Bioelectromagnetics 35:519^530 (2014)

Extremely Low Frequency Magnetic Fields Inhibit Adipogenesis of Human Mesenchymal Stem Cells Leilei Du,1 Hongye Fan,1 Huishuang Miao,1 Guangfeng Zhao,2 and Yayi Hou1* 1

The State Key Laboratory of Pharmaceutical Biotechnology, Division of Immunology, Medical School, Nanjing University, Nanjing, P.R. China 2 Department of Obstetrics and Gynecology, Nanjing DrumTower Hospital, Nanjing University Medical School, Nanjing, P.R. China

It was reported that obese (Ob/Ob) mice lose their weight and fat when treated with 0.5 T direct current electromagnetic fields. We also observed that 7.5 Hz, 0.4 T rotation of extremely low frequency magnetic fields (ELF-MF) has an inhibitory effect on obesity. Mesenchymal stem cells (MSCs) are multi-potent cells capable of differentiating to different MSC lineages, including adipose. We hypothesized that inhibitory effects of ELF-MF on obesity may be related to the differentiation of MSCs to adipocytes. In the present study, we investigated the effects of 7.5 Hz, 0.4 T ELF-MF on differentiation of human umbilical cord MSCs. We found that ELF-MF inhibited adipogenic differentiation (exposed 2 h/day for 15 days) of MSCs but had no effect on osteogenic differentiation (exposed 2 h/day for 21 days). Moreover, ELF-MF inhibited adipocyte-specific expression of peroxisome proliferator-activated receptor 2 (PPARg2). ELF-MF promoted c-Jun Nterminal kinase (JNK)-dependent intracellular signaling in MSCs. Furthermore, activation of the non-canonical Wnt pathway provoked the inhibition of PPARg2 expression resulting in suppression of adipogenic differentiation. In addition, the effects of ELF-MF on growth and apoptosis of MSCs were not observed. Our data indicated that ELF-MF of 7.5 Hz, 0.4 T inhibited the adipogenic differentiation of MSCs via JNK-dependent Wnt signaling pathway, but had no effect on the growth and function of MSCs, suggesting the inhibitory effect of ELF-MF on obesity may be attributed to the inhibition of differentiation of MSCs into adipocytes. This study may provide a potential approach for the treatment of obesity. Bioelectromagnetics 35:519–530, 2014. © 2014 Wiley Periodicals, Inc. Key words: ELF-MF; adipogenic differentiation; MSCs; obesity; PPARg2

INTRODUCTION Obesity is a major health concern worldwide [Friedman, 2004] and is associated with the development of a number of pathological disorders including certain cancers, heart disease, stroke, and diabetes [Cornier et al., 2008; Attie and Scherer, 2009; PiSunyer, 2009; Nichols, 2012]. Mesenchymal stem cells (MSCs) are multi-potent cells capable of differentiating in vitro and in vivo to different MSC lineages, including adipose, bone and cartilage [Haynesworth et al., 1992; Pittenger et al., 1999]. Recent studies suggested that the inverse relationship between bone and fat mass might be caused by enhanced differentiation of MSC into either the osteoblastic or adipocytic lineages [Takeda et al., 2003; Gimble et al., 2006]. Therefore, it is important to maintain the balance of osteogenic differentiation and adipogenic differentiation of MSCs to prevent obesity.
2014 Wiley Periodicals, Inc.

Electromagnetic fields have been studied with great interest due to the possible effects they have on human health. Pulsed electromagnetic fields (PEMF) enhance osteogenic effects of bone morphogenetic Grant sponsor: National Natural Science Foundation of China; grant number: 31370899; grant sponsor: Ministry of Science and Technology “Twelfth Five-Year” National Scientific and Technological Support for Major Projects (China); grant number: 2012BA/15B03. *Correspondence to: Yayi Hou, Medical School, Nanjing University, Hankou Road 22, Nanjing 210093, P.R. China. E-mail: [email protected] Received for review 1 January 2014; Accepted 14 July 2014 DOI: 10.1002/bem.21873 Published online 4 September 2014 in Wiley Online Library (wileyonlinelibrary.com).

520

Du et al.

protein 2 (BMP-2) on MSCs cultured on calcium phosphate substrates, suggesting that PEMF will improve MSC response to BMP-2 in vivo in bones [Schwartz et al., 2008]. It was reported that 15 Hz, 1 mT magnetic fields can directly regulate the rat bone marrow MSCs, promoting their differentiation to osteoblasts and inhibiting differentiation to adipocytes [Yang et al., 2010]. A recent study found that alternating electric current promoted the differentiation of adult human MSCs toward the osteogenic pathway [Creecy et al., 2013], and the high-frequency (200 Hz) vibratory stimulation, when combined with a synthetic fibrous scaffold, served as a potent modulator of MSC functions [Tong et al., 2013]. Moreover, frequencies below 300 Hz are known as extremely low frequency magnetic fields (ELFMF). Interestingly, ELF-MFs do not have enough energy to break molecular bonds, for example, they cause no direct damage to DNA. ELF-MF is also noninvasive and non-ionizing and may have non-thermal effects on cells and tissues. These properties have led to studies of ELF-MF influence on the development of various diseases. It has been found that ELF-MF might be a way to stimulate and maintain chondrogenesis of MSCs and provide a new step in regenerative medicine regarding tissue [Mayer-Wagner et al., 2011]. We previously found that ELF-MF of 7.5 Hz, 0.4 T can inhibit tumor cell proliferation and disrupt the cell cycle [Wang et al., 2011]. It was reported that when obese (Ob/Ob) mice were treated with 0.5 T direct current electromagnetic fields, the mice increased their activity, lost weight and fat in a 6-day period [Nichols, 2012]; electromagnetic fields also reduced human abdominal obesity [Beilin et al., 2012]. We hypothesized that inhibitory effect of ELF-MF on obesity may be related to the differentiation of MSCs to adipocytes. Adipogenesis consists of two related steps: the determination of MSCs into preadipocytes and the differentiation of preadipocytes into mature fat cells [Bowers and Lane, 2007]. Because the number of preadipocytes and mature fat cells has been shown to be different between lean and obese human adult subjects [Tchoukalova et al., 2007], variations in the determination process in early stages of adipose tissue development might be important in the pathogenesis of obesity. However, the regulation of adipogenesis (adipocyte differentiation) is complex and this process includes alteration of the sensitivity to hormones and the expression of a number of genes in response to various stimuli including lipid mediators. Interestingly, several transcriptional factors and intracellular signaling pathways have been demonstrated to control the differentiation of MSCs into osteoblastic Bioelectromagnetics

