that healthy pregnant women delivering healthy infants are frequently asymptomatically colonized with M. hominis [1]. Accordingly, we present a case of stillbirth following intrauterine infection in which M. hominis was detected in the internal organs of the fetus by culture and by the recently developed polymerase chain reaction (PCR) [10]. A 37-year-old gravida 2 para 1 woman was admitted at 24 weeks gestation because of imminent premature labor. The pregnancy was uneventful and the patient had no history of illness. Findings of physical examination on admission were remarkable for the absence of fever or other signs of systemic infection. No uterine tenderness was detected. Amniotic membranes were intact although they were bulging through the cervical os, which was dilated to 4 cm. The peripheral white blood cell count (WBC) was 17.1 X 109IL. Ultrasonography of the fetus and uterus revealed no abnormalities. For preventing immature partus, a cerclage of the cervix was put in place. Vaginal cultures at this time yielded Gardnerella vaginalis. Two days
Correspondence: Dr. Jacques F. Meis. Department of Medical Microbiology. University Hospital Nijmegen. 6500 HB Nijmegen. The Netherlands.
Clinical Infectious Diseases 1992;15:753-4 © 1992 by The University of Chicago. All rights reserved. 1058-4838/92/1504-0048$02.00
Laboratoire de Bacteri%gie- Vir%gie. Hopita/ Pontchai//ou, Rennes. and Laboratoire de Bacteriologie- Virologie, Hopital Henri Mondor, Paris, France
References I. Johnson AP. Uttley AHC, Woodford N, George RC. Resistance to van-
2. 3.
4. 5.
6.
7.
8.
comycin and teicoplanin: an emerging clinical problem. Clin Microbioi Rev 1990;3:280-91. Shlaes OM. AI-Obeid S, Gutmann L. Vancomycin-resistant enterococci. APUA Newsletter 1989;7:1-8. Williamson R. AI-Obeid S. ShlaesJH. Goldstein FW. Shlaes OM. Inducible resistance to vancomycin in Enterococcus faecium 0366. J Infect Dis 1989; 159: 1095-104. UttIey AHC, Collins CH, Naidoo J, George RC. Vancomycin resistant enterococci [letter]. Lancet 1988;1:57-8. Kaplan AH. Gilligan PH, Facklam RR. Recovery of resistant enterococci during vancomycin prophylaxis. J Clin Microbiol 1987; 26: 1216-8. Sahm OF. Kissinger J. Gilmore MS, et al. In vitro susceptibility studies of vancomycin-resistant Enterococcus faeca/is. Antimicrob Agents Chemother 1989;33: 1588-91. Handwerger S. Perlman DC, Altarac 0, McAuliffe V. Concomitant highlevel vancomycin and penicillin resistance in clinical isolates of enterococci. C1in Infect Dis 1992; 14:655-61. Leclercq R, Derlot E, Weber M. Duval J, Courvalin P. Transferable vancomycin and teicoplanin resistance in Enterococcus faecium. Antimicrob Agents Chemother 1989;33: 10-5.
Downloaded from http://cid.oxfordjournals.org/ at University of Bath Library & Learning Centre on June 22, 2015
SIR-Mycoplasma hominis and Ureaplasma urealyticum are generally considered commensals of the urogenital tract. The potential pathogenic role of these genital mycoplasmas in nongonococcal urethritis, pelvic inflammatory disease, and infertility has been reviewed previously [1]. Extragenital infections include septic arthritis, wound infection, prosthetic valve endocarditis, peritonitis, brain abscess, septicemia, ventriculoperitoneal shunt infection, neonatal encephalitis, and meningitis [2, 3]. The latter three infections are most likely the result of intrauterine infection or colonization during passage through the birth canal, with subsequent development of infection [4]. There is
Pascal Pouedras, Roland Leclercq, Pierre-Yves Donnio, Jean-Marie Sire, Renaud Mesnard, and Jean-Loup Avril
754
Correspondence
MYCOPLASMA HOMINIS
UREAPLASMA UREALYTICUM
following admission, she experienced painful uterine contractions. Her body temperature was elevated to 38.2°C and the WBC count was 19.6 X 109fL. Ultrasonography revealed the absence of amniotic fluid and fetal cardiac activity. Upon removal of the cerclage, the patient rapidly delivered a stillborn female infant (weight, 580 g) without macroscopic malformations. The postpartum course was remarkable only for I day of fever, and the patient was subsequently discharged in good condition on the fifth day. A culture ofcervical specimens obtained 10 days later yielded U. urealyticum. Histologic examination of the placenta revealed chorioamnionitis. Cultures of postmortem surface swabs from the fetal ears, nose, and umbilicus yielded G. vaginalis. Cultures ofaseptically removed lung, spleen, and liver specimens yielded a pure growth ofnonhemolytic pinpoint colonies after 4 days ofincubation on blood agar. No organisms were seen in gram-stained smears of the colonies, thereby suggesting mycoplasmas. The isolated strain was identified by the growth-inhibition test as M. hominis [1]. RNA was extracted from lung, spleen, and liver tissues by standard techniques [10]. DNA was amplified with use of the peR after reverse transcription of 16S rRNA sequences using primers specific to M. hominis and U. urealyticum species as described previously [10]. M. hominis was detected in the lungs, spleen, and liver, whereas U. urealyticum was detected only in the lungs (figure 1). In the case presented herein the stillbirth is most likely attrib-
