233
Atherosclerosis, 92 (1992) 233-241 0 1992 Elsevier Scientific Publishers Ireland, Ltd. All rights reserved 0021-9150/92/$05.00
Printed and Published in Ireland
ATHERO 04768
Familial defective apolipoprotein Bloo: clinical characteristics of 54 cases G. Rauh, C. Keller, B. Kormann, F. Spengel, H. Schuster, G. Wolfram and N. Ziillner Medizinische
Poliklinik der Universitiit,
Pettenkoferstr.
8a. D-8000 Miinchen 2 (F. R.G. )
(Received 16 July, 1991) (Revised, received 26 November, 1991) (Accepted 29 November, 1991)
Familial defective apohpoprotein Bloo (FDB) is a recently identified dominantly inherited genetic disorder, which is characterized by a decreased affinity of low density lipoprotein (LDL) for the LDL receptor. FDB is caused by a G to A mutation at nucleotide 10 708 in exon 26 of the apo B gene creating a substitution of glutamine for arginine in the codon for amino acid 3500. To determine the consequences of the arginine(s5W) - glutamine mutation on plasma lipid levels and other clinical features. we have investigated 54 FDB heterozygotes from Germany (24 men, 30 women, mean age 37.2 (4-73) years). The average total cholesterol level in plasma was 308 mg/dl (average LDL-cholesterol 242 mg/dl). which was 116 mgIdl(l20 mg/dl) above the 50th percentile of the age and sex-matched controls reported in the LRC population studies (Lipid Research Clinics’ Program 1980). Tendon xanthoma and arcus lipoides were present in 25.9% and 22.2% of the patients, respectively. Plaques in the carotid arteries, determined by duplex scanning, were present in 38.9%, and coronary artery disease was present in 22.2%. This study shows that the combination of tendon xanthoma, arcus lipoides and premature atherosclerosis is no longer totally appropriate for the diagnosis of familial hypercholesterolemia (FH). It rather seems that these features are characteristic of a defective LDL receptor pathway, which could be caused by a defective LDL receptor or a defective ligand apo B,,,,,. The distinction between FH and FDB may have therapeutic implications, because certain lipid lowering drugs act by stimulation of the LDL receptor, which has a normal function in FDB. Key words: Apolipoprotein
Bloo; LDL; Atherosclerosis;
Introduction
The plasma level of low density lipoprotein (LDL) is to a large extent determined by the LDL to: Dr. G. Rauh, Medizinische Poliklinik der Pettenkoferstr. 8a, D-8000 Miinchen 2, F.R.G.
Correspondence
Universitlt,
Hypercholesterolemia;
Genetic mutation
receptor pathway. The interaction of LDL particles with the receptor is mediated by apolipoprotein Bloo (apo B,&, which is its sole protein constituent and ligand for the LDL receptor [l]. Mutations in the LDL receptor gene are known to cause familial hypercholesterolemia (FH), a disease characterized by an increased level of LDL
234 cholesterol, tendon xanthoma, and an increased risk of myocardial infarction [2,3]. Familial defective apolipoprotein Bloo (FDB) is a recently reported dominantly inherited genetic disorder, which is caused by a defective binding of apo Bloo to the LDL receptor [4]. FDB results from a G to A mutation at nucleotide 10 708 in exon 26 of the apo B gene creating a substitution of glutamine for arginine in the codon for amino acid 3500 [5]. The concordance between the arginglutamine and the functional defect inq3500) was demonstrated in turnover studies [6], binding studies [4] and studies with monoclonal antibodies directed against the putative receptor binding domain of apo Bloo [7]. FDB is one of the most common and widespread disorders of lipid metabolism resulting from a single-gene mutation. The argglutamine mutation has been observiniq3500) ed with a frequency of approximately l/500 in several populations of European origin: Austria [8], Denmark [9], Germany [lo-121, Italy [13], North America [4,14] and the United Kingdom [9]. FDB was not identified in the Finnish population, which has a different ethnic origin compared with the populations cited above [ 151. Haplotype analysis suggested that the arginine(35es, glutamine mutation occurred on a single ancestral gene of European origin [8,12,16,17]. FDB has been demonstrated in patients with mild [8], moderate [ 141 and severe hypercholesterolemia [9,10,12,16]. FDB was demonstrated only in a few normolipidemic individuals [ 141. Only the FDB heterozygotes with severe hypercholesterolemia displayed features typical of FH heterozygotes, such as tendon xanthoma and arcus lipoides. The purpose of this study was to examine the consequences of the arginineo5,, - glutamine mutation on plasma lipid levels and other clinical features in 54 FDB heterozygotes using the same diagnostic and examination criteria in each patient. Some of them have been described previously, but without complete clinical data [ 10,121. Subjects and methods
Subjects In previous studies we have identified 11 unrelated FDB heterozygotes in Munich [ 10,121. All individuals were recruited from a single lipid clinic at the Medizinische Poliklinik in Munich.
Family studies using DNA methods demonstrated the arginine(3500, - glutamine mutation in 43 additional related individuals, yielding a total of 54 FDB heterozygotes. In seven FDB families a defect of the LDL receptor was excluded by linkage analysis with polymorphic sites in the LDL receptor gene [ 181. In four FDB families where no linkage analysis was possible due to a limited number of family members a defect of the LDL receptor was excluded by tissue culture biochemistry [19]. Detection
of
the
arginine(,,,
glutamine mutation Genomic DNA was prepared from total blood cells using a Triton X-100 lysis method [20]. DNA was amplified by the polymerase chain reaction (PCR) [2 I]. The PCR primers and the AS0 probes were synthesized on an Applied Biosystems Model 391 (Forster City, CA). The sequences of the PCR primers were 5 ’CATAACAGTACTGTGAGCTTAACCACGAAA3’ and 5’AGGATCCTGCAATGTCAAGGTGTGAATTT3 ‘; those of the AS0 probes were 5 ‘GCACACGGTCTT3 ’ and 5 ‘GCACACAGTCTTC3 ’. PCRs were performed using an automated thermal cycler according to the recommendations of the manufacturer (Perkins-Elmer-Cetus, Norwalk, CT). Initial denaturation was at 95°C for 10 min. Subsequently 30 cycles were used, each consisting of 95°C for 1 min for denaturation, 1 min annealing at 55°C and 5 min extension at 73°C. The amplified DNA was transferred to nylon membranes (Amersham International) under vacuum with a Minifold II slotblotter (Schleicher und Schuell, Dassel, F.R.G.) and fixed to the membranes by irradiation for 3 min on a standard UV-transilluminator. Filters were hybridized with the AS0 probes for 1 h at 37°C in 5 x sodium-sodium phosphate ethylenediaminetetraacetate (SSPE), 5 x Denhardts solution and 0.5% sodium dodecylsulfate (SDS). ASOs were end labelled with T4 polynucleotide kinase and [ 32P]ATP (Amersham International). After washing for 10 min at 40°C in 5 x SSPE and 0.1% SDS the filters were exposed to X-ray films (Kodak X-Omat AR) for 24 h at -70°C. Lipid determination Blood samples were taken at least 12 h after the last meal. Plasma lipid levels were determined
235
following a period of at least 6 weeks without drug treatment or when the patients came to the lipid clinic for the first time and before therapy. Secondary hyperlipidemia was excluded in all subjects by normal levels of blood glucose and normal tests for hepatic, renal, thyroid and pancreatic function. Cholesterol and triglycerides were determined by enzymatic assays (Boehringer, Mannheim, F.R.G., Kit No. 236 691). HDL-cholesterol was determined after precipitation of apo Bloo containing lipoproteins, and LDL cholesterol was calculated by the Friedewald formula if triglycerides were < 300 mg/dl [22]. Lipoproteins were separated by preparative ultracentrifugation according to Have1 et al. [23]. Stutistical analysis of lipid levels
Analysis of variance was performed on heteroand the 50th percentile of the age- and sexmatched controls reported in the Lipid Research Clinics’ (LRC) population studies [24]. Significance was estimated by calculating the variance ratio (fl. We considered statistical significance to be at the 0.05 level.