or adipocyte cells, for example, peroxisome proliferatoractivated receptor (PPAR) g 2 [Akune et al., 2004] and canonical Wnt-b-catenin and non-canonical Wnt signaling pathways [Taipaleenmaki et al., 2011]. PPARg is a ligand-activated transcription factor [Mangelsdorf and Evans, 1995; Kersten et al., 2000; Rosen and Spiegelman, 2001]. It is believed that PPAR g and CCAAT/enhancer-binding proteins (C/EBPs) are the most important factors involved in the activation of adipogenesis, and they induce the expression of a number of adipogenic genes that participate in the control of adipogenesis [Lefterova and Lazar, 2009; Rosen et al., 2009]. PPARg2 overexpression in fibroblast cell lines can initiate adipogenesis [Tontonoz et al., 1994] and PPARg defect in ES cells and embryonic fibroblastic cells from mice were unable to differentiate into adipocytes [Barak et al., 1999; Kubota et al., 1999; Rosen et al., 1999]. Canonical Wnt/b-catenin signaling is a key regulator of bone formation and MSC differentiation to either the osteogenic or chondrogenic lineage [Church et al., 2002; Day et al., 2005; Hill et al., 2005; Holmen et al., 2005]. In addition, non-canonical Wnt signaling is also a regulator of cell differentiation [He et al., 2008]. Therefore, in the present study, we attempted to explore the effect of 7.5 Hz, 0.4 T rotation of ELF-MF on the differentiation of human umbilical cord MSCs (UC-MSCs) to adipocytes. Furthermore, we tried to investigate whether ELF-MF affects the differentiation of MSCs through regulating the expression of PPAR g 2 and Wnt signaling pathways. MATERIALS AND METHODS Culture of Human Umbilical Cords MSCs (UC-MSC) Human umbilical cords were obtained from fullterm caesarian section births in a sterile manner at the time of delivery at the Department of Gynecology and Obstetrics, the Affiliated Drum Tower Hospital of Nanjing University Medical School (Nanjing, China). The hospital ethics committee approved the consent forms and the protocol for evaluation of the tissue. Umbilical arteries and veins were removed, and the remaining tissue was transferred to a sterile container in DMEM/F12 (Gibco, Carlsbad, CA) with antibiotics (penicillin 100 mg/ml, streptomycin 10 mg/ml; Life Sciences, Carlsbad, CA) and was diced into 1–2 mm3 fragments. The tissue was incubated in an enzyme cocktail (hyaluronidase 5 U/ml, collagenase 125 U/ml, and dispase 50 U/ml; Sigma, St. Louis, MO) for 45– 60 min with gentle agitation at 37 8C. The cells were pelleted by low-speed centrifugation (250g for 5 min),

ELF-MF Inhibits Adipogenesis of Human MSCs

suspended in fresh medium, and transferred to cell culture flasks containing DMEM/F12 supplemented with 20% fetal bovine serum (Gibco). Cells were incubated with 5% CO2 at saturating humidity. When cells reached 70–80% confluence or when numerous colonies were observed, the cells were detached with 0.25% trypsin-EDTA (Sigma); the trypsin was inactivated with fresh media. The culture medium was replaced every 3 or 4 days. After the 2nd to 4th cell passages, the adherent cells were symmetric, with phenotypic surface antigens CD105þ, CD73þ, CD90þ, HLA-ABCþ, CD29þ, CD44þ, CD106, HLA-DR, CD19, CD11b, CD14, CD34, CD31. The cells of the 3rd passage were used in the experiments. Flow Cytometry The specific surface antigens of UC-MSCs in the cultures, after passages 2–4, were characterized by flow cytometry analysis. The following murine monoclonal antibodies, purified or directly conjugated with fluorescein isothiocyanate (FITC), phycoerythrin (PE or R-PE), allophycocyanin (APC) were used in fluorescence-activated cell sorting (FACS) analysis: anti-CD105, anti-CD73, anti-CD90, anti-HLA-ABC, anti-CD29, anti-CD44, anti-CD106, anti-HLA-DR, antiCD19, anti-CD11b, anti-CD14, anti-CD34, anti-CD31, anti-CD45, and IgG/IgM isotype controls (all from BD Biosciences, San Jose, CA). For fluorescence measurements only, data from 10000 single cell events were collected using a standard FACScalibur flow cytometer (Becton Dickinson, San Jose, CA). Data were analyzed using CELLQuest (Becton Dickinson) or FlowJo software (Treestar, San Carlos, CA). Experimental Magnetic Field The construction of experimental magnetic fields has been described previously [Wang et al., 2011; Nie et al., 2013]. Two pairs of fan-shaped NdFeB permanent magnets (N45; Innuovo, Dongyang, China; Fig. 1A) were attached to a circular iron plate and arranged to produce ELF-MF (Fig. 1B). The black arrow indicated site is the place where MSCs were exposed. The bottom two magnets rotated at certain frequency driven by a step motor, which was controlled using a functional signal generator. The top two magnets rotated synchronously due to the strong magnetic interaction. Magnetic flux density was measured at the target site using a gauss meter (HT201; Hengtong, Shanghai, China). ELF-MF at the target site is a series of alternate pulses with a maximum flux density of 0.4 T (6% variation). The frequency of ELF-MF could be varied from 0 to 7.5 Hz, but all experiments were conducted at 7.5 Hz. This instrument was fabricated

