Fat-storing Cells of the Rat Liver Synthesize and Secrete C 1-Esterase Inhibitor; Modulation by Cytokines STEFAN SCHWOGLER, MARGARETEODENTHAL, THOMASKNITTEL,KARL-HERMA” MEYERZUM BUSCHENFELDE AND GIULIANO RAMADOR1 I. Department of Internal Medicine, University of Mainz, 6500 Mainz, Germany

During liver fibrogenesis, fat-storingcells transform Fat-storing cells (FSC) (Ito cells, perisinusoidal cells into myofibroblast-like cells and produce increasing stellate cells, lipocytes and pericytes) belong to the amounts of extracellular matrix proteins. Because nonparenchymal liver cells (1).They are characterized fat-storing cells produce %-macroglobulin, an im- by the presence of large intracytoplasmatic fat vacuoles, portant serine protease inhibitor (serpin),we investi- which are the consequence of their main function, the gated whether fat-storing cells also synthesize C1- storage of vitamin A (2-6). Besides this function of esterase inhibitor, another important serpin. C1esterase inhibitor synthesis was studied in rat fat- “resting” FSC, McGee and Patrick (7) proposed in 1972 storing cells at day 0, 3 and 7 after isolation by that FSC are involved in the genesis of hepatic fibrosis. biosynthetic labeling, immunoprecipitation and This idea was supported by a number of in uiuo studies sodium dodecyl sulfate-polyacrylamide gel electro- of the last decade demonstrating that FSC divide and phoresis. Messenger RNA was examined by cause the bulk of excess matrix growth in chronic liver Northern-blot analysis. C 1-esteraseinhibitor gene ex- disease. In fact, collagen and fibronectin could be pression and synthesis were detectable in freshly detected in FSC by immunohistochemical staining isolated fat-storing cells and increased distinctly (8-10).Because it is possible to isolate and cultivate FSC during the time in culture. The cellular source of (111, they could be shown to synthesize other extracelC1-esterase inhibitor in fat-storing cell cultures was lular matrix proteins such as laminin, glycosamialso identified by in situ hybridization of cells at different times after isolation. By inhibition of the noglycans, entactin and tenascin (for review see refN-glycosylation using tunicamycin, rat C1-esterase erence 12). FSC cultured on plastic surfaces start to inhibitor was identified as a glycoprotein. The time divide (13), resembling “activated” cells during liver course of C1-esterase inhibitor secretion was deter- fibrosis. “Activated” FSC express the smooth-musclemined by pulse-chase experiments. C1-esterase in- a-actin gene (14) and produce increasing amounts of hibitor synthesis was increased &fold to 10-fold by proteins (14-16). interferon-y. Specific messenger RNA levels were also Although the contribution of FSC in matrix generraised distinctly by this cytokine. In contrast, ation is undisputed, it was not known until now whether interferon-or and dexamethasone did not alter C1- FSC also influence matrix degradation (17). In general, esterinhibitor gene expression. Because C1- the importance of matrix degradation in liver fibrosis esterase inhibitor synthesis is increased by advancing culture time and by the inflammatory mediator and the origin and substrate specificity of the particiinterferon-y, we suggest that fat-storing cells may pating enzymes have been poorly understood (18). Recently, the release of a neutral metalloproteinase by enhance the deposition of extracellular matrix proFSC was detected (17), which could be identified as type teins by inhibiting their degradation. (HEPATOLOGY IV collagenase-gelatinase with a molecular weight of 72 1992;16:794-802.)

Received January 21, 1992; accepted May 5, 1992. This work waa supported by the Deutsche Fomhungsgemeinschaft (Grants SFB 311 A7 and Ra 362/5-2). Giuliano Ramadon holds a Hermann and LiUy Schilling professorship. Parts of the results of this paper have been presented at the 26th meeting of the European Association for the Study of the Liver, Palma de Mallorca, Spain, September 1991, and at the 28th meeting of the Deutsche Gesellschaft fiir Verdauungs- und Sbffwechsel-krankheiten,Mannheim, Germany, September 1991. Address reprint requests to: G. Ramadori, I. Department of Internal Medicine, University of Mainz, Langenbeckatrape 1, 6500 Mainz, Germany.

31/1/39366

kD (19). FSC also produce a,-macroglobulin (16), a multispecific protease inhibitor, which is one of the most important antagonists of metalloproteinases next to the tissue inhibitor of metalloproteinases (18). Another important serum protease inhibitor (serpin) with a wide sphere of activity is C1-esterase inhibitor (Cl-I), a single-chain protein with a large proportion of glycosyl residues (20). Originally, C1-I was identified as an inhibitor of C1 (21), but it also inactivates other plasma components like kallikrein (221, plasmin (23) and the coagulation factors XIa and XIIa (24). The homologous a,-protease inhibitor has been shown to participate in a great number of intracellular and

794

Vol. 16,No. 3, 1992

a

C1 INHIBITOR GENE EXPRESSION IN RAT LIVER FAT-STORING CELLS

b

795

C

FIG.1. FSC in culture. (a) day 1, (b) day 3 and ( c ) day 7 after isolation. Phase-contrast microscope, (a) original magnification x 400, (b) and (c) original magmfxation x 200.