zygotes
8ooCholesterol mg/dl
I
0’
1 12
i
1
I
3
4
’
6
1
6
’
7
’
8
’
9
/
l0
11
Family No Fig. 1. Total cholesterol levels in plasma of 1 I families consisting of 54 FDB heterozygotes (24 men, 30 women, age 37.2 (4-73) years, denoted by open squares) and 47 genetically normal individuals (25 men, 22 women, age 38.3 (6-75) years denoted by asterisks). Except for two families (families I and 7), there was no overlap of total cholesterol between FDB heterozygotes and normal individuals. In these families the FDB heterozgotes with low total cholesterol were below the age of 12 and had markedly higher cholesterol than individuals of the same generation. Moreover, their plasma cholesterol was above the 95th percentile of the age- and sex-matched controls reported in the LRC population studies [24].
Clinical characterization of FDB heterozygotes
A complete history and physical examination were obtained for all patients by the same examiner. A diagnosis of coronary artery disease (CAD) was established when the patient gave the typical history of angina1 chest pain and showed ischemic changes in exercise-ECG, when myocardial infarction was documented in the medical history, when coronary stenosis had been documented by angiography. or when aortocoronary bypass or angioplasty had been carried out. Hypertension was diagnosed according to WHO criteria; cigarette smoking (usually lo-20 cigarettes per day) was noted at the time of physical examination. Duplex scanning of the carotid arteries and their branches was carried out by a ATL Mark 600 (7.5 kHz Bmode, 5 mHz pulsed-Doppler). Carotid arteries were examined in three views (frontal, left-lateral, right-lateral), each view being taped onto a VHS recorder for documentation. Only plaque formation was considered as atherosclerosis of the carotid artery. Results
Figure 1 illustrates the total cholesterol
in 11
families consisting of 54 FDB heterozygotes (24 men, 30 women, mean age 37.2 (4-73) years, denoted by open squares) and 47 genetically normal individuals (25 men, 22 women, mean age 36.3 (6-75) years, denoted by asteriks). Except for two families (families 1 and 7), there was no overlap of total cholesterol between FDB heterozygotes and normal individuals. In these families the FDB heterozgotes with low total cholesterol were below the age of 12 and had markedly higher total cholesterol than normal individuals of similar age. Moreover, their plasma cholesterol was above the 95th percentile of the age- and sex-matched controls reported in the LRC population studies [24]. Whether a comparison is made within a single family or within different families a great difference of total cholesterol is noted. The lipid and lipoprotein levels of 54 FDB heterozygotes are presented in Table 1. The elevation of plasma cholesterol resulted from an elevation of LDL cholesterol. In two patients an additional elevation of plasma triglycerides was noted. All lipid and lipoprotein levels were compared with the 50th percentile of the age- and sex-
236 TABLE
1
LIPID
AND
LIPOPROTEIN
(years)
Number patients
Age group
LEVELS
of
IN PLASMA
Age (years)
OF 54 FDB HETEROZYGOTES
Lipids and lipoproteins
(mg/dl)
TC
TG
LDL-C
HDL-C
4-25
12
13.1
264 (213-325)
108 (44- 197)
201 (173-254)
26-50
21
35.2
51-73
15
59.3
322 (222-537) 314 (253-425)
107 (42-415) 118 (69-300)
257 (165-476) 240 (199-347)
41 (21-59) 45 (31-65) 50 (34-64)
Total
54
31.2
Men
24
31.6
308 (213-537) 310a (222-377)
III (42-415) 143 (54-415)
242 ( 156-476) 24ib (165-287)
45 (21-64) 43 (31-59)
Women
30
37.0
307c (213-537)
242d (,“,“_248)
(156-476)
46e (21-64)
TC = total cholesterol, TG = triglyceride, LDL-C = LDL-cholesterol, =F = 71.094, P 5 0.0001; bF = 79.991, P rc 0.0001; CF = 86.392,
HDL-C
= HDL-cholesterol;
range in parentheses.
P 5 0.0001; dF = 94.593, P 5 0.0001; eF = 23.153, P s
0.0001.
matched controls reported in the LRC population studies [24]. Statistical analysis was performed separately for each gender. Male and female FDB heterozygotes had significantly higher total cholesterol and LDL cholesterol (P I 0.0001) than the LRC controls. Female FDB heterozygotes had a significantly lower HDL cholesterol (P 5 0.0001) than the LRC controls. No significant difference was observed for plasma triglycerides in male and female FDB heterozygotes and for HDL cholest-
TABLE
2
CLINICAL
Age group
erol in male FDB heterozygotes. No significant difference was observed in lipid and lipoprotein levels between the three age groups. The average total cholesterol level of FDB heterozygotes was 308 mg/dl, which was 116 mg/dl above the 50th percentile of the age-and sex-matched LRC controls. The average LDL cholesterol level of FDB heterozygotes was 242 mg/dl, which was 120 mg/dl above the 50th percentile of the LRC controls. The clinical signs of 54 FDB heterozygotes are
SIGNS
OF 54 FDB HETEROZYGOTES Number of patients
Age
(years)
(years)
Tendon xanthoma (“h)
Arcus lipoides (‘%I)
4-25 26-50 51-73
12 27 15
13.1 35.2 59.3
0 25.9 46.1
0 22.2 40.0
Total Men
54 24
37.2
25.9 25.0
Women
30
77 __._‘) 20.8 23.3
31.6 37.0
26.7
WJ
0
0
O'LE
I'll
E'EL
0'09
6'8E
ixz
Z’IP
0’52
L'9C
O’OZ
pgoJe3
6Jal.m
(x) LJalJe
=-s!P
dJlWOJO3
sanbqd
O'LE 9'LE Z'LE E'6S Z'SE I'EI
Of PZ PS SI LZ 21
UauIoM w4 WJ~ CL-IS OS-95 SZ-P
(SJeab) (SJsaL)
a%f S3LO!DAZOlELL3H
sluayd
.J‘JJ=W’N
dnoJ%
2%
tK&I PS NI SISOlII313SOPEfH.LV E 318V.L
aq) u! sanbeld 30 sapuanbaq aqj ‘saloZKzo~a]ay BaJ 11” JOJ pau!uualap s! DuanbaJj a%waAe aql 31 .pa)ou SBM huanbaq %Uy?aWI! ua a%I? Itq aAoqe fparuasqo 10u aJaM av3 pue sapape pyo~e~ ay, u! sanbqd ‘s.wad sz 01 dn dnolil a% aql UI ‘E alqaJ u! pawasald s! sa)oXzo~alay aad ps II! s!soJal~olayxe 30 huanbaq aqL ‘lenp!A sap!odIl sn3JB ut! s~oys E a&g -!pu! azues aql30 .B!“aloJalsaloy~-‘adICY 30 uopwnp pue @aA
-as ay) 01 IauoyodoJd aq 01 pasoddns s! eu~oy~u~x uopua) ayl jo az!s aqL .aloMzoJa~ay 8ad apxu pi0 -Jea& e 30 uopual salIyv aq1 smoys z am%!d *hlaAp%dsaJ ‘%z’zz pue ygj’sz aJaM aldtues aql ur sap!odg snwa pua au~oy~uax uopual30 saisuanb -aJj aqt ‘sa~o%Azo3a~ay8ad lie ‘03 pau!tu.xalap s! huanbaq a%eJaae ay) JI *palou SBM huanb -as3 8u!saalx! UBa% ~t?y~aAoqa inq fpaMasq0 IOU aJaM sap!od!l stw1? pue ewoy~ut?x uopual ‘slvab sz 01 dn dnod a% ayl UI ‘z alq”l u! paluasald
238
Fig. 3. Arcus lipoides of the same 39-year-old male FDB heterozygote individual as in Fig. 2.