521

by the National Laboratory of Solid Micro-structures, Nanjing University (Nanjing, China). Control cells were placed in a similar apparatus except that there were two rotating iron plates instead of magnets, thus lacking an ELF-MF. The entire magnetic apparatus was located in a hood with controlled humidity and temperature. MSCs Osteogenesis and Adipogenesis Differentiation For differentiation experiments, the methods were used as Bilkovski et al. [2010] described. MSCs were transferred to six-well plates. Two days postconfluence, adipogenesis was induced by adding adipogenesis medium (Dulbecco’s modified Eagle’s medium, 10% FBS, 1% penicillin/streptomycin, 1 mM dexamethasone, 5 mg/ml insulin, 0.5 mM isobutylmethylxanthine, and 50 mM indomethacin). Osteogenesis was induced at 80% confluency by adding osteogenesis medium (Dulbecco’s modified Eagle’s medium, 10%FBS, 1% penicillin/streptomycin, 100 nM dexamethasone, 10 mM ascorbic acid, and 10 mM b-glycero-phosphate). Before performing the experiments, the two primary cell populations were cultured for at least 3 weeks under standard conditions. Alizarin Red S Stain Analysis After 21 days of differentiating condition, media was removed from the six-well plate and rinsed once with PBS. Cells were fixed with 4% formaldehyde solution for 30 min. After fixation, wells were rinsed twice with distilled water and cells were stained with 2% Alizarin Red S solution (pH 4.2; Sigma) for 2– 3 min. Wells were rinsed three times with distilled water, visualized under a light microscope and images were captured for analysis. Oil Red O Stain Analysis After 21 days of differentiating condition, media from six-well plate was removed and rinsed once with PBS. Cells were fixed with 4% formaldehyde solution for 30 min. After fixation, wells were rinsed twice with distilled water and 1 ml of 60% isopropanol was added for 30 min. Cells were then stained with Oil Red O solution for 30 min. Wells were rinsed three times with distilled water, visualized under a light microscope and images were captured for analysis. Reverse Transcription and Real-Time Polymerase Chain Reaction (PCR) Total RNA was extracted from the cultured cells using Trizol reagent (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions. For quantitative RT-PCR analysis of genes FABP4, Bioelectromagnetics

522

Du et al.

Fig. 1. Magnetic field exposure system. A: The magnetic field exposure system instrument was fabricated by the National Laboratory of Solid Micro-structures, Nanjing University (Nanjing, China). Internal schematic diagram of the instrument.The black arrow indicated site where MSCs were exposed. B: Two pairs of fan-shaped NdFeB permanent magnets were arranged to establish magnetic fields. ELF-MF at the target site is alternative pulses with a maximum flux density of about 0.4 T.

PPARg2, LPL, ALP, Runnx2, OCN, Col1a1 and GAPDH, 1 mg of total RNA was reverse transcribed to cDNA with oligdT and Thermoscript (TaKaRa, Dalian, China). Real-time PCR for these genes was performed on a tepOne Sequence Detection System (Applied Biosystems, Foster City, CA) using SYBR green dye (Invitrogen). A 10 ml PCR reaction was used and included 1 ml RT product, 5 ml 2 QuantiTect SYBR green PCR Master Mix, and 0.5 ml forward and reverse primers. The forward and reverse PCR oligonucleotide primers were designed with the Primer premier 5.0 software (Premier Biosoft, Palo Alto, CA), and the primer sequences were blasted to exclude the nonspecific sequences. The primer sequences are shown in Table 1. The reactions were incubated in a 96-well plate at 95 8C for 10 min, followed by 40 cycles of 95 8C for 15 s, 60 8C for 30 s and 72 8C for Bioelectromagnetics

30 s. The housekeeping gene GAPDH was used as endogenous control for RNA normalization. All experiments were done in triplicate. The level of expression was calculated based on the PCR cycle number (Ct) and the relative gene expression level was determined using the DDCt method. Western Blot Analysis Whole-cell lysates for Western blotting were extracted with lysis buffer containing 50 mM Tris (pH 8), HEPES (pH 7.5), 150 mM NaCl, 1.5 mM MgCl2, 1 mM EDTA, 0.1% Triton X-100, 0.25% sodium deoxycholate and protease inhibitor (Roche, Basel, Switzerland). Protein samples were resolved by 10% SDS/PAGE, and gels were transferred to polyvinylidene difluoride membranes (Roche). Membranes were blocked using 5% bovine serum albumin

ELF-MF Inhibits Adipogenesis of Human MSCs

523

TABLE 1. Primers Used for Real-Time Quantitative PCR Analysis SANGER_NAME

Forward primer (50 –30 )

Reverse primer (50 –30 )

HUMAN-PPARg2 HUMAN-FABP4 HUMAN-LPL HUMAN-Runx2 HUMAN-Col1a1 HUMAN-OCN HUMAN-ALP HUMAN-GAPDH

CTCCTATTGACCCAGAAAGCG GGAGTGGGCTTTGCCACCAGG GTGGACTGGCTGTCACGGGC GATGTCCGTAAGGTCTTGCCA CTTGGTCTCGTCACAGATCA CGGTGCAGAGTCCAGCAAAG TACCCAGATGACTACAGCCAA AGAAGGCTGGGGCTCATTTG

CAAAGTTGGTGGGCCAGAAT GCACATGTACCAGGACACCCCC GCCAGCAGCATGGGCTCCAA TGCAGTCTCCATCACGAAATG TGTTCAGCTTTGTGGACCTC TACAGGTAGCGCCTGGGTCTCT TCGGTGGATCTCGTATTTCATGT AGGGGCCATCCACAGTCTTC

Fig. 2. Isolation and characterization of UC-MSCs derived from human umbilical cord tissue. A: Morphology of MSCs isolate after 4, 6, and 8 days. B: Flow cytometry characterization of human MSC passage 3. Phenotypic surface antigens of MSCs (CD105, CD73, CD90, HLA-ABC, CD29, CD44, HLA-DR, CD19, CD11b, CD14, CD34, CD45, CD106, and CD31) were detected using FACS.