extracellular regulations (25), indicating that C1-I might have multiple functions also. The synthesis of C1-I could be detected in human monocytes, monocyte-like cells (26-28) and human skin fibroblasts (29), but the primary site of production is supposed to be the hepatocyte (30). In this report we demonstrate that FSC of rat liver are able to synthesize and secrete C1-I and that the rate of synthesis is up-regulated by interferon (1FN)-y.

zerland): guanidinium isothiocyanate; Gibco (Karlsruhe, Germany): DMEM without methionine; Holland Biotechnologies (Leiden, Netherlands): recombinant rat IFN-y; Hofmann La Roche (Basel, Switzerland):human recombinant IFN-a; Merck (Darmstadt, Germany): pronase, SDS, Titriplex (EDTA) and formaldehyde; Nyegaard (Oslo, Norway): Nycodenz; Pharmacia (Freiburg, Germany): Ficoll; Riedel de Haen (Seelze, Germany): Tris; Roth KG (Karlsruhe, Germany): glycine; Serva (Munich, Germany): acrylamide and bisacrylamide; Seromed (Berlin, Germany): PBS; Sigma Chemical Co. (Munich, Germany): collagenase, sodium acetate, diethylpyrocarbonate, citric acid, lauroyl sulphate, polyvinylpyrrolidone, MATERIALS AND METHODS MOPS, formamide and ethidium bromide. The monoclonal Animals. Female rats (9 to 12 mo old, retired breeders) of antibodies ED1 and ED2 were kindly provided by Dr. Dijkstra the Wistar breed with a body weight of 200 to 300 gm were (Department of Histology, University of Amsterdam, Ampurchased from Charles River Breeding Laboratories sterdam, Netherlands) (31). (Sulzfeld, Germany) and kept under standard conditions Isolation ofFSC. FSC were isolated accordingto the method with free access to food (Altromin, Lage, Germany) and water. of Knook, Seffelaar and De Leeuw (11)as described in detail In conducting the investigations described below we adhered to elsewhere (32) with minor modifications. After perfusing the the effective guidelines for care and use of laboratory animals. liver by way of the portal vein with GBSS, enzymatic dgestion Reagents and Anthem. The required substances were was performed by in situ perfusion with a pronase solution in obtained from the following sources: Amersham Buchler GBSS (0.2%) and subsequently with a pronase/collagenase GmbH (Braunschweig, Germany): 35S-methionine (specific solution (0.08%in each case). The resulting liver cell paste was activity = 800 Ci/mmol), 32P-deoxycytidinetriphosphate (spe- suspended in a third enzyme solution containing 0.04% cific activity = 700 Ci/mol), 14C-labeled protein standards, pronase, 0.06% collagenase and 0.0025% DNAse and stirred Amplify, and Nylon Hybond blotting membranes; Biochrom under permanent control at pH 7.4 and 37" C. Nonparen(Berlin, Germany): penicillin and streptomycin; Biorad chymal liver cells were separated on a single-step Nycodenz (Munich, Germany): ammonium persulfate and TEMED; gradient (8.2% Nycodenz wt/vol) for 20 min at 1,500 g and Boehringer Mannheim (Mannheim, Germany): FCS and 20" C. A total of 85% of the cells in the upper layer could be DNAse; Bethesda Research Laboratories (BRL, Heidelberg, identified as FSC through the presence of fat vacuoles, Germany): agarose, cesium chloride and nick translation kit; stainable with fat red and exhibiting autofluorescence of Calbiochem GmbH (Frankfurt, Germany): Staphylococcus vitamin A (61, and by immunocytochemistry as stated earlier aureus cells (Pansorbin) and anti-C1-esterase-inhibitor; Da- (14). By trypan blue exclusion a viability of more than 95% kopatts (Copenhagen, Denmark): desmin antibody, vimentin could be determined. Contaminating cells were mainly endoantibody, and vW-factor-VIII antibody; Flow Laboratories thelial cells, but some Kupffer cells ( < 1%)were also detected (Bonn, Germany): Dulbecco's modified eagle medium (DMEM) by immunostainings with monoclonals against the macroand Gey's balanced salt solution (GBSS); Fluka (Bern, Swit- phage antigens ED1 and ED2.

796

SCHWOGLER ET AL.

1

2

1'

2'