Fig. 4. Duplex scan of the carotid artery of the same 39-year-old male FDB heterozygote individual as in Fig. 2. Plaque formal lion occurs in the intima and protrudes into the vascular lumen.
239 carotid artery and CAD in the sample were 38.9% and 22.2%, respectively. In five of the 11 FDB families a history of premature CAD, i.e. before the age of 60, was observed. Additional risk factors, such as smoking and hypertension, were present in six FDB heterozygotes. Figure 4 shows the duplex scan of the carotid artery of the abovementioned 39-year-old male FDB heterozygote. The scan demonstrates that plaque formation occurs in the intima and protrudes into the vascular lumen. Discussion FDB is a common and widespread genetic disorder which leads to a dominantly inherited increase of LDL cholesterol. The underlying abnormality, a defective binding of apo B,, to the LDL receptor, results from a single-point mutation in the putative receptor binding domain of apo Bl~ [4,25]. The identification of 54 FDB heterozygotes has given us the opportunity to examine the consequences of the arginine(ssoo, - glutamine mutation on plasma lipid levels and other clinical features. Whether a comparison is. made with the 50th percentile of the age- and sex-matched controls reported in the LRC population studies [24] or with unaffected family members, the arginglutamine mutation results in a conN3500) siderable increase in total cholesterol and LDL cholesterol levels. The typical clinical signs of FH heterozygotes, such as tendon xanthoma, arcus lipoides and premature atherosclerosis, occur with similar frequency in FDB heterozygotes. The FDB heterozygotes had a total cholesterol level similar to that observed in FH heterozygotes, where a LDL receptor defect was confirmed by tissue culture biochemistry [ 191. The average total cholesterol level of 54 FDB heterozygotes from Germany was similar to that of 302 mg/dl reported for 27 FDB heterozygotes from the United Kingdom and Denmark [9,16]. The average total cholesterol level of the FDB heterozygotes from Germany was 39 mg/dl higher than that reported for 41 FDB heterozygotes from North America and Austria [14]. FDB heterozygotes from North America and Austria [14] were detected in a screening of individuals with predominantly
moderate hypercholesterolemia, whereas FDB heterozygotes from Germany, the United Kingdom and Denmark [9,16] were detected in a screening of individuals with more severe hypercholesterolemia. The FDB heterozygotes had tendon xanthoma and arcus lipoides with frequencies similar to those observed for our FH heterozygotes, where a LDL receptor defect was confirmed by tissue culture biochemistry. The frequency of tendon xanthoma and arcus lipoides in FDB heterozygotes from Germany were similar to those of 33% and 22%, respectively, reported for FDB heterozygotes from the United Kingdom and Denmark [9,16]. This finding is in contrast to that of Innerarity et al. [14], where only one proband had arcus lipoides and tendon xanthoma. A possible reason for this might be the different age distribution. The FDB heterozygotes had CAD with a frequency similar to those observed in FH heterozygotes [3]. CAD was observed in FH heterozygotes around the age of 60 years with a frequency of approximately 60% [3]. The frequency of CAD in FDB heterozygotes from Germany was approximately half of that reported for FDB heterozygotes from the United Kingdom and Denmark [9,16]. A part of that finding can be explained by the high proportion of men in this study. However, other risk factors or genetic factors may also be present. In FDB heterozygotes from North America and Austria [ 141,CAD was only observed in patients from Austria who were selected because of a primary clinical diagnosis of CAD. The FDB heterozygotes had plaques in the carotid artery with frequencies similar to those observed in FH heterozygotes [26,27]. In FH heterozygotes, plaques in the carotid artery were present with a frequency of 0% below the age of 20 years, with a frequency of 42.8% between the ages of 20 and 39 years and with a frequency of 72.3% above the age of 40 years [26.27]. Plaques were only observed in 10 of 82 normolipidemic controls, who had other risk factors for premature atherosclerosis. These studies demonstrate that the combination of tendon xanthoma, arcus lipoides and premature coronary and carotid atherosclerosis is no longer totally appropriate for the diagnosis of FH. It
240 rather seems that these features are characteristic for a defective LDL receptor pathway, which could be caused by a defective LDL receptor or a defective ligand apo Bloo. The distinction between FH and FDB may have therapeutic implications, because certain lipid lowering drugs act by stimulation of the LDL receptor. Two FDB heterozygotes from Italy demonstrated a decrease of cholesterol and LDL cholesterol by only 12% and 16%, respectively, after simvastatin treatment at a dose of up to 40 mg/day [28]. This is consistent with the notion that only one-third of LDL is catabolized via the LDL receptor pathway [29]. However, some of the FDB heterozygotes we have examined have shown a good response to statins. These discrepancies support the view that other factors such as the other apo B allele and the LDL receptor function have an impact on LDL metabolism [3,30-321. Acknowledgement This work was supported by a grant from the Deutsche Forschungsgemeinschaft. References Brown, MS. and Goldstein, J.L., A receptor-mediated pathway for cholesterol homeostasis, Science, 232 (1986) 34. Ziillner, N., Metabolism of steroids and carotenoids. In: Thannhauser’s Textbook of Metabolism and Metabolic Disorders, Grune and Stratton, New York, 1964, p. 56. Goldstein, J.L. and Brown, MS., Familial hypercholesterolemia. In: Striver, C.R, Beaudet, A.L., Sly, W.S. and Valle, D. (Eds.), The Metabolic Basis of Inherited Diseases, McGraw Hill, New York, 1989, p. 1215. Innerarity, T.L., Weisgraber, K.H., Arnold, K.S., Mahley, R.W., Krauss, R.M., Vega, G.L. and Grundy, SM., Familial defective apolipoprotein B-100: low density lipoproteins with abnormal receptor binding, Proc. Natl. Acad. Sci. USA, 84 (1987) 6919. Soria, L.F., Ludwig, E.H., Clarke, H.R.G., Vega, G.L., Grundy, S.M. and McCarthy, B.J., Association between a specific apolipoprotein B mutation and familial defective apolipoprotein B-100, Proc. Natl. Acad. Sci. USA, 86 (1989) 587. Vega, G.L. and Grundy, S.M., In vivo evidence for reduced binding of low density lipoproteins to receptors as a cause of primary moderate hypercholesterolemia, J. Clin. Invest., 78 (1986) 1410. Weisgraber, K.H., Innerarity, T.L., Newhouse, Y.M., Young, S.G., Arnold, K.S., Krauss, R.M., Vega, G.L.,