(BSA) for 1–2 h, at 25 8C and subsequently incubated overnight at 4 8C with diluted primary monoclonal antibodies against PPARg2 (1:1000 dilution; Santa Cruz, Dallas, TX), JNK (1:1000 dilution), p-JNK

(1:1000 dilution), b-catenin (1:1000 dilution; Santa Cruz), P-CamKII (1:1000 dilution), CamKII (1:1000 dilution), and GAPDH (1:1000 dilution; Cell Signaling Technology, Boston, MA). Signals were detected Bioelectromagnetics

524

Du et al.

Fig. 3. The effects of ELF-MF on osteogenic differentiation of MSCs. A: The cells were cultured in osteogenesis inducing medium and exposed to ELF-MF (ELF group) or sham exposure (CON). The cells without adding osteogenesis medium were as NC group.Osteoblast-specific mRNA expression of ALP, COL1a1, OCN and Runx2 and were measured by the real-time PCR. The realtime PCR results are expressed as means  SEM. B: Alizarin Red S staining was performed to detect the osteogenic differentiation at day 21.

using the appropriate HRP-conjugated secondary antibody (Cell Signaling Technology). The blots were visualized using an enhanced Immobilon Western chemiluminescent HRP substrate (Millipore, Billerica, MA), according to the manufacturer’s instructions, and the relative intensity of the specific bands was quantified using the FluorChem FC2 system (Alpha Innotech, San Jose, CA). Immunofluorescence The effects of ELF-MF on expression of PPARg2 and cytoskeleton of MSCs could be detected by immunofluorescence. Briefly, exponentially growing cells were seeded onto a six-well plate (Costar, Carlsbad, CA; 1  105 cells/well). The cells were adherent overnight. Media was removed from six-well plates and rinsed once with PBS. Cells were fixed with 4% formaldehyde solution for 30 min. After fixation, wells were rinsed twice with PBS and 0.1% Triton-100 was added for 15 min; wells were then rinsed twice Bioelectromagnetics

with PBS and 3% BSA was added for 1 h; wells were rinsed twice with PBST, after adding PPARg2 Ab (Santa Cruz) (1:2000) for PPARg2 protein detect or mouse monoclonal vinculin Ab (Santa Cruz) (1:2000) for cytoskeleton, 4 8C overnight. Wells were rinsed fourth with PBST, adding again Alexa Fluor 594 donkey anti-mouse IgG (Abcam, Cambridge, England; 1:1000) was added for PPARg2 protein detect or Alexa Fluor 594 donkey anti-mouse IgG (Abcam; 1:1000) and Phalloidin-FITC (Santa Cruz; 1:1000) for 2 h. Wells were rinsed four times with PBST, DAPI was added for 10 min. Using a laser scanning confocal microscope (Olympus FluoView FV10i, Osaka, Japan) cells were observed and a photograph was taken. Cell Proliferation, Cell Cycle, and Apoptosis Assay The effect of ELF-MF on cell viability was determined using the Cell Counting Kit-8 (CCK-8) assay (Dojindo, Kumamoto, Japan). Briefly, exponen-

ELF-MF Inhibits Adipogenesis of Human MSCs

525

Fig. 4. The effects of ELF-MF on adipogenic differentiation of Human umbilical cords MSCs. A: The cells were cultured in adipogenesis inducing medium and exposed to (ELF group) or sham exposure (CON). The cells without adding adipogenesis medium were as NC group. adipocyte-specific mRNA expression of PPARg2, FABP4, and LPL was measured by the realtime PCR. The real-time PCR results are expressed as means  SEM.  P < 0.05 versus CON. B: Oil Red O staining was performed detect the adipogenic differentiation at day 21.

tially growing cells were seeded onto a 24-well plate (Costar; 2  104 cells/well). Growing cells were exposed to ELF of 7.5 Hz, 0.4 T with different exposure times. Identical, non-energized exposure chambers were used for sham exposure of control cells in the same room. Twenty microliters of CCK-8 solution was added to each well, and the cells were further incubated at 37 8C for another 3.5 h. The absorbance values (A) at 450 nm were measured on an ELx-800 Universal Microplate Reader (BioTek, Winooski, VT). All data are expressed as mean values from three independent studies. For the apoptosis assay, the cells were harvested, stained with propidium iodide and anti-Annexin-V antibody, and then analyzed by a fluorescence-activated cell-sorting (FACS) Calibur (BD Biosciences). For cell cycle experiment, the treated cells were harvested, washed once with PBS, and fixed in 70% ethanol overnight. Staining of DNA content was performed with 50 mg/ml propidium iodide and 1 mg/ml RNase A for 30 min. Analysis was performed with Cell Quest Pro software.