FIG. 2. FSC (day 7 after isolation) synthesize C1-I; specificity experiment. Cells were labeled for 4 hr with 35S-methionine in methionine-free DMEM. C1-I was immunoprecipitated from cell lysates (1,l') and pulse media (2,Z') with normal (1,Z) or with antigen-blocked (1',Z')antiserum and analyzed by SDS-PAGE (7.5% acrylamide concentration). Culture Conditions. FSC (2.5 x lo5 cells/well) were plated onto 24-well culture plates (Falcon) in DMEM supplemented with 10% FCS (vol/vol). The culture medium was changed daily. For immunocytochemical investigations cells were plated onto 8-well Lab-tek tissue culture slides (Nunc Inc., Naperville, IL). The cells were cultured at 37" C, 5% CO, and 100% humidity. Immunocytochemistry. Freshly isolated FSC were centrifuged onto specimen slides at 300 rpm in a cytospin centrifuge (Shandon, London, UK). Slides of freshly isolated and cultured cells were rinsed in PBS and fixed 10 min in methanol and 10 sec in acetone ( - 20" C). After air drylng and preincubation with FCS for blocking nonspecific binding sites, peroxidase staining was performed as described earlier (14). Bwsynthetic Labeling of Proteins. The cells were rinsed three times in methionine-free DMEM and incubated for 4 hr with 150 pCi 35S-methionine in the same medium. After labeling, the pulse media were removed, the cell layers were rinsed three times with ice-cold GBSS and cell lysates were obtained as described elsewhere (33).After centrifugation of pulse media and cell lysates at 4" C and 12,000 g for 30 min, the supernatants were taken off and diluted 1:1 with lysis buffer (33). Freshly isolated cells were suspended directly after purification in DMEM without methionine containing 500 pCi/ml 35S-methionineand incubated for 4 to 24 hr in 24-well culture plates. Thereafter, the cell suspension was centrifuged 10 min at 450 g, the pulse medium was removed and the cell pellet was washed three times in ice-cold GBSS and processed as described above. Measurement of the total protein synthesis was performed by trichloroacetic-acid precipitation of 35Slabeled proteins as described elsewhere (33). Cells were treated with different concentrations of the antibiotic tunicamycin 4 hr before and during pulse labeling to demonstrate N-glycosylation of C1-I. Cytokine Treatment of the Cells. Recombinant rat IFN-y (4 x lo6 IU/mg, purity 98%) was available in 0.01 m o w PBS supplemented with 0.01% gelatin, human recombinant leucocyte IFN-a (3 x lo6 IU/mg) in PBS/O.Ol% gelatin. Dexamethasone (lo-, mom) was dissolved in absolute ethanol. Before use the mediators were further diluted in isotonic sodium chloride solution and added to the culture medium. The control cells were treated with corresponding dilutions of

HEPATOLOGY

the dissolving buffers. After 20 hr of incubation the culture medium was removed and the cells were biosynthetically labeled in the presence of equivalent concentrations of the mediators as described above. Immunoprecipitation and SDS-PAGE. The immunoprecipitation and SDS-PAGE procedures were performed as previously described (32). The samples pulse labeled with 35Smethionine were incubated at 4" C overnight with a specific antiserum. Immunocomplexes were precipitated by incubation with Pansorbin at 4" C, washed five times in lysis buffer, boiled for 4 min in sample buffer (34) and analyzed by SDS-PAGE accordingto the method of Laemmli (34). The gels were fixed, dried and exposed to Kodak X-omat x-ray films (Eastman Kodak, Rochester, NY) (33).The protein bands were quantified by video densitometry (Biorad). Isolation of Total RNA and Northern-blot Analysis. Isolation of total RNA was performed according to the method of Chirgwin et al. (35) with some modifications described elsewhere (33).Cells cultured in 24-well culture plates were rinsed with PBS and lysed in guanidinium isothiocyanate. Total RNA samples were then separated by agarose gel electrophoresis and transferred onto Nylon Hybond membranes. After prehybridization (4 to 12 hr at 42" C) the membranes were hybridized with 32P-labeled complementary DNA (cDNA) probes at 42" C overnight. Afterward the membranes were washed in standard saline citrate, dried and exposed at - 70" C on Kodak X-omat films. For hybridization, a human C1-I cDNA (36) and an a-actin cDNA (37) probe were used. RNA was hybridized with an oligonucleQtide (5' AACGATCAGAGTAGTGGTATTTCACC 3') specific for ribosomal RNA to demonstrate that similar amounts of total RNA (5 pg) were loaded on the slots (38). In Situ Hybridixution. The preparation of cells, RNA probes and hybridization was performed according to described methods (39). With regard to the preparation of RNA probes, the digestion of C1-I-specific cDNA (plasmid pUC 9) also used for Northern-blot analysis withPstl andEcoRl resulted in five fragments. A fragment of 211 bases was subcloned into Bluescript SK plasmid DNA (Stratagene, La Jolla, CAI. Linearized recombinant DNA was transcribed to 36S-labeled sense or antisense probes using the T3 or T7 polymerase promotor of the Bluescript vector. With regard to the pretreatment of cells, slides with freshly isolated or cultured cells were fixed for 20 min with 4% paraformaldehyde, washed in 10 mmol/L magnesium chloride in PBS and stored at -70" C until further use. After predigestion with proteinase K (10 p g / d in 5 mmol/L EDTA, 50 mmol/L Tris-HC1, pH 7.4) for 10 rnin the slides were rinsed in PBS containing 0.1 mmol/L glycine and PBS alone for 5 min in each case, postfixed in 4% paraformaldehyde for 20 min and washed twice in PBS. Cells were then acetylated (0.25% acetic anhydride in 0.1 mol/L triethanolamine buffer, pH 8.0)for 10 min, washed again and dehydrated in ethanol. With regard to the hybridization of labeled probes to cell RNA, 35S-labeled RNA probes were diluted in hybridization buffer to a final concentration of 5 x lo4 cpdml. After hybridization that was performed overnight at 42" C, the slides were washed two to four times in 2 x standard saline citrate and treated with RNAse (20 p g / d in 0.5 m o w NaCl, 10 mmol/L Tris, 1 mmol/L EDTA, pH 7.5). Continued washes were followed by dehydration in ethanol. The slides were coated with Kodak NTB-2 emulsion, exposed for 7 days, developed in Kodak D-19 and fixed in Kodak rapid fixer. After counterstaining with hematoxylin and eosin the slides were analyzed by light microscopy.