Grundy, S.M. and Mahley, R.W., Familial defective apolipoprotein B-100: enhanced binding of monoclonal antibody MB47 to abnormal low density lipoproteins, Proc. Natl. Acad. Sci. USA, 85 (1988) 9758. 8 Friedl, W., Ludwig, E.H., Balestra, M.E., Arnold, K.S., Paulweber, B., Sandhofer, F., McCarthy, B.J. and Innerarity, T.L., Apolipoprotein B gene mutations in Austrian subjects with heart disease and their kindred, Arterioscler. Thromb., I I (1991) 371. 9 Tybjaerg-Hansen, A., Gallagher, J.J., Vincent, J., Houlston, R., Talmud, P., Dunning, A.M., Seed, M., Hamsten, A., Humphries, S.E. and Myant, N.B., Familial defective apolipoprotein B-100: detection in the United Kingdom and Scandinavia, and clinical characteristics of ten cases, Atherosclerosis, 80 (1990) 235. IO Schuster, H., Rauh, G., Kormann, B., Hepp, T., Humphries, S.E., Keller, C., Wolfram, G. and Ziillner, N., Familial defective apolipoprotein B-100: comparison with familial hypercholesterolemia in I8 cases detected in Munich, Arteriosclerosis, IO (1990) 577. II Rauh, G., Schuster, H., Fischer, J., Keller, C., Wolfram, G. and Ziillner, N., Identification of a heterozygous compound individual with familial hypercholesterolemia and familial defective apolipoprotein B-100, Klin. Wochenschr., 69 (1991) 320. I2 Rauh, G., Schuster, H., Fischer, J., Keller, C., Wolfram, G. and Zollner, N., Familial defective apolipoprotein B-100: haplotype analysis of the arginine(ss,,,,, glutamine mutation, Atherosclerosis, 88 (1991) 219. I3 Corsini, A., Fantappie, S., Granata, A., Bemini, F.. Catapano, A.L., Fumagalli, R., Romano, L. and Romano, C., Binding defective low-density lipoprotein in family with hypercholesterolemia, Lancet, i (1989) 623. I4 Innerarity, T.L., Mahley, R.W., Weisgraber, K.H., Bersot, T.P., Krauss, R.M., Vega, G.L., Grundy, S.M., Friedl, W., Davignon, J. and McCarthy, B.J., Familial defective apolipoprotein B-100: a mutation of apolipoprotein B that causes hypercholesterolemia, J. Lipid Res., 31 (1990) 1337. I5 Hlmiillinen, T., Palotie, A., Aalto-Settill, K., Kontula, K. and Tikkanen, M.J., Absence of familial defective apolipoprotein B-100 in Finnish patients with elevated serum cholesterol, Atherosclerosis, 82 (1990) 177. I6 Myant, N.B., Gallagher, J.J., Knight, B.L., McCarthy, S.N., Frosteggrd, J., Nilsson, J., Hamsten, A., Talmud, P.J. and Humphries, S.E., Clinical signs of familial hypercholesterolemia in patients with familial defective apolipoprotein B-100 and normal low density lipoprotein receptor function, Arterioscler. Thromb., I I (1991) 691. I7 Ludwig, E.H. and McCarthy, B.J., Haplotype analysis of the human apolipoprotein B mutation associated with familial defective apolipoprotein B-100, Am. J. Hum. Genet., 47 (1990) 712. I8 Schuster, H., Stiefenhofer, B., Wolfram, G., Keller, C.. Humphries, S.E., Huber, A. and Zollner, N., Four DNA polymorphisms in the LDL-receptor gene and their use in diagnosis of familial hypercholesterolemia, Hum. Genet., 82 (1989) 69.
241 19
Keller, C., Harder+Spengel, K., Spengel, F.A., Wieczorek, A., Wolfram, G. and Ziillner, N., Serum cholesterol levels in patients with familial hypercholesterolemia confirmed by tissue culture, Atherosclerosis, 39 (198 I) 5 I.
20
Kunkel, L.M., Smith, K.D., Boyer. S.H., Borgaonkar, D.S., Wachtel, S.S., Miller, O.J., Breg, W.R., Jones, H.W. and Rary, J.M., Analysis of human Y-chromosomespecific reiterated DNA in chromosome variants, Proc.
21
22
23
24
25
Nat]. Acad. Sci. USA, 74 (1977) 1245. Saiki, R.K., Gelfand, D.H., Stoffel, S., Scharf, S.J., Higuchi, R.G., Horn, T.T., Mullis, K.B. and Erlich, H.A., Primer-directed enzymatic amplification of DNA with thermostable Friedewald, Estimation lipoprotein
DNA polymerase, Science, 239 (1988) 487. W.T., Levy, RI. and Fredrickson, D.S.. of the concentration of low densitycholesterol in plasma, without use of the
preparative ultracentrifuge, Clin. Chem., 18 (1972) 499. Have], R., Eder, H. and Bragdon, J., The distribution and chemical composition of ultracentrifugally separated lipoproteins in human serum, J. Clin. Invest., 34 (1955)
26
27
28
29
30
A.J., McCarthy, B.J., Mahley, R.W., Levy-Wilson, B. and Scott, J., Complete protein sequence and identification of structural domains of human apolipoprotein B, Nature, 323 (1986) 734.
familial hypercholesterolemia, Klin. Wochenschr.. 66 (1988) 65. Corsini, A., Mazzotti, M., Fumagalli, R., Catapano. A.L., Romano, L. and Romano, C.. Poor response to simvastatin in familial defective apolipoprotein B- 100, Lancet, i (1991) 305. Innerarity, T.L., Balestra, M.E., Arnold, K.S., Mahley, R.W., Vega, G.L., Grundy, SM. and Young S.G., Isolation of defective receptor-binding low density lipoproteins from subjects with familial defective apolipoprotein B-100, Arteriosclerosis, 8 (1988) 55la. Houlston, R.S., Turner, P.R., Revill, J., Lewis, B. and Humphries, S.E., The fractional catabolic rate of low density lipoprotein in normal individuals is influenced by variation in the apolipoprotein B gene: a preliminary study, Atherosclerosis, 71 (1988) 81.
1345. Lipid Research Clinics’ Program, Population Studies Data Book, Vol. I, The Prevalence Study, US Department of Health and Human Services, National Institutes of Health (NIH Publication No. SO-l527), Washington, DC. Knott, T.J., Pease, R.J., Powell, L.M., Wallis, S.C., Rall. S.C. Innerarity, T.L., Blackhart. B., Taylor, W.H., Marcel, Y., Milne, R., Johnson, D., Fuller, M., Lusis,
Schuster, H., Kroner, K.K., Keller, C., Spengel, F.A., Wolfram, G. and Ziillner, N., Atherosclerosis of the carotid arteries documented by duplex scan as a predictor of coronary artery disease in familial hyperlipidemias. Klin. Wochenschr., 65 (1987) 34. Spengel, F.A., Kaess, B., Keller. C., Kroner, K.K., Schreiber, M., Schuster, H. and Zollner, N., Atherosclerosis of the carotid arteries in young patients with
31
32
Gavish, D., Brinton, E.A. and Breslow, J.L., Heritable allele-specific differences in amounts of apo B and lowdensity lipoproteins in plasma, Science, 244 (1989) 72. Schuster, H., Humphries, S.E., Rauh, G., Keller, C.. Wolfram, G. and Ziillner, N., Association of DNAhaplotypes in the human LDL receptor gene with normal serum cholesterol levels, Clin. Genet.. 38 (1990) 401.