Cell-cycle modeling was performed with Modfit 3.0 software (Verity Software House, Topsham, ME). Statistical Analysis All values were expressed as mean  SEM. The analyses were conducted with the SPSS 11.5 software (SPSS, Chicago, IL). Statistical significance was assessed by Student’s t-test. For PCR analysis, statistical analyses were conducted according to instructions for the Gel-Pro Analyzer (Alpha Innotech). For all statistical tests, P < 0.05 was considered significant. RESULTS Morphology of Human Umbilical Cords MSCs in Culture The cultures of primary UC-MSCs underwent an initial lag phase of about 4–8 days, adherent cells with fibroblastic morphology could be observed as early as 24 h. The cells formed a monolayer of homogenous Bioelectromagnetics

526

Du et al.

bipolar spindle-like cells with a whirl pool like array within 1 week (Fig. 2A). After 3 cell passages, the adherent cells were symmetric with phenotypic surface antigens. Results showed that UC-MSCs shared most of their immunophenotype with bone marrow-derived MSCs (BM-MSCs) as reported, including positivity for CD29, CD44, CD90, CD105 (SH2), CD73 (SH3), and HLA-ABC, negativity for CD19, CD11b, CD14, CD34, and CD31 (endothelial cell marker) and HLADR (Fig. 2B). Effects of ELF-MF on Osteogenesis by Human UC-MSCs To test the effect of ELF-MF on osteogenic differentiation of human UC-MSCs, osteoblast-specific mRNA expression of ALP, COL1a1, Runx2 and OCN was measured by the real-time PCR. The adherent MSCs with plates (ELF group) were exposed for 2 h/day for 15 days. Control treatments (CON group) were placed in a similar apparatus but without ELF-MF. The cells without added osteogenesis medium were the NC group. Real-time PCR results showed that ELF-MF had no effects on the expression of ALP, COL1a1, Runx2, and OCN (Fig. 3A). Furthermore, we analyzed the osteogenic differentiation of MSCs using Alizarin Red S Stain analysis. After 21 days of ELF-MF exposure (2 h/ day), there was no change on osteogenic differentiation compared with control samples (Fig. 3B). ELF-MF Exposure Inhibits Adipocyte Master Gene Expression of Human UC-MSCs To test the effect of ELF-MF on adipogenic differentiation of human UC-MSCs, adipocyte-specific mRNA expression of PPARg2, FABP4, and LPL was measured by the real-time PCR. The adherent MSCs with plates (ELF group) were exposed for 2 h/day for 15 days. Control treatments (CON group) were placed in a similar apparatus without the ELF-MF. The cells without added adipogenesis medium were the NC group. ELF-MF exposure for 15 days resulted in a decrease in PPARg2 and FABP4 over the non-treated control (P < 0.01; Fig. 4A). To further confirm the effect of ELF-MF on MSCs adipogenesis, cells were incubated in adipogenic induction medium with ELF-MF (2 h/day) or sham exposure for 21 days and then stained with Oil Red O. In Figure 4B, we can see that the control has more lipid droplets than the ELF-MF exposed group. ELF-MF Downregulates the PPARg 2 Expression of Human UC-MSCs To further study whether expression of PPARg2 protein was downregulated by ELF-MF, protein Bioelectromagnetics

Fig. 5. The effect of ELF-MF exposure on PPARg2 protein expression of human umbilical cords MSCs. A: MSCs cells were cultured on coverslips in adipogenic induction medium. After treatment with ELF-MF (ELF) or sham exposure (CON) for 21 days, MSCs were fixed and immunostained with specific Abs for rat PPARg2 (60). B: MSCs cells treated with were ELF-MF (ELF) or sham exposure (CON) for 21 days. Representative Western blots PPARg2 and GAPDH in MSCs were shown and the relative expression of PPARg2 to GAPDH was calculated. The results are shown as mean  SE from three representative independent experiments.  P < 0.05, compared with CON.

expression analysis was performed using Western blot and immunofluorescence methods. MSCs were cultured in adipogenic induction medium with ELFMF or sham exposure for 2 h/day for 21 days. Then the cells were stained with PPARg2 for immunofluorescence assay or the cells were lysed to PPARg2 protein level with immunoblot analysis. As shown in Figure 5A, after treatment with ELF-MF for 21 days, PPARg2 expression in MSCs was decreased. Western blotting results also showed that the level of PPARg2 protein was reduced after stimulation with ELF-MF (Fig. 5B). Effect of ELF-MF on Adipogenic Differentiation of Human UC-MSCs Is Mediated via the JNK-Dependent Noncanonical Wnt Signaling Pathway We next aimed to investigate how ELF-MF affected MSCs adipogenic differentiation. We detected several central signaling molecules (b-catenin, CamKII, JNK, and p-JNK) in Wnt signaling pathway. MSCs were cultured in adipogenic induction medium with ELF-MF or sham exposure for 2 h/day for

ELF-MF Inhibits Adipogenesis of Human MSCs

527

Fig. 6. Effect of ELF-MF on Wnt signaling pathway. MSCs cells treated with were ELF-MF (ELF) or sham exposure (CON) for 21 days. Representative Western blots b-catenin, JNK, p-JNK, CamKII, p-CamKII, and GAPDH in MSCs were shown and the relative expression of b-catenin to GAPDH, p-JNK to JNK and p-CamKII to CamKII was calculated. The results are shown as mean  SE from three representative independent experiments.  P < 0.05, compared with CON.