utable to M. hominis infection acquired in utero. The first report describing the isolation of M. hominis from internal organs of aborted fetuses was published 25 years ago [6]. Since then, there have been several case reports describing the isolation of both M. hominis and U. urealyticum from fetal lung tissue [4, 7-9]. Whether the microorganisms invade via intact fetal membranes or following rupture is not always clear, but both routes have been reported for U. urealyticum [4]. In previously published reports of extragenital M. hominis infections, several cases occurred after genitourinary instrumentation [2, 3]. We speculate that the patient in this report may have become infected due to bacteremia induced by the cerclage placement. With the exception of the genitourinary tract, it is widely accepted that isolation of M. hominis, in the absence ofother pathogens, constitutes evidence of infection [2, 3]. As described in this report, cultures of lung, spleen, and liver specimens from aseptically collected fetal tissues yielded abundant growth of M. hominis, indicating invasive systemic disease. The presence of U. urealyticum in both lungs, as detected by PCR, could be the result of the ingestion ofamniotic fluid, representing mere colonization of the cervix. Furthermore, this organism is frequently present together with M. hominis in the vagina and is often associated with nonspecific vaginosis and infection with Chlamydia trachomatis [1]. Indeed, vaginal cultures from the patient also yielded G. vaginalis and U. urealyticum during and after delivery, possibly as copathogens. This case illustrates that invasion of the fetal bloodstream with M. hominis may be a cause of stillbirth. This report, we believe, represents the first instance in which PCR has contributed to the clarification of the pathogenic role of M. hominis in the perinatal period.
Jacques F. Meis, Frank J. van Kuppeveld, Jan A. Kremer, Jan G. Nijhuis, and Willem J. Melchers Departments of Medical Microbiology and Gynecology and Obstetrics. University Hospital. Nijmegen. The Netherlands References I. Taylor-Robinson D, McCormack WM. The genital mycoplasmas. N Engl J Med 1980;302: 1003- 10. 2. Madotf S, Hooper DC. Nongenitourinary infections caused by Mycoplasma hominis in adults. Rev Infect Dis 1988; 10:602-13. 3. McMahon DK. Dummer JS. Pasculle AW. Cassell G. Extragenital Mycoplasma hominis infection in adults. Am J Med 1990;89:275-81. 4. Cassell GH. Waites KB. Crouse DT. Perinatal mycoplasmal infections. C1in Perinatol 1991; 18:241-62. 5. Wallace RJ. Alpert S, Browne K, Lin JS, McCormack WM. Isolation of Mycoplasma hominis from blood cultures in patients with post-partum fever. Obstet Gynecol 1978;51: 181-5. 6. Jones OM. Mycoplasma hominis in abortion. BMJ 1967;1:338-40. 7. Brunell PA. Dische RM. Walker MB. Mycoplasma. amnionitis, and respiratory distress syndrome. JAMA 1969;207:2097-9. 8. Dische MR, Quinn PA, Czegledy-Nagy E. Sturgess JM. Genital mycoplasma infection. Intrauterine infection: pathologic study of the fetus and placenta. Am J C1in PathoI1979;72: 167-74. 9. Christensen KK. Hagerstrand I, Mardh PA. Late spontaneous abortion associated with Mycoplasma hominis infection of the fetus. Scand J Infect Dis 1982;14:73-4. 10. van Kuppeveld FJM. van der Logt JTM. Angulo AF, et al. Genus and species specific identification of mycoplasmas by 16S rRNA amplification. Appl Env Microbiol 1992;58:2606-15.
Downloaded from http://cid.oxfordjournals.org/ at University of Bath Library & Learning Centre on June 22, 2015
Figure 1. Agarose gel electrophoresis of DNA amplified by the polymerase chain reaction (PCR) with Mycoplasma hominis primers (lanes 1-8) or Ureaplasma urealyticum primers (lanes 9-16) with reversed transcribed 16S rRNA isolated from fetal tissues and controls. Lanes 1 and 9: left lung; lanes 2 and 10: right lung; lanes 3 and 11: liver; lanes 4 and 12: spleen; lanes 5 and 13: control lung; lanes 6 and 14: control lung; lanes 7 and 15: water; lane 8: M. hominis DNA; and lane 15: U. urealyticum DNA. (M. hominis: primer I, 5'-TGAAAGGCGGCTGTAAGGCGC, and primer 2, GTCTGCAATCATTTCCTATTGCAAA, producing a PCR product of 281 base pairs. U. urealyticum: primer I, 5'TAAATGTCGGCTCGAACGAG-3', and primer 2, 5'-GCAGTATCGCTAGAAAAGCAAC-3', producing a PCR product of 311 base pairs; the thermal profile involved 40 cycles of denaturation at 94°C for I minute, primer annealing at 55°C for I minute, and extension at 72°C for 2 minutes.) The results of the PCR were confirmed by Southern blot analysis (not shown) with species-specific [,),_32 p]ATP-end-Iabeled oligonucleotides directed against the internal portion of the amplified product. (M. hominis probe: 5'· ACTCCTACGGGAGGCAGCAGTA-3'; u. urealyticum probe: 5'-CTTAAAGGAATTGACGGGAACCCG-3'.)
CIO 1992; 15 (October)