Atherosclerosis, 92 (1992) 233-241 0 1992 Elsevier Scientific Publishers Ireland, Ltd. All rights reserved 0021-9150/92/$05.00
Printed and Published in Ireland
ATHERO 04768
Familial defective apolipoprotein Bloo: clinical characteristics of 54 cases G. Rauh, C. Keller, B. Kormann, F. Spengel, H. Schuster, G. Wolfram and N. Ziillner Medizinische
Poliklinik der Universitiit,
Pettenkoferstr.
8a. D-8000 Miinchen 2 (F. R.G. )
(Received 16 July, 1991) (Revised, received 26 November, 1991) (Accepted 29 November, 1991)
Familial defective apohpoprotein Bloo (FDB) is a recently identified dominantly inherited genetic disorder, which is characterized by a decreased affinity of low density lipoprotein (LDL) for the LDL receptor. FDB is caused by a G to A mutation at nucleotide 10 708 in exon 26 of the apo B gene creating a substitution of glutamine for arginine in the codon for amino acid 3500. To determine the consequences of the arginine(s5W) - glutamine mutation on plasma lipid levels and other clinical features. we have investigated 54 FDB heterozygotes from Germany (24 men, 30 women, mean age 37.2 (4-73) years). The average total cholesterol level in plasma was 308 mg/dl (average LDL-cholesterol 242 mg/dl). which was 116 mgIdl(l20 mg/dl) above the 50th percentile of the age and sex-matched controls reported in the LRC population studies (Lipid Research Clinics’ Program 1980). Tendon xanthoma and arcus lipoides were present in 25.9% and 22.2% of the patients, respectively. Plaques in the carotid arteries, determined by duplex scanning, were present in 38.9%, and coronary artery disease was present in 22.2%. This study shows that the combination of tendon xanthoma, arcus lipoides and premature atherosclerosis is no longer totally appropriate for the diagnosis of familial hypercholesterolemia (FH). It rather seems that these features are characteristic of a defective LDL receptor pathway, which could be caused by a defective LDL receptor or a defective ligand apo B,,,,,. The distinction between FH and FDB may have therapeutic implications, because certain lipid lowering drugs act by stimulation of the LDL receptor, which has a normal function in FDB. Key words: Apolipoprotein
Bloo; LDL; Atherosclerosis;
Introduction
The plasma level of low density lipoprotein (LDL) is to a large extent determined by the LDL to: Dr. G. Rauh, Medizinische Poliklinik der Pettenkoferstr. 8a, D-8000 Miinchen 2, F.R.G.
Correspondence
Universitlt,
Hypercholesterolemia;
Genetic mutation
receptor pathway. The interaction of LDL particles with the receptor is mediated by apolipoprotein Bloo (apo B,&, which is its sole protein constituent and ligand for the LDL receptor [l]. Mutations in the LDL receptor gene are known to cause familial hypercholesterolemia (FH), a disease characterized by an increased level of LDL
234 cholesterol, tendon xanthoma, and an increased risk of myocardial infarction [2,3]. Familial defective apolipoprotein Bloo (FDB) is a recently reported dominantly inherited genetic disorder, which is caused by a defective binding of apo Bloo to the LDL receptor [4]. FDB results from a G to A mutation at nucleotide 10 708 in exon 26 of the apo B gene creating a substitution of glutamine for arginine in the codon for amino acid 3500 [5]. The concordance between the arginglutamine and the functional defect inq3500) was demonstrated in turnover studies [6], binding studies [4] and studies with monoclonal antibodies directed against the putative receptor binding domain of apo Bloo [7]. FDB is one of the most common and widespread disorders of lipid metabolism resulting from a single-gene mutation. The argglutamine mutation has been observiniq3500) ed with a frequency of approximately l/500 in several populations of European origin: Austria [8], Denmark [9], Germany [lo-121, Italy [13], North America [4,14] and the United Kingdom [9]. FDB was not identified in the Finnish population, which has a different ethnic origin compared with the populations cited above [ 151. Haplotype analysis suggested that the arginine(35es, glutamine mutation occurred on a single ancestral gene of European origin [8,12,16,17]. FDB has been demonstrated in patients with mild [8], moderate [ 141 and severe hypercholesterolemia [9,10,12,16]. FDB was demonstrated only in a few normolipidemic individuals [ 141. Only the FDB heterozygotes with severe hypercholesterolemia displayed features typical of FH heterozygotes, such as tendon xanthoma and arcus lipoides. The purpose of this study was to examine the consequences of the arginineo5,, - glutamine mutation on plasma lipid levels and other clinical features in 54 FDB heterozygotes using the same diagnostic and examination criteria in each patient. Some of them have been described previously, but without complete clinical data [ 10,121. Subjects and methods
Subjects In previous studies we have identified 11 unrelated FDB heterozygotes in Munich [ 10,121. All individuals were recruited from a single lipid clinic at the Medizinische Poliklinik in Munich.
Family studies using DNA methods demonstrated the arginine(3500, - glutamine mutation in 43 additional related individuals, yielding a total of 54 FDB heterozygotes. In seven FDB families a defect of the LDL receptor was excluded by linkage analysis with polymorphic sites in the LDL receptor gene [ 181. In four FDB families where no linkage analysis was possible due to a limited number of family members a defect of the LDL receptor was excluded by tissue culture biochemistry [19]. Detection
of
the
arginine(,,,
glutamine mutation Genomic DNA was prepared from total blood cells using a Triton X-100 lysis method [20]. DNA was amplified by the polymerase chain reaction (PCR) [2 I]. The PCR primers and the AS0 probes were synthesized on an Applied Biosystems Model 391 (Forster City, CA). The sequences of the PCR primers were 5 ’CATAACAGTACTGTGAGCTTAACCACGAAA3’ and 5’AGGATCCTGCAATGTCAAGGTGTGAATTT3 ‘; those of the AS0 probes were 5 ‘GCACACGGTCTT3 ’ and 5 ‘GCACACAGTCTTC3 ’. PCRs were performed using an automated thermal cycler according to the recommendations of the manufacturer (Perkins-Elmer-Cetus, Norwalk, CT). Initial denaturation was at 95°C for 10 min. Subsequently 30 cycles were used, each consisting of 95°C for 1 min for denaturation, 1 min annealing at 55°C and 5 min extension at 73°C. The amplified DNA was transferred to nylon membranes (Amersham International) under vacuum with a Minifold II slotblotter (Schleicher und Schuell, Dassel, F.R.G.) and fixed to the membranes by irradiation for 3 min on a standard UV-transilluminator. Filters were hybridized with the AS0 probes for 1 h at 37°C in 5 x sodium-sodium phosphate ethylenediaminetetraacetate (SSPE), 5 x Denhardts solution and 0.5% sodium dodecylsulfate (SDS). ASOs were end labelled with T4 polynucleotide kinase and [ 32P]ATP (Amersham International). After washing for 10 min at 40°C in 5 x SSPE and 0.1% SDS the filters were exposed to X-ray films (Kodak X-Omat AR) for 24 h at -70°C. Lipid determination Blood samples were taken at least 12 h after the last meal. Plasma lipid levels were determined
235
following a period of at least 6 weeks without drug treatment or when the patients came to the lipid clinic for the first time and before therapy. Secondary hyperlipidemia was excluded in all subjects by normal levels of blood glucose and normal tests for hepatic, renal, thyroid and pancreatic function. Cholesterol and triglycerides were determined by enzymatic assays (Boehringer, Mannheim, F.R.G., Kit No. 236 691). HDL-cholesterol was determined after precipitation of apo Bloo containing lipoproteins, and LDL cholesterol was calculated by the Friedewald formula if triglycerides were < 300 mg/dl [22]. Lipoproteins were separated by preparative ultracentrifugation according to Have1 et al. [23]. Stutistical analysis of lipid levels
Analysis of variance was performed on heteroand the 50th percentile of the age- and sexmatched controls reported in the Lipid Research Clinics’ (LRC) population studies [24]. Significance was estimated by calculating the variance ratio (fl. We considered statistical significance to be at the 0.05 level.