Vol. 16, No. 3, 1992

C1 INHIBITOR GENE EXPRESSION IN RAT LIVER FAT-STORING CELLS

797

FIG. 3. Inhibition of N-glycosylation of C1-I synthesized by FSC (7 days old) by tunicamycin. Cells were treated 4 hr with 0.1 1~Lg/d(3,3'), 1 p g / d (4,4'), 5 p,g/ml(5,5') and 10 kg/ml(6,6') tunicamycin or with the solution buffer of tunicamycin fl,l',2,2')and pulsed for 2 hr with 150 pCi 35S-methionine in the presence of tunicamycin. C1-I immunoprecipitates obtained from cell lysates (1-6) and pulse media (1'-6') were analyzed by SDS-PAGE.

FIG.4. Kinetics of Cl-I synthesis and secretion by FSC (7 days after plating); pulse-chase experiment. Cells were pulsed 1 hr with 250 FCi 30 min (2,2'), 60 min (3,3'), 120 min (4,4'), 240 min 15,5')360 min (6.6') 36Smethionine in methionine-free DMEM and chased for 0 min (l,l')> and 720 min (7,7') with normal culture medium. C1-I immunoprecipitated from cell lysates (1-7) and chase media (1'-7') was separated by SDS-PAGE.

RESULTS Isohtion of FSC and Primary Culture. Using a mod-

smooth-muscle-a-actin a t day 7, as shown in our previous studies ( 14).

ification of the original isolation procedure, up to 60 x lo6 FSCkver were recovered. The cells present in the compact white top layer of the gradient contained more than 85% FSC; most of the contaminating cells were endothelial cells. FSC were mostly adherent at day 1after isolation and spread out at day 2. Contaminating cells remained predominantly in suspension (endothelial cells) so that they were removed for the most part after the fist change of medium at day 2. At this time, about 1%Kupffer cells were present in the cultures. Cultured FSC showed their well-known characteristics such as large fat vacuoles, which decrease in size and number during the time in culture (13), a stellate cell body with cytoplasmatic branches and a nucleus with one or two nucleoli (Fig. 1). FSC were positive for desmin and

SDS-PAGE analysis of cell lysate and pulse medium of cultured FSC immunoprecipitated with C1-I-specific antiserum revealed bands at about 81 kD for the intracellular protein and 86 kD for the secreted form (Fig. 2). After immunoprecipitation with antiserum preincubated with excess amounts of nonradioactive antigen, the bands were not detectable, indicating their specificity for C1-I. The pattern of the molecular weights of intracellular and secreted protein is in agreement with previous data obtained from C1-I of human sources (26, 29). FSC cultured for 7 days were incubated for 4 hr and pulse-labeled for 2 hr in the presence of different concentrations of tunicamycin, an antibiotic that is a

C1-I Synthesis in Freshly Isolated and Cultured FSC.

SCHWOGLER ET AL.

798

1

2

3

1'

HEPMOLOGY

2' 3'

FIG.5. Synthesis of C1-I in FSC at different times after isolation. Cells were labeled for 4 hr subsequently after isolation ( l , l ' ) ,at day 3 (2,Z') and day 7 (3,3').Immunoprecipitatesof cell lysates (1-3)and pulse media (1'-3')were analyzed by SDS-PAGE.

21w -b

4- c1-I

21kb -b 1dkb -b

1

2

3

FIG.6. C1-I gene expression in FSC at different times after isolation. Northern-blot analysis of total RNA extracted from cells immediately after isolation (l), at day 3 (2) and day 7 (3).Total RNA (5 bg) was electrophoresedon agarose gel (1%agarose concentration),blotted and hybridized subsequently with C1-I-specific and a-actin-specific "Plabeled cDNA probes.

specific inhibitor of dolichol phosphatase, the enzyme responsible for the N-glycosylation to further demonstrate the glycosylation of rat C1-I. Tunicamycin reduced the molecular weights of both intracellular and extracellular bands in concentrations of 1to 10 pg/ml; 0.1 pg/ml showed no effect (Fig. 3). The molecular weight of both protein forms was about 14 kD lower, indicating an asparagine-linked glycosyl residue of this size. The time course of the secretion of newly synthesized C1-I into the medium was demonstrated by pulse-chase experiments. FSC at day 7 after seeding were pulse labeled for 1 hr with 250 p,Ci/well 36S-methionineand chased for different times with nonradioactive DMEM. Immunoprecipitates obtained after SDS-PAGE showed evidence for the secretion of C1-I within a short period of time. After 240 min of chasing, pulse labeled protein was completely secreted, and no more was detectable in