21 days. Then the cells were lysed and the immunoblot analysis was performed. ELF-MF had no effects on the expression of b-catenin, CamKII, and p-CamKII. However, the level of p-JNK was increased after ELFMF exposure (Fig. 6). ELF-MF Has No Effect on Morphology, Cell Cycle, Apoptosis, and Cell Proliferation of Human UC-MSCs Our studies have shown that ELF-MF was able to inhibit adipogenic differentiation of MSCs. We further examined the effects of ELF-MF on cytoskeleton, cell viability, cell cycle and apoptosis of MSCs. F-actin and vinculin are cell cytoskeleton proteins. After exposure with ELF-MF of 7.5 Hz, 0.4 T for 1–4 days, 2 h/day, ELF had no effects on the expression of F-actin and vinculin in MSCs (Fig. 7A). In addition, the cell viability was analyzed after treatment with ELF-MF using CCK-8 assay kit. As shown in Figure 7B, ELFMF had no effects on MSCs cell viability. Then the cell cycle was measured after treatment with ELF-MF. The results showed that the cell cycle of ELF-MF treated cells was similar to that of control cells (Fig. 7C). Assessment of cell apoptosis of MSC showed that treatment of ELF-MF of 7.5 Hz, 0.4 T for 1–4 days, 2 h/day had no effects on cell apoptosis (Fig. 7D).

DISCUSSION Bassett [1982] used a pair of Helmholtz coils to produce a magnetic field across a fracture site and enhance osteogenesis. Since then, several experimental studies have examined the influence of EMF on osteoporosis. The effect appears to vary with the waveform of magnetic field used [Bassett et al., 1981; Brighton, 1984; Rubin et al., 1989; Skerry et al., 1991]. The effect was variable, but in some cases, osteoporosis was prevented or even reversed. However, the exact mechanism by which EMF stopped bone loss has not been defined. In our study, we found that 7.5 Hz, 0.4 T ELF-MF inhibit adipogenic differentiation of MSCs while they have no affect on osteogenic differentiation. Furthermore, we found that ELF-MF of 7.5 Hz, 0.4 T may inhibit adipogenic differentiation of MSCs via JNK-dependent Wnt signaling pathway. ELF-MF inhibited adipocyte-specific expression of PPARg and C/EBPs, but had no effects on the expression of ALP, Runx2, OCN, and Col1a1. Several transcriptional factors and intracellular signaling pathways have been demonstrated to control the differentiation of MSCs into osteoblastic or adipocytic cells. Generally, it is believed that PPAR g and C/EBPs are the most important factors involved in the activation Bioelectromagnetics

528

Du et al.

Fig. 7. Effects of ELF-MF on cytoskeleton, cell viability, cell cycle and apoptosis of MSCs. A: MSCs cells were cultured on coverslips. After treatment with 7.5 Hz, 0.5 T ELF-MF (ELF) or sham exposure (CON) for 21 days, MSCs were fixed and immunostained with specific Abs for rat F-actin (Green) and Vinculin (Red) or DAPI for nucleus (60). B: Cell viability analysis of MSCs treated with ELF-MF using CCK-8 assay kit. C: Representative data of flow cytometry analysis of cell cycle. After 4 days of treatment, cells were analyzed and the percentage of cells in different cell cycle interphases G0/G1, S, and G2 are indicated. D: Representative data of flow cytometry analysis of apoptosis.D1,D2,D3,D4 refers to cells were treated with1-4 days of ELF-MF exposure (7.5 Hz, 0.4 T, 2 h/day).Data from one representative experiment performed in triplicate.

of adipogenesis [Noer et al., 2007; Hasegawa et al., 2008; Lefterova and Lazar, 2009; Rosen et al., 2009]. ALP, Runx2, OCN, and Col1a1 are osteogenesis markers of osteoblast differentiation [Glimcher et al., 2007; Holleville et al., 2007]. Esposito et al. [2013] reported that pulsed electromagnetic field (PEMF) increased the division of MSCs and reduced the time to obtain chondrocyte cell differentiation. Ceccarelli et al. [2013] also found that PEMF exposure promoted the cell proliferation of BM-MSCs and increased ALK protein level and activity. Our results demonstrated that ELF-MF inhibited adipogenesis of the stem cells but had no effect on osteogenesis. This indicates that ELF-MF and PEMF have different effects on MSCs differentiation. The present findings that ELF-MF concomitantly corrected Bioelectromagnetics

osteoblastogenesis and adipogenesis suggests that ELF-MF may act directly on the common precursor cell to inhibit its commitment in the adipocyte lineage. This may be one of the mechanisms by which ELFMF stops obesity. ELF-MF was found to promote JNK-dependent intracellular signaling in MSCs. Wnt pathway is considered to be important in regulating mechanisms for the proliferation, development, differentiation of cells and organisms and can be divided into canonical and noncanonical Wnt pathway. In the noncanonical Wnt pathway, Wnt ligand such as Wnt5a regulates target gene expression. JNK is a downstream effector of Wnt5a that activates activator protein 1 (AP-1), thereby regulating planar cell polarity (PCP) signaling [Ling et al., 2009; Rao and Kühl, 2010]. Several recent