zygotes
8ooCholesterol mg/dl
I
0’
1 12
i
1
I
3
4
’
6
1
6
’
7
’
8
’
9
/
l0
11
Family No Fig. 1. Total cholesterol levels in plasma of 1 I families consisting of 54 FDB heterozygotes (24 men, 30 women, age 37.2 (4-73) years, denoted by open squares) and 47 genetically normal individuals (25 men, 22 women, age 38.3 (6-75) years denoted by asterisks). Except for two families (families I and 7), there was no overlap of total cholesterol between FDB heterozygotes and normal individuals. In these families the FDB heterozgotes with low total cholesterol were below the age of 12 and had markedly higher cholesterol than individuals of the same generation. Moreover, their plasma cholesterol was above the 95th percentile of the age- and sex-matched controls reported in the LRC population studies [24].
Clinical characterization of FDB heterozygotes
A complete history and physical examination were obtained for all patients by the same examiner. A diagnosis of coronary artery disease (CAD) was established when the patient gave the typical history of angina1 chest pain and showed ischemic changes in exercise-ECG, when myocardial infarction was documented in the medical history, when coronary stenosis had been documented by angiography. or when aortocoronary bypass or angioplasty had been carried out. Hypertension was diagnosed according to WHO criteria; cigarette smoking (usually lo-20 cigarettes per day) was noted at the time of physical examination. Duplex scanning of the carotid arteries and their branches was carried out by a ATL Mark 600 (7.5 kHz Bmode, 5 mHz pulsed-Doppler). Carotid arteries were examined in three views (frontal, left-lateral, right-lateral), each view being taped onto a VHS recorder for documentation. Only plaque formation was considered as atherosclerosis of the carotid artery. Results
Figure 1 illustrates the total cholesterol
in 11
families consisting of 54 FDB heterozygotes (24 men, 30 women, mean age 37.2 (4-73) years, denoted by open squares) and 47 genetically normal individuals (25 men, 22 women, mean age 36.3 (6-75) years, denoted by asteriks). Except for two families (families 1 and 7), there was no overlap of total cholesterol between FDB heterozygotes and normal individuals. In these families the FDB heterozgotes with low total cholesterol were below the age of 12 and had markedly higher total cholesterol than normal individuals of similar age. Moreover, their plasma cholesterol was above the 95th percentile of the age- and sex-matched controls reported in the LRC population studies [24]. Whether a comparison is made within a single family or within different families a great difference of total cholesterol is noted. The lipid and lipoprotein levels of 54 FDB heterozygotes are presented in Table 1. The elevation of plasma cholesterol resulted from an elevation of LDL cholesterol. In two patients an additional elevation of plasma triglycerides was noted. All lipid and lipoprotein levels were compared with the 50th percentile of the age- and sex-
236 TABLE
1
LIPID
AND
LIPOPROTEIN
(years)
Number patients
Age group
LEVELS
of
IN PLASMA
Age (years)
OF 54 FDB HETEROZYGOTES
Lipids and lipoproteins
(mg/dl)
TC
TG
LDL-C
HDL-C
4-25
12
13.1
264 (213-325)
108 (44- 197)
201 (173-254)
26-50
21
35.2
51-73
15
59.3
322 (222-537) 314 (253-425)
107 (42-415) 118 (69-300)
257 (165-476) 240 (199-347)
41 (21-59) 45 (31-65) 50 (34-64)
Total
54
31.2
Men
24
31.6
308 (213-537) 310a (222-377)
III (42-415) 143 (54-415)
242 ( 156-476) 24ib (165-287)
45 (21-64) 43 (31-59)
Women
30
37.0
307c (213-537)
242d (,“,“_248)
(156-476)
46e (21-64)
TC = total cholesterol, TG = triglyceride, LDL-C = LDL-cholesterol, =F = 71.094, P 5 0.0001; bF = 79.991, P rc 0.0001; CF = 86.392,
HDL-C
= HDL-cholesterol;
range in parentheses.
P 5 0.0001; dF = 94.593, P 5 0.0001; eF = 23.153, P s
0.0001.
matched controls reported in the LRC population studies [24]. Statistical analysis was performed separately for each gender. Male and female FDB heterozygotes had significantly higher total cholesterol and LDL cholesterol (P I 0.0001) than the LRC controls. Female FDB heterozygotes had a significantly lower HDL cholesterol (P 5 0.0001) than the LRC controls. No significant difference was observed for plasma triglycerides in male and female FDB heterozygotes and for HDL cholest-
TABLE
2
CLINICAL
Age group
erol in male FDB heterozygotes. No significant difference was observed in lipid and lipoprotein levels between the three age groups. The average total cholesterol level of FDB heterozygotes was 308 mg/dl, which was 116 mg/dl above the 50th percentile of the age-and sex-matched LRC controls. The average LDL cholesterol level of FDB heterozygotes was 242 mg/dl, which was 120 mg/dl above the 50th percentile of the LRC controls. The clinical signs of 54 FDB heterozygotes are
SIGNS
OF 54 FDB HETEROZYGOTES Number of patients
Age
(years)
(years)
Tendon xanthoma (“h)
Arcus lipoides (‘%I)
4-25 26-50 51-73
12 27 15
13.1 35.2 59.3
0 25.9 46.1
0 22.2 40.0
Total Men
54 24
37.2
25.9 25.0
Women
30
77 __._‘) 20.8 23.3
31.6 37.0
26.7
WJ
0
0
O'LE
I'll
E'EL
0'09
6'8E
ixz
Z’IP
0’52
L'9C
O’OZ
pgoJe3
6Jal.m
(x) LJalJe
=-s!P
dJlWOJO3
sanbqd
O'LE 9'LE Z'LE E'6S Z'SE I'EI
Of PZ PS SI LZ 21
UauIoM w4 WJ~ CL-IS OS-95 SZ-P
(SJeab) (SJsaL)
a%f S3LO!DAZOlELL3H
sluayd
.J‘JJ=W’N
dnoJ%
2%
tK&I PS NI SISOlII313SOPEfH.LV E 318V.L
aq) u! sanbeld 30 sapuanbaq aqj ‘saloZKzo~a]ay BaJ 11” JOJ pau!uualap s! DuanbaJj a%waAe aql 31 .pa)ou SBM huanbaq %Uy?aWI! ua a%I? Itq aAoqe fparuasqo 10u aJaM av3 pue sapape pyo~e~ ay, u! sanbqd ‘s.wad sz 01 dn dnolil a% aql UI ‘E alqaJ u! pawasald s! sa)oXzo~alay aad ps II! s!soJal~olayxe 30 huanbaq aqL ‘lenp!A sap!odIl sn3JB ut! s~oys E a&g -!pu! azues aql30 .B!“aloJalsaloy~-‘adICY 30 uopwnp pue @aA
-as ay) 01 IauoyodoJd aq 01 pasoddns s! eu~oy~u~x uopua) ayl jo az!s aqL .aloMzoJa~ay 8ad apxu pi0 -Jea& e 30 uopual salIyv aq1 smoys z am%!d *hlaAp%dsaJ ‘%z’zz pue ygj’sz aJaM aldtues aql ur sap!odg snwa pua au~oy~uax uopual30 saisuanb -aJj aqt ‘sa~o%Azo3a~ay8ad lie ‘03 pau!tu.xalap s! huanbaq a%eJaae ay) JI *palou SBM huanb -as3 8u!saalx! UBa% ~t?y~aAoqa inq fpaMasq0 IOU aJaM sap!od!l stw1? pue ewoy~ut?x uopual ‘slvab sz 01 dn dnod a% ayl UI ‘z alq”l u! paluasald
238
Fig. 3. Arcus lipoides of the same 39-year-old male FDB heterozygote individual as in Fig. 2.