intracellular material (Fig. 4). Thirteen percent of the total amount was secreted already after 30 min, and 87% was secreted after 120 min. SDS-PAGE of C1-I precipitated from FSC at day 0, 3 and 7 after isolation demonstrates that FSC svnthesize C1-I immediately after isolation and, because the used aliquots contained equal amounts of labeled total protein, that the rate of synthesis increases in its dependence on the culture age (Fig. 5). The increase of C1-I synthesis and secretion rate from day 3 to day 7 was about sixfold, as determined by video densitometry. Northern-blot Analysis and In Situ Hybridization. The results described above could be confirmed on the RNA level (Fig. 6).Freshly isolated and cultured cells at day 3 and day 7 were lysed and prepared for Northern-blot analysis as described before. The amount of C1-I-specific transcripts detected in lysates of freshly isolated cells was slightly higher than that of day 3. Because we found a similar effect for undulin and collagen type I11 messenger RNAs (mRNAs) (not shown), this effect might be a consequence of the cell isolation procedure. C1-I-specific transcripts increased distinctly at day 7 compared with day 3. Smooth-musclea-actin specifictranscripts were not detectable in freshly isolated FSC, whereas the expression of this gene increased from day 3 to day 7 after isolation, as demonstrated in our previous studies (14). In situ hybridization was performed to exclude the possibility that the positive C1-I-specific signals detected in lysates of freshly isolated FSC were caused by contaminating cells. Grains detected after hybridizing freshly isolated FSC with 36S-labeled antisense probes showed evidence that FSC, immediately after isolation, are in fact a cellular source of C1-I (Fig. 7A). The amount of grains on FSC cultured for 3 or 7 days increased in dependence on the time in culture and confirmed the results obtained from SDS-PAGE and Northern-blot analysis (Fig. 7C, E). Signal intensity was equally distributed over the cell shape and distinctly elevated compared with the controls (Fig. 7B, D, F) hybridized with sense probes.

Vol. 16, No. 3, 1992

C1 INHIBITOR GENE EXPRESSION IN RAT LrVER FAT-STORING CELLS

799

FIG.7. Detection of C1-I-specific mRNA in FSC by in situ hybridization.Freshly isolated (a,b), 3-day-old (c,d) and 7-day-old (e,D cells were hybridized with 36S-labeledC1-I-specific antisense (a,c,e) and sense Ib,d,o RNA probes. (a) and (b) original magnification x 400; (c) through (f)original magnification x 200. ModuZution of CI-I Synthesis in FSC. We further investigated whether C1-I gene expression in FSC is af€ected by IFNs and by dexamethasone. A significant effect on C1-I synthesis was detectable on the protein level after incubation of 6-day-old cells with IFN-)Ifor 20 hr. Synthesis and secretion increased in their dependence on the concentration of this cytokine. Concentrations of 1IU/ml had already caused 2-fold enhancement, and a maximal effect with a 6-fold to 10-foldincrease was reached at a concentration of 1,000 IU/ml (Fig. 8). FSC cultured for 3 days showed a minor response to IFN-)I (not shown). In contrast, the synthesis of the protease

inhibitor %-macroglobulin was not affected by IFN-)I (not shown). Similar findings were obtained investigating the RNA level. Concentrations of 1 IU/ml induced an increase of Cl-I-speclfic transcripts of about 1.5-fold and 100 IU/ml of about 2.5-fold, respectively (Fig. 9). In contrast to IFN-y, IFN-a caused no significant alteration of C1-I synthesis either on RNA (Fig. 9) or on the protein level (not shown). Smooth-muscle-a-actin-specific transcripts were slightly modulated by both interferons. The discrepancy in the content of C1-I-transcripts in the controls (lane 1 and lane 4 of Fig. 9) may be, at least in

800

HEPATOLOGY

SCHWOGLER ET AL.

Mr 97.4

+

69

-b

1

2

3

4

5

6

1’

2‘

Y 4’

s* 6‘

FIG.8. Modulation of C1-I synthesis in FSC (6 days old) by IFN-y. FSC were incubated with different concentrations of IFN-y and labeled for 24 h r with 150 pCi 36S-methioninein the presence of IFN-y. Immunoprecipitates from cell lysates (1-6) and pulse media (1 ‘-6’) yielded from control cells (1,I ’,2,2’) and cells exposed to 1IU/ml(3,3‘), 10 IU/ml(4,4’), 100 IU/ml f5,5’) and 1,000 IU/ml(6,6’) were analyzed by SDS-PAGE.