ELF-MF Inhibits Adipogenesis of Human MSCs

studies have shown that noncanonical Wnt signaling has critical effects on the differentiation of MSCs, which express a number of ligands, receptors and pathway inhibitors [Etheridge et al., 2004]. In this study, we found that ELF-MF activates JNK noncanonical signaling in human MSCs. Interestingly it has been shown that JNK signaling is essential in the regulation of bone formation and inactivation of JNK signaling impairs osteogenesis, although adipogenesis is promoted [Tominaga et al., 2005]. There are some limitations to our study. First, most studies show that in the adipogenic and osteogenic differentiation of MSCs there exists a reciprocal relationship. This means that if adipogenic differentiation was promoted, osteogenic differentiation will be inhibited. In our study, ELF-MF inhibited adipogenic differentiation, but had no effect on osteogenic differentiation; a point to be further explored in the future. Our study revealed that ELF-MF acted on MSCs to inhibit differentiation to adipocytes. However, it is not clear if this effect is direct or indirect. In conclusion, the adipogenic differentiation of MSCs could be inhibited by ELF-MF of 7.5 Hz, 0.4 T, suggesting the inhibitory effect of ELF-MF on obesity may be attributed to the inhibition of differentiation of MSCs into adipocytes. Despite the limitations of our study, our findings have several implications for the biology and therapy of human diseases associated with adipogenesis and will provide a possible approach for the treatment of obesity. REFERENCES Akune T, Ohba S, Kamekura S, Yamaguchi M, Chung UI, Kubota N, Terauchi Y, Harada Y, Azuma Y, Nakamura K, Kadowaki T, Kawaguchi H. 2004. PPARgamma insufficiency enhances osteogenesis through osteoblast formation from bone marrow progenitors. J Clin Invest 113:846–855. Attie AD, Scherer PE. 2009. Adipocyte metabolism and obesity. J Lipid Res 50:S395–399. Barak Y, Nelson MC, Ong ES, Jones YZ, Ruiz-Lozano P, Chien KR, Koder A, Evans RM. 1999. PPAR g is required for placental, cardiac, and adipose tissue development. Mol Cell 4:585–595. Bassett CA. 1982. Claims for magnetotherapy. Can Med Assoc J 127:1079–1080. Bassett CA, Mitchell SN, Gaston SR. 1981. Treatment of ununited tibial diaphyseal fractures with pulsing electromagnetic fields. J Bone Joint Surg Am 63:511–523. Beilin G, Benech P, Courie R, Benichoux F. 2012. Electromagnetic fields applied to the reduction of abdominal obesity. J Cosmet Laser Ther 14:24–42. Bilkovski R, Schulte DM, Oberhauser F, Gomolka M, Udelhoven M, Hettich MM, Roth B, Heidenreich A, Gutschow C, Krone W, Laudes M. 2010. Role of WNT-5a in the determination of human mesenchymal stem cells into preadipocytes. J Biol Chem 285:6170–6178.

529

Bilkovski R, Schulte DM, Oberhauser F, Gomolka M, Udelhoven M, Hettich MM, Roth B, Heidenreich A, Gutschow C, Krone W, Laudes M. 2010. Role of WNT-5a in the determination of human mesenchymal stem cells into preadipocytes. J Biol Chem 285:6170–6178. Bowers RR, Lane MD. 2007. A role for bone morphogenetic protein-4 in adipocyte development. Cell Cycle 6:385– 389. Brighton CT. 1984. The semi-invasive method of treating nonunion with direct current. Orthop Clin North Am 15:33–45. Ceccarelli G, Bloise N, Mantelli M, Gastaldi G, Fassina L, De Angelis MGC, Ferrari D, Imbriani M, Visai L. 2013. A comparative analysis of the in vitro effects of pulsed electromagnetic field treatment on osteogenic differentiation of two different mesenchymal cell lineages. Biores Open Access 2:283–294. Church V, Nohno T, Linker C, Marcelle C, Francis-West P. 2002. Wnt regulation of chondrocyte differentiation. J Cell Sci 115:4809–4818. Cornier MA, Dabelea D, Hernandez TL, Lindstrom RC, Steig AJ, Stob NR, Van Pelt RE, Wang H, Eckel RH. 2008. The metabolic syndrome. Endocr Rev 29:777–822. Creecy CM, O’Neill CF, Arulanandam BP, Sylvia VL, Navara CS, Bizios R. 2013. Mesenchymal stem cell osteodifferentiation in response to alternating electric current. Tissue Eng Part A 19:467–474. Day TF, Guo X, Garrett-Beal L, Yang Y. 2005. Wnt/beta-catenin signaling in mesenchymal progenitors controls osteoblast and chondrocyte differentiation during vertebrate skeletogenesis. Cell 8:739–750. Esposito M, Lucariello A, Costanzo C, Fiumarella A, Giannini A, Riccardi G, Riccion I. 2013. Differentiation of human umbilical cord-derived mesenchymal stem cells, WJ-MSCs, into chondrogenic cells in the presence of pulsed electromagnetic fields. In Vivo 27:495–500. Etheridge SL, Spencer GJ, Heath DJ, Genever PG. 2004. Expression profiling and functional analysis of wnt signaling mechanisms in mesenchymal stem cells. Stem Cells 22:849–860. Friedman JM. 2004. Modern science versus the stigma of obesity. Nat Med 10:563–569. Gimble JM, Zvonic S, Floyd ZE, Kassem M, Nuttall ME. 2006. Playing with bone and fat. J Cell Biochem 98:251–266. Glimcher LH, Jones DC, Wein MN. 2007. Control of postnatal bone mass by the zinc finger adapter protein Schnurri-3. Ann NY Acad Sci 1116:174–181. Hasegawa S, Yamasaki M, Inage T, Takahashi N, Fukui T. 2008. Transcriptional regulation of ketone body-utilizing enzyme, acetoacetyl-CoA synthetase, by C/EBPalpha during adipocyte differentiation. Biochim Biophys Acta 1779:414–419. Haynesworth SE, Goshima J, Goldberg VM, Caplan AI. 1992. Characterization of cells with osteogenic potential from human marrow. Bone 13:81–88. He S, Pant D, Schiffmacher A, Meece A, Keefer CL. 2008. Lymphoid enhancer factor 1-mediated Wnt signaling promotes the initiation of trophoblast lineage differentiation in mouse embryonic stem cells. Stem Cells 26:842–849. Hill TP, Spater D, Taketo MM, Birchmeier W, Hartmann C. 2005. Canonical Wnt/beta-catenin signaling prevents osteoblasts from differentiating into chondrocytes. Dev Cell 8:727–738. Holleville N, Matéos S, Bontoux M, Bollerot K, Monsoro-Burq AH. 2007. Dlx5 drives Runx2 expression and osteogenic differentiation in developing cranial suture mesenchyme. Dev Biol. 304:860–874. Bioelectromagnetics

530

Du et al.