Fig. 4. Duplex scan of the carotid artery of the same 39-year-old male FDB heterozygote individual as in Fig. 2. Plaque formal lion occurs in the intima and protrudes into the vascular lumen.
239 carotid artery and CAD in the sample were 38.9% and 22.2%, respectively. In five of the 11 FDB families a history of premature CAD, i.e. before the age of 60, was observed. Additional risk factors, such as smoking and hypertension, were present in six FDB heterozygotes. Figure 4 shows the duplex scan of the carotid artery of the abovementioned 39-year-old male FDB heterozygote. The scan demonstrates that plaque formation occurs in the intima and protrudes into the vascular lumen. Discussion FDB is a common and widespread genetic disorder which leads to a dominantly inherited increase of LDL cholesterol. The underlying abnormality, a defective binding of apo B,, to the LDL receptor, results from a single-point mutation in the putative receptor binding domain of apo Bl~ [4,25]. The identification of 54 FDB heterozygotes has given us the opportunity to examine the consequences of the arginine(ssoo, - glutamine mutation on plasma lipid levels and other clinical features. Whether a comparison is. made with the 50th percentile of the age- and sex-matched controls reported in the LRC population studies [24] or with unaffected family members, the arginglutamine mutation results in a conN3500) siderable increase in total cholesterol and LDL cholesterol levels. The typical clinical signs of FH heterozygotes, such as tendon xanthoma, arcus lipoides and premature atherosclerosis, occur with similar frequency in FDB heterozygotes. The FDB heterozygotes had a total cholesterol level similar to that observed in FH heterozygotes, where a LDL receptor defect was confirmed by tissue culture biochemistry [ 191. The average total cholesterol level of 54 FDB heterozygotes from Germany was similar to that of 302 mg/dl reported for 27 FDB heterozygotes from the United Kingdom and Denmark [9,16]. The average total cholesterol level of the FDB heterozygotes from Germany was 39 mg/dl higher than that reported for 41 FDB heterozygotes from North America and Austria [14]. FDB heterozygotes from North America and Austria [14] were detected in a screening of individuals with predominantly
moderate hypercholesterolemia, whereas FDB heterozygotes from Germany, the United Kingdom and Denmark [9,16] were detected in a screening of individuals with more severe hypercholesterolemia. The FDB heterozygotes had tendon xanthoma and arcus lipoides with frequencies similar to those observed for our FH heterozygotes, where a LDL receptor defect was confirmed by tissue culture biochemistry. The frequency of tendon xanthoma and arcus lipoides in FDB heterozygotes from Germany were similar to those of 33% and 22%, respectively, reported for FDB heterozygotes from the United Kingdom and Denmark [9,16]. This finding is in contrast to that of Innerarity et al. [14], where only one proband had arcus lipoides and tendon xanthoma. A possible reason for this might be the different age distribution. The FDB heterozygotes had CAD with a frequency similar to those observed in FH heterozygotes [3]. CAD was observed in FH heterozygotes around the age of 60 years with a frequency of approximately 60% [3]. The frequency of CAD in FDB heterozygotes from Germany was approximately half of that reported for FDB heterozygotes from the United Kingdom and Denmark [9,16]. A part of that finding can be explained by the high proportion of men in this study. However, other risk factors or genetic factors may also be present. In FDB heterozygotes from North America and Austria [ 141,CAD was only observed in patients from Austria who were selected because of a primary clinical diagnosis of CAD. The FDB heterozygotes had plaques in the carotid artery with frequencies similar to those observed in FH heterozygotes [26,27]. In FH heterozygotes, plaques in the carotid artery were present with a frequency of 0% below the age of 20 years, with a frequency of 42.8% between the ages of 20 and 39 years and with a frequency of 72.3% above the age of 40 years [26.27]. Plaques were only observed in 10 of 82 normolipidemic controls, who had other risk factors for premature atherosclerosis. These studies demonstrate that the combination of tendon xanthoma, arcus lipoides and premature coronary and carotid atherosclerosis is no longer totally appropriate for the diagnosis of FH. It
240 rather seems that these features are characteristic for a defective LDL receptor pathway, which could be caused by a defective LDL receptor or a defective ligand apo Bloo. The distinction between FH and FDB may have therapeutic implications, because certain lipid lowering drugs act by stimulation of the LDL receptor. Two FDB heterozygotes from Italy demonstrated a decrease of cholesterol and LDL cholesterol by only 12% and 16%, respectively, after simvastatin treatment at a dose of up to 40 mg/day [28]. This is consistent with the notion that only one-third of LDL is catabolized via the LDL receptor pathway [29]. However, some of the FDB heterozygotes we have examined have shown a good response to statins. These discrepancies support the view that other factors such as the other apo B allele and the LDL receptor function have an impact on LDL metabolism [3,30-321. Acknowledgement This work was supported by a grant from the Deutsche Forschungsgemeinschaft. References Brown, MS. and Goldstein, J.L., A receptor-mediated pathway for cholesterol homeostasis, Science, 232 (1986) 34. Ziillner, N., Metabolism of steroids and carotenoids. In: Thannhauser’s Textbook of Metabolism and Metabolic Disorders, Grune and Stratton, New York, 1964, p. 56. Goldstein, J.L. and Brown, MS., Familial hypercholesterolemia. In: Striver, C.R, Beaudet, A.L., Sly, W.S. and Valle, D. (Eds.), The Metabolic Basis of Inherited Diseases, McGraw Hill, New York, 1989, p. 1215. Innerarity, T.L., Weisgraber, K.H., Arnold, K.S., Mahley, R.W., Krauss, R.M., Vega, G.L. and Grundy, SM., Familial defective apolipoprotein B-100: low density lipoproteins with abnormal receptor binding, Proc. Natl. Acad. Sci. USA, 84 (1987) 6919. Soria, L.F., Ludwig, E.H., Clarke, H.R.G., Vega, G.L., Grundy, S.M. and McCarthy, B.J., Association between a specific apolipoprotein B mutation and familial defective apolipoprotein B-100, Proc. Natl. Acad. Sci. USA, 86 (1989) 587. Vega, G.L. and Grundy, S.M., In vivo evidence for reduced binding of low density lipoproteins to receptors as a cause of primary moderate hypercholesterolemia, J. Clin. Invest., 78 (1986) 1410. Weisgraber, K.H., Innerarity, T.L., Newhouse, Y.M., Young, S.G., Arnold, K.S., Krauss, R.M., Vega, G.L.,