1

2

3

4

5

6

FIG. 9. Modulation of C1-I mRNA level in FSC by IFN-y (1-3)and IFN-a (4-6). Northem-blot analysis of total RNA extracted from FSC 7 days after isolation. Cells were previously incubated for 20 hr without cytokines (1,4), with 1IU/ml(2) and 100 IU/rnl(3) IFN-y or with 10 I U h l (5) and 1,000 IUlml(6) IFN-a, respectively. Total RNA (5 kg) was separated on agarose gel (l%), blotted and hybridized with a C1-I-specific 32P-labeledcDNA probe. The membranes were exposed for 1day (IFN-y) and 4 days (IFN-a). Samples of both experiments were also hybridized with an a-actin-specific probe.

part, caused by the different times of exposure (see legend). Furthermore, C1-I synthesis was not affected by the antiinflammatory hormone dexamethasone (not shown). DISCUSSION

In this report we demonstrate that isolated FSC of the rat liver synthesize and secrete C1-I. Rat C1-I appears in two major molecular sizes, characterized by a larger secreted mature form compared with the intracellular precursor. In heavily labeled samples, the extracellular form of the protein is also detectable in intracellular material, indicating the maturing process of the precursor. Distinct size differences between intracellular and mature forms are also present in human (21-1(29, 40).C1-I synthesized by rat FSC could be identified as a glycoprotein by inhibiting the N-glycosylation with tunicamycin. Decreased molecular weights indicate that asparagine-linked oligosaccharides are present in the

intracellular and extracellular form of rat C1-I. Human C1-I from Hep G2 cells shows a comparable reduction of the molecular weight after tunicamycin treatment (40). The size difference between lower glycosylated intracellular and extracellular protein could be the result of the fact that rat C1-I is not only N-glycosylated but also 0-glycosylated (41),as demonstrated in human cells (42, 43).Secretion of lower glycosylated C1-I indicates that the asparagin linkage of oligosaccharides is not necessary for the release of the protein into the medium. As demonstrated by pulse-chase experiments, de nouo synthesized C1-I is secreted completely within a short period of time. SDS-PAGE analysis of C1-I immunoprecipitates, Northern-blot analysis and in situ hybridization show that C1-I gene expression and synthesis is especially enhanced at late stages of primary culture, confirming previous observations that increased protein synthesis represents a function of FSC “activation.” Because it is known that the liver represents the major

Vol. 16, No. 3, 1992

C l INHIBITOR GENE EXPRESSION IN RAT LIVER FAT-STORING CELLS

synthesis site of C1-I (30) and the hepatocyte is the main cellular source in this organ (401, the production of C1-I by FSC should be only of local importance. Treatment of FSC with different concentrations of IFN-y caused a dose-dependent increase in C1-I synthesis and secretion. Enhanced C1-I-specific mRNA levels indicate that this cytokine modulates on a pretranslational level. In contrast, IFN-a was without effect. Up-regulation of C1-I synthesis induced by IFN-y was found in human skin fibroblasts (29), human monocytes (44,45) and human hepatoma cells (46, 47). Lappin, Birnie and Whaley (48) found a stimulation of C1-I caused by each IFN-a, IFN-P and IFN-y in human monocytes in uitro. Heda et al. (49) observed a twofold increase of C1-I-speciiic mRNA in human erythroleukemia cells treated with IFN-y but no alteration after incubation with IFN-a or IFN-P. Katz and Strunk (29) reported that IFN-P2 has, in contrast to IFN-y, no influence on C1-I synthesis in human skin fibroblasts. Proteases, which are known to be present in increased concentrations during inflammation, might be of importance in removing cellular debris resulting from this process. Matrix degradation could therefore be a side effect of inflammation. On the other hand, degradation of matrix proteins by protease activity could be necessary for the remodeling process of the extracellular matrix. Because FSC play a major role in synthesizing matrix proteins that accumulate during fibrogenesis,we believe that C1-I secretion could protect these components from enhanced protease activity. This function could be increased by IFN-y. Dexamethasone, an antiinflammatory hormone, showed no influence on C1-I synthesis. Glucocorticoids are able to modulate a variety of cell functions, including proliferation, differentiation and gene expression (50). Suppression of mRNA levels of type I and type lV collagens in an in vim model of hepatic fibrogenesis indicated an inhibition of fibrogenesis by corticoids (51). We recently demonstrated that the synthesis of azmacroglobulin, another protease inhibitor like C1-I, is increased by dexamethasone in FSC (52). Keeping in mind that IFN-y showed no effect on the synthesis of a,-macroglobulin in contrast to C1-I expression, it seems likely that, at least in FSC, these proteins are regulated in different ways. Acknowledgments: We thank Christine Waldmann for excellent technical assistance and BBatrice Hussong for typing the manuscript. We also thank Dr. Mario Tosi for the C1-I cDNA probe. REFERENCES 1. Wisse E, Geerts A, Bouwens L, van Bossuyt H, Vanderkerken K, van Goethem F. Cells of the hepatic sinusoid anno 1988: In: Wisse E, b o o k DL, Decker K, eds. Cells of the hepatic sinusoid, Vol. 2 Riiswijk, Netherlands: Kupffer Cell Foundation, 1989:1-9. 2. Wake K. Perisinusoidal stellate cells (fat storing cells, interstitial cells, lipocytes),their related structure in and around the liver sinusoids, and vitamin A storage in extrahepatic organs. Int Rev Cytol 1980;66:303-353. 3. Blomhoff R, Norum KR, Berg T. Hepatic uptake of 3H-retinol bound to the serum retinol binding protein involves both paren-