Holmen SL, Zylstra CR, Mukherjee A, Sigler RE, Faugere MC, Bouxsein ML, Deng L, Clemens TL, Williams BO. 2005. Essential role of beta-catenin in postnatal bone acquisition. J Biol Chem 280:21162–21168. Kersten S, Desvergne B, Wahli W. 2000. Roles of PPARs in health and disease. Nature 405:421–424. Kubota N, Terauchi Y, Miki H, Tamemoto H, Yamauchi T, Komeda K, Satoh S, Nakano R, Ishii C, Sugiyama T, Eto K, Tsubamoto Y, Okuno A, Murakami K, Sekihara H, Hasegawa G, Naito M, Toyoshima Y, Tanaka S, Shiota K, Kitamura T, Fujita T, Ezaki O, Aizawa S, Kadowaki T. 1999. PPAR g mediates high-fat diet-induced adipocyte hypertrophy and insulin resistance. Mol Cell 4:597–609. Lefterova MI, Lazar MA. 2009. New developments in adipogenesis. Trends Endocrinol Metab 20:107–114. Ling L, Nurcombe V, Cool SM. 2009. Wnt signaling controls the fate of mesenchymal stem cells. Gene 433:1–7. Mangelsdorf DJ, Evans RM. 1995. The RXR heterodimers and orphan receptors. Cell 83:841–850. Mayer-Wagner S, Passberger A, Sievers B, Aigner J, Summer B, Schiergens TS, Jansson V, Müller PE. 2011. Effects of low frequency electromagnetic fields on the chondrogenic differentiation of human mesenchymal stem cells. Bioelectromagnetics 32:283–290. Nichols TW, Jr. 2012. Mitochondria of mice and men: Moderate magnetic fields in obesity and fatty liver. Med Hypotheses 79:287–293. Nie Y, Du L, Mou Y, Xu Z, Weng L, Du Y, Zhu Y, Hou Y, Wang T. 2013. Effect of low frequency magnetic fields on melanoma: Tumor inhibition and immune modulation. BMC Cancer 13:582. Noer A, Boquest AC, Collas P. 2007. Dynamics of adipogenic promoter DNA methylation during clonal culture of human adipose stem cells to senescence. BMC Cell Biol 8:18. Pi-Sunyer X. 2009. The medical risks of obesity. Postgrad Med 121:21–33. Pittenger MF, Mackay AM, Beck SC, Jaiswal RK, Douglas R, Mosca JD, Moorman MA, Simonetti DW, Craig S, Marshak DR. 1999. Multilineage potential of adult human mesenchymal stem cells. Science 284:143–147. Rao TP, Kühl M. 2010. An updated overview on Wnt signaling pathways: A prelude for more. Circ Res 106:1798–1806. Rosen E, Eguchi J, Xu Z. 2009. Transcriptional targets in adipocyte biology. Expert Opin Ther Targets 13:975–986. Rosen ED, Sarraf P, Troy AE, Bradwin G, Moore K, Milstone DS, Spiegelman BM, Mortensen RM. 1999. PPAR g is required

Bioelectromagnetics

for the differentiation of adipose tissue in vivo and in vitro. Mol Cell 4:611–617. Rosen ED, Spiegelman BM. 2001. PPARg: A nuclear regulator of metabolism, differentiation, and cell growth. J Biol Chem 12:37731–37734. Rubin CT, McLeod KJ, Lanyon LE. 1989. Prevention of osteoporosis by pulsed electromagnetic fields. J Bone Joint Surg Am 71:411–417. Schwartz Z, Simon BJ, Duran MA, Barabino G, Chaudhri R, Boyan BD. 2008. Pulsed electromagnetic fields enhance BMP-2 dependent osteoblastic differentiation of human mesenchymal stem cells. J Orthop Res 26:1250–1255. Skerry TM, Pead MJ, Lanyon LE. 1991. Modulation of bone loss during disuse by pulsed electromagnetic fields. J Orthop Res 9:600–608. Taipaleenmaki H, Abdallah BM, AlDahmash A, Saamanen AM, Kassem M. 2011. Wnt signalling mediates the cross-talk between bone marrow derived pre-adipocytic and pre-osteoblastic cell populations. Exp Cell Res 317:745– 756. Takeda S, Elefteriou F, Karsenty G. 2003. Common endocrine control of body weight, reproduction, and bone mass. Annu Rev Nutr 23:403–411. Tchoukalova Y, Koutsari C, Jensen M. 2007. Committed subcutaneous preadipocytes are reduced in human obesity. Diabetologia 50:151–157. Tominaga S, Yamaguchi T, Takahashi S, Hirose F, Osumi T. 2005. Negative regulation of adipogenesis from human mesenchymal stem cells by Jun N-terminal kinase. Biochem Biophys Res Commun 326:499–504. Tong Z, Duncan RL, Jia X. 2013. Modulating the behaviors of mesenchymal stem cells via the combination of highfrequency vibratory stimulations and fibrous scaffolds. Tissue Eng Part A 19:1862–1878. Tontonoz P, Hu E, Spiegelman BM. 1994. Stimulation of adipogenesis in fibroblasts by PPAR g 2, a lipid-activated transcription factor. Cell 79:1147–1156. Wang T, Nie Y, Zhao S, Han Y, Du Y, Hou Y. 2011. Involvement of midkine expression in the inhibitory effects of lowfrequency magnetic fields on cancer cells. Bioelectromagnetics 32:443–452. Yang Y, Tao C, Zhao D, Li F, Zhao W, Wu H. 2010. EMF acts on rat bone marrow mesenchymal stem cells to promote differentiation to osteoblasts and to inhibit differentiation to adipocytes. Bioelectromagnetics 31:277–285.