Grundy, S.M. and Mahley, R.W., Familial defective apolipoprotein B-100: enhanced binding of monoclonal antibody MB47 to abnormal low density lipoproteins, Proc. Natl. Acad. Sci. USA, 85 (1988) 9758. 8 Friedl, W., Ludwig, E.H., Balestra, M.E., Arnold, K.S., Paulweber, B., Sandhofer, F., McCarthy, B.J. and Innerarity, T.L., Apolipoprotein B gene mutations in Austrian subjects with heart disease and their kindred, Arterioscler. Thromb., I I (1991) 371. 9 Tybjaerg-Hansen, A., Gallagher, J.J., Vincent, J., Houlston, R., Talmud, P., Dunning, A.M., Seed, M., Hamsten, A., Humphries, S.E. and Myant, N.B., Familial defective apolipoprotein B-100: detection in the United Kingdom and Scandinavia, and clinical characteristics of ten cases, Atherosclerosis, 80 (1990) 235. IO Schuster, H., Rauh, G., Kormann, B., Hepp, T., Humphries, S.E., Keller, C., Wolfram, G. and Ziillner, N., Familial defective apolipoprotein B-100: comparison with familial hypercholesterolemia in I8 cases detected in Munich, Arteriosclerosis, IO (1990) 577. II Rauh, G., Schuster, H., Fischer, J., Keller, C., Wolfram, G. and Ziillner, N., Identification of a heterozygous compound individual with familial hypercholesterolemia and familial defective apolipoprotein B-100, Klin. Wochenschr., 69 (1991) 320. I2 Rauh, G., Schuster, H., Fischer, J., Keller, C., Wolfram, G. and Zollner, N., Familial defective apolipoprotein B-100: haplotype analysis of the arginine(ss,,,,, glutamine mutation, Atherosclerosis, 88 (1991) 219. I3 Corsini, A., Fantappie, S., Granata, A., Bemini, F.. Catapano, A.L., Fumagalli, R., Romano, L. and Romano, C., Binding defective low-density lipoprotein in family with hypercholesterolemia, Lancet, i (1989) 623. I4 Innerarity, T.L., Mahley, R.W., Weisgraber, K.H., Bersot, T.P., Krauss, R.M., Vega, G.L., Grundy, S.M., Friedl, W., Davignon, J. and McCarthy, B.J., Familial defective apolipoprotein B-100: a mutation of apolipoprotein B that causes hypercholesterolemia, J. Lipid Res., 31 (1990) 1337. I5 Hlmiillinen, T., Palotie, A., Aalto-Settill, K., Kontula, K. and Tikkanen, M.J., Absence of familial defective apolipoprotein B-100 in Finnish patients with elevated serum cholesterol, Atherosclerosis, 82 (1990) 177. I6 Myant, N.B., Gallagher, J.J., Knight, B.L., McCarthy, S.N., Frosteggrd, J., Nilsson, J., Hamsten, A., Talmud, P.J. and Humphries, S.E., Clinical signs of familial hypercholesterolemia in patients with familial defective apolipoprotein B-100 and normal low density lipoprotein receptor function, Arterioscler. Thromb., I I (1991) 691. I7 Ludwig, E.H. and McCarthy, B.J., Haplotype analysis of the human apolipoprotein B mutation associated with familial defective apolipoprotein B-100, Am. J. Hum. Genet., 47 (1990) 712. I8 Schuster, H., Stiefenhofer, B., Wolfram, G., Keller, C.. Humphries, S.E., Huber, A. and Zollner, N., Four DNA polymorphisms in the LDL-receptor gene and their use in diagnosis of familial hypercholesterolemia, Hum. Genet., 82 (1989) 69.
241 19
Keller, C., Harder+Spengel, K., Spengel, F.A., Wieczorek, A., Wolfram, G. and Ziillner, N., Serum cholesterol levels in patients with familial hypercholesterolemia confirmed by tissue culture, Atherosclerosis, 39 (198 I) 5 I.
20
Kunkel, L.M., Smith, K.D., Boyer. S.H., Borgaonkar, D.S., Wachtel, S.S., Miller, O.J., Breg, W.R., Jones, H.W. and Rary, J.M., Analysis of human Y-chromosomespecific reiterated DNA in chromosome variants, Proc.
21
22
23
24
25
Nat]. Acad. Sci. USA, 74 (1977) 1245. Saiki, R.K., Gelfand, D.H., Stoffel, S., Scharf, S.J., Higuchi, R.G., Horn, T.T., Mullis, K.B. and Erlich, H.A., Primer-directed enzymatic amplification of DNA with thermostable Friedewald, Estimation lipoprotein
DNA polymerase, Science, 239 (1988) 487. W.T., Levy, RI. and Fredrickson, D.S.. of the concentration of low densitycholesterol in plasma, without use of the
preparative ultracentrifuge, Clin. Chem., 18 (1972) 499. Have], R., Eder, H. and Bragdon, J., The distribution and chemical composition of ultracentrifugally separated lipoproteins in human serum, J. Clin. Invest., 34 (1955)
26
27
28
29
30
A.J., McCarthy, B.J., Mahley, R.W., Levy-Wilson, B. and Scott, J., Complete protein sequence and identification of structural domains of human apolipoprotein B, Nature, 323 (1986) 734.
familial hypercholesterolemia, Klin. Wochenschr.. 66 (1988) 65. Corsini, A., Mazzotti, M., Fumagalli, R., Catapano. A.L., Romano, L. and Romano, C.. Poor response to simvastatin in familial defective apolipoprotein B- 100, Lancet, i (1991) 305. Innerarity, T.L., Balestra, M.E., Arnold, K.S., Mahley, R.W., Vega, G.L., Grundy, SM. and Young S.G., Isolation of defective receptor-binding low density lipoproteins from subjects with familial defective apolipoprotein B-100, Arteriosclerosis, 8 (1988) 55la. Houlston, R.S., Turner, P.R., Revill, J., Lewis, B. and Humphries, S.E., The fractional catabolic rate of low density lipoprotein in normal individuals is influenced by variation in the apolipoprotein B gene: a preliminary study, Atherosclerosis, 71 (1988) 81.
1345. Lipid Research Clinics’ Program, Population Studies Data Book, Vol. I, The Prevalence Study, US Department of Health and Human Services, National Institutes of Health (NIH Publication No. SO-l527), Washington, DC. Knott, T.J., Pease, R.J., Powell, L.M., Wallis, S.C., Rall. S.C. Innerarity, T.L., Blackhart. B., Taylor, W.H., Marcel, Y., Milne, R., Johnson, D., Fuller, M., Lusis,
Schuster, H., Kroner, K.K., Keller, C., Spengel, F.A., Wolfram, G. and Ziillner, N., Atherosclerosis of the carotid arteries documented by duplex scan as a predictor of coronary artery disease in familial hyperlipidemias. Klin. Wochenschr., 65 (1987) 34. Spengel, F.A., Kaess, B., Keller. C., Kroner, K.K., Schreiber, M., Schuster, H. and Zollner, N., Atherosclerosis of the carotid arteries in young patients with
31
32
Gavish, D., Brinton, E.A. and Breslow, J.L., Heritable allele-specific differences in amounts of apo B and lowdensity lipoproteins in plasma, Science, 244 (1989) 72. Schuster, H., Humphries, S.E., Rauh, G., Keller, C.. Wolfram, G. and Ziillner, N., Association of DNAhaplotypes in the human LDL receptor gene with normal serum cholesterol levels, Clin. Genet.. 38 (1990) 401.