80 1

chymal and perisinusoidal stellate cells. J Biol Chem 1980;260: 13571-13575. 4. Hendriks HFJ, Brouwer A, Knook DL. The role of hepatic fat storing (stellate) cells in retinoid metabolism. HEPATOLOGY 1987; 1:1368-1371. 5. Hendriks HFJ, Verhoofstad AM, Brouwwe A, De Leeuw AM, Knook DL. Perisinusoidal fat storing cells are the main vitamin A storing sites in rat liver. Exp Cell Res 1985;160:138-149. 6. Wake K. Sternzellen in the liver: perisinusoidal cells with special reference to storage of Vitamin A. Am J Anat 1971;132:429-461. 7. McGee JO, Patrick Rs.The role of perisinusoidal cells in hepatic fibrogenesis. Lab Invest 1972;26:429-440. 8. Martinez-Hernandez A. The hepatic extracellular matrix. 11. Electron immunohistochemicalstudies in rats with CCl, induced cirrhosis. Lab Invest 1985;53:166-186. 9. Clement B, Emonhard H, Rissel M, Druget M, Grimaud JA, Herbage D, Bourel M, et al. Cellular origin of collagen and fibronectin in the liver. Cell Mol Biol 1984;30:489496. 10. Clement B, Grimaud JA, Campion JP, Deugnier Y,Guillouzo A. Cell types involved in collagen and fibronectin production in normal and fibrotic liver. HEPATOLOGY 1986;6:225-234. 11. Knook DL, SeffelaarAM, De Leeuw AM. Fat storing cells of the rat liver: their isolation and purification. Exp Cell Res 1982;139: 468-471. 12. Ramadori G. The stellate cell (Ito-cell, fat-storing cell, lipocyte, perisinusoidal cell) of the liver: new insights into pathophysiology of an intriguing cell. Virchows Archiv [Bl 1991;61:147-158. 13. De Leeuw AM, McCarthy SB, Geerta A, Knook DL. Purified rat liver fat storing cells in culture divide and contain collagen. HEPATOLOGY 1984;4:392-403. 14. Ramadori G, Veit T, Schwogler S, Dienes HP, Knittel T, Rieder H, Meyer zum Biischenfelde KH. Expression of the gene of the alpha-smooth-muscle isoform in rat liver and in rat fat storing (Ito) cells. Virchows Archiv [Bl 1990;59:349-357. 15. Ramadori G, Rieder H, Theiss F, Meyer zum Buschenfelde KH. Fat storing (Ito) cells of rat liver synthesize and secrete apolipoproteins: comparison with hepatocytes. Gastroenterology 1989; 97:163-173. 16. Andus T, Ramadori G, Heinrich PC, Knittel T, Meyer zum Buschenfelde KH. Cultured It0 ceb of the rat liver express the alpha-2-macroglobulin-gene.Eur J Biochem 1987;168641-646. 17. Arthur MJP, Friedman SL, Bissel DM. Gelatinaae secretion by hepatic lipocytes. In: Wisse E, Knook DL, Decker K, eds. Cells of the hepatic sinusoid, Vol 2. Rijswijk, Netherlands: Kupffer Cell Foundation, 1989:57-60. 18. Arthur MJP. Matrix degradation in the liver. In: Bkwl DM, ed. Connective tissue metabolism and hepatic fibrosis. Semin Liver DL 1990;10:47-55. 19. Arthur MJP, Friedman SL, Roll FJ, Bissel DM. Lipocytes from normal rat liver release a neutral metalloproteinase that degrades basement membrane (type Iv,collagen. J Clin Invest 1989;84: 1045-1049. 20. Pensky J, Sehwick H. Human serum inhibitor of C1-esterase: identity with alpha-2-neuraminoglycoprotein.Science 1969;163: 689-699. 21. Ratnoff OD, Lepow IH. Some properties of an esterase derived from preparations of the first component of complement. Proc Soc Exp Biol Med 1957;106:327-343. 22. Gigll I, Mason JW, Colman RW, Austen KF. Interaction of plasma kallikrein with the C1-inhibitor. J Immunol 1970;104:574-581. 23. Harpel PC, Cooper NR. Studies on human plasma C1 inactivatorenzyme interactions. I. Mechanism of interaction with Cls, plasmin and trypsin. J Clin Invest 1975;55:593-604. 24. Forbes CO, Peneky J , Ratnoff OD. Inhibition of activated Hageman factor and activated plasma thromboplastin by antecedent purified C1 inactivator. J Lab Clin Med 1970;76:809-815. 25. Perlmutter DM, Cole FS, Kilbridge P, Rossing TH, Colten HR. Expression of the alpha-1-proteinase inhibitor gene in human monocytes and macrophages. Proc Natl A d Sci USA 1985;82: 759-799. 26. Reboul A, Prandini MH, Bensa JC, Colomb MG. Characterization of Clq, Cls and C1-inhibitor synthesized by stimulated human monocytes in vitro. FEBS Lett 1985;190:65-68.

a02

SCHWOGLER ET AL.

27. Yeung Laiwah AC, Jones L, Hamilton AO, Whaley K. Complement-subcomponent C1-inhibitor synthesis by human monocytes. Biochem J 1985;226:199-205. 28. Randazzo BP, Dattwyler RJ, Kaplan AP,Ghebrehiwet B. Synthesis of C1-inhibitor (Cl-INH) by a human monocyte-like cell line, U 937. J Immunol 1985;135:1313-1317. 29. Katz Y,Strunk RC. Synthesis and regulation of C1 inhibitor in human skin fibroblasts. J Immunol 1989;142:2041-2045. 30. Johnson AM, Alper CA, Rosen FS, Craig JM. C1 inhibitor: evidence for decreased hepatic synthesis in hereditary angioneurotic edema. Science 1971;173:5553-5554. 31. Dijkstra CD, Dopp EA, Joling P, Kraal G. The heterogeneity of monocellularphagocytes in lymphoid organs: distinct macrophage subpopulation in the rat recognized by monoclonal antibodies ED1, ED2 and ED3. Immunology 1985;54:589-599. 32. Ramadori G, Rieder H, Knittel T, Meyer zum Buschenfelde KH. Fat storing cells (FSC) of rat liver synthesize and secrete fibronectin: Comparison with hepatocytes. J Hepatol 1987;4: 190-197. 33. Ramadori G, Sipe JD, Dinarello CA, Mizel SB, Colten HR. Pretranslational modulation of acute phase hepatic protein synthesis by murine recombinant interleukin-1 (IL-1)and purified human IL-1. J Exp Med 1985;162:930-942. 34. Laemmli UK. Cleavage of structural protein during the assembly of the head of bacteriophage T4. Nature 1970;227:680-682. 35. Chirgwin JM, Pryzbyla AB,Mac Donald RJ, Rutter WJ. Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry 1979;18:5294-5300. 36. Tosi M, Duponchel C, Bourgarel P, Colomb M, Meo T. Molecular cloning of human C1-inhibitor: sequence homologies with alantitrypsin and other members of the serpins superfamily. Gene 1986;42:265-272. 37. Schwartz RJ, Haron JA, Rothblum KN, Dugajczyk A. Regulation of muscle differentiation: cloning of sequences from alpha-actin messenger ribonucleic acid. Biochemistry 1980;19:5883-5890. 38. Barbu V,Dautry F. Northern blot normalization with a 28s RNA oligonucleotide probe. Nucleic Acid Res 1989;17:7115-7119. 39. Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, Struhl K, eds. Current protocols in molecular biology. New York John Wiley & Sons Inc., 1990. 40. Prandini MH, Reboul A, Colomb MG. Biosynthesisof complement C1 inhibitor by Hep G2 cells: reactivity of different glycosylated forms of the inhibitor with Cls. Biochem J 1986;237:93-98.

HEPATOLOGY

41. Hill RL, Beyer TA, Westcott KR, Eckhardt AE, Mullin RJ. Glycosyltransferases in protein glycosylation. In: Abraham AK, Eickhorn TS, Pryme IF, eds. Protein synthesis translational and post-translational events. Clifton, N J The Humana Press, 1983: 315-336. 42. Kornfeld R, Kornfeld S. Structure of glycoproteins and their oligosaccharide units. In: Lennartz W, ed. The biochemistry of glycoproteins and proteoglycans. New York Plenum Press, 1980: 1-34. 43. Harrison RA. Human C1 inhibitor: improved isolation and preliminary structural characterization. Biochemistry 1983;22: 5001-5007. 44. Bensa JC, Reboul A, Colomb MG. Biosynthesis in uitro of complement subcomponents Clq, Cls and C1 inhibitor by resting and stimulated human monocytes. Biochem J 1983;216:385-392. 45. Lotz M, Zuraw BL. Interferon-gamma is a major regulator of Cl inhibitor synthesis by human blood monocytes. J Immunol 1987;139:3382-3387. 46. Ramadori G, Bork K, Rieder H, Benes P, Meyer zum Buschenfelde KH. Regulation der C1 Inhibitor Synthese in menschlichen Hepatomzellenund Monozyten durch Interferone: Bedeutung fur Patienten mit angioneurotischem Syndrom [Abstract]. Klin Wschr 1989;67:274. 47. Ramadori G, Meyer zum Buschenfelde KH. Die AkutphaseReaktion und ihre Mediatoren. Teil I: Interleukin-1. Z Gastroenterol 1989;27:746-750. 48. Lappin DF, Birnie GD, Whaley K. Modulationby interferons of the expression of monocyte complement genes. Biochem J 1990;268: 387-392. 49. Heda GD, Mardente S, Weiner L, Schmaier AH. Interferongamma increases in uiuo and in vitro expression of C1-inhibitor. Blood 1990;75:2401-2407. 50. Thompson EB, Lippmann ME. Mechanism of action of glucocorticoids. Metabolism 1974;23:159-202. 51. Weiner FR, Czaja MJ, Giambrone MA, Takahashi S, Biempieca L, Zern MA. Transcriptional and posttranscriptional effects of dexamethasone on albumin and procollagen messenger RNAs in murine schistosomiasis. Biochemistry 1987;26:1557-1562. 52. Ramadori G, Knittel T, Schwogler S, Bieber F, Rieder H, Meyer zum Buschenfelde KH. Dexamethasone modulates a2macroglobulin and apolipoprotein E gene expression in cultured rat liver fat-storing (Ito) cells. HEPATOLOGY 1991;15:875-882.