Bioscience, Biotechnology, and Biochemistry
ISSN: 0916-8451 (Print) 1347-6947 (Online) Journal homepage: http://www.tandfonline.com/loi/tbbb20
Extremely low-frequency electromagnetic field promotes astrocytic differentiation of human bone marrow mesenchymal stem cells by modulating SIRT1 expression Won-Yong Jeong, Jun-Beom Kim, Hyun-Jung Kim & Chan-Wha Kim To cite this article: Won-Yong Jeong, Jun-Beom Kim, Hyun-Jung Kim & Chan-Wha Kim (2017) Extremely low-frequency electromagnetic field promotes astrocytic differentiation of human bone marrow mesenchymal stem cells by modulating SIRT1 expression, Bioscience, Biotechnology, and Biochemistry, 81:7, 1356-1362, DOI: 10.1080/09168451.2017.1308243 To link to this article: http://dx.doi.org/10.1080/09168451.2017.1308243
View supplementary material
Published online: 29 Mar 2017.
Submit your article to this journal
Article views: 113
View related articles
View Crossmark data
Citing articles: 1 View citing articles
Full Terms & Conditions of access and use can be found at http://www.tandfonline.com/action/journalInformation?journalCode=tbbb20 Download by: [Australian Catholic University]
Date: 15 September 2017, At: 07:26
Bioscience, Biotechnology, and Biochemistry, 2017 Vol. 81, No. 7, 1356–1362
Extremely low-frequency electromagnetic field promotes astrocytic differentiation of human bone marrow mesenchymal stem cells by modulating SIRT1 expression Won-Yong Jeong, Jun-Beom Kim, Hyun-Jung Kim and Chan-Wha Kim* College of Life Sciences and Biotechnology, Korea University, Seoul, Korea Received January 12, 2017; accepted March 3, 2017
Downloaded by [Australian Catholic University] at 07:26 15 September 2017
https://doi.org/10.1080/09168451.2017.1308243
It has been shown that extremely low-frequency electromagnetic fields (ELFMF) affect regulation of cell fate and differentiation. Thus, the aim of this study was to investigate the role of ELFMFs in the enhancement of astrocytic differentiation. ELFMF exposure reduced the rate of proliferation and enhanced astrocytic differentiation. The ELFMFtreated cells showed increased levels of the astrocyte marker (GFAP), while those of the early neuronal marker (Nestin) and stemness marker (OCT3/4) were downregulated. The reactive oxygen species (ROS) level was observed to be significantly elevated after ELFMF exposure, which strengthens the modulatory role of SIRT1 and SIRT1 downstream molecules (TLE1, HES1, and MASH1) during astrocytic differentiation. After nicotinamide (5 mM) mediated inhibition of SIRT1, levels of TLE1, HES1, and MASH1 were examined; TLE1 was significantly upregulated and MASH1 was downregulated. These results suggest that ELFMFs induce astrocytic differentiation through activation of SIRT1 and SIRT1 downstream molecules. Key words:
extremely low-frequency electromagnetic fields; hBM-MSCs; astrocytic differentiation; SIRT1; TLE1
Neural cell regeneration potentially benefits patients with degenerative diseases or injuries of the nervous system, such as Alzheimer’s disease (AD), Parkinson’s disease (PD), Huntington’s disease, spinal cord and brain trauma, brain tumors, or spinal cord injuries. Recently, there has been a lot of research on the possibility of generating neural cells from embryonic stem cells (ESCs), neural stem (NS) cells from the brain, and mesenchymal stem cells (MSCs) from adult bone marrow (BM).1) BM-MSCs can ultimately differentiate into osteoblasts, adipocytes, chondrocytes, myoblasts, and early
neural progenitor cells (NPCs). Generally, researchers use specific factors, such as growth factors, neurotrophins, and cytokines, or specific chemical compounds, such as β-mercaptoethanol, dimethyl sulfoxide (DMSO), and butylated hydroxyanizole (BHA), to induce differentiation of BM-MSCs into neural cells.2−4) However, specific factors have disadvantages, such as restricted sources, high cost, risk of rejection, and disease propagation. Additionally, specific chemical compounds have disadvantages, such as reduced viability of MSCs and difficulty of acquiring functional neurons.5) Therefore, researchers are making efforts to find a more affordable and efficient way to differentiate MSCs into neural cells. Previously, we reported that extremely low-frequency electromagnetic fields (ELFMFs) induce neural differentiation of human BM-MSCs (hBM-MSCs).6,7) One of the neural differentiation mechanisms is related to reactive oxygen species (ROS) generated by ELFMFs. ROS have been known to be significant chemical mediators, regulating signal transduction processes related to cell growth and differentiation.8) High expression levels of ROS can directly or indirectly regulate the expression of sirtuin1 (SIRT1).9) SIRT1 is an NAD+-dependent class III histone deacetylase (HADC) that deacetylates histones and transcription factors.10) Under oxidative conditions, SIRT1 expression is upregulated in NPCs. Subsequently, SIRT1 binds to the transcription factor Hairy/enhancer of split 1 (Hes1) and inhibits Mash1 expression.11) Therefore, in this study, we investigated the involvement of ELFMF-induced activation of SIRT1 and SIRT1 downstream molecules in MSC differentiation.
Materials and methods Cell culture. hBM-MSCs (PT-2501, Walkersville Inc, MD) were thawed and maintained in culture in non-hematopoietic expansion medium (Miltenyi Biotec, Bergisch Gladbach, Germany) supplemented with
*Corresponding author. Email: [email protected] Abbreviations: AD, Alzheimer’s disease; hBM-MSC, human bone marrow-derived mesenchymal stem cell; ELFMF, extremely low-frequency electromagnetic field; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; FBS, fetal bovine serum; HES1, hairy and enhancer of split1; NPC, neural progenitor cell; PD, Parkinson’s disease; ROS, reactive oxygen species; SIRT1, sirtuin1; TLE1, transducin-like enhancer protein1. © 2017 Japan Society for Bioscience, Biotechnology, and Agrochemistry
Effect of Electromagnetic Fields on Neural Differentiation
Downloaded by [Australian Catholic University] at 07:26 15 September 2017
100 U/mL penicillin and 100 μg/mL streptomycin (Gibco BRL, Gaithersburg, MD) in 5% CO2 incubator at 37 °C. The non-hematopoietic expansion medium was standardized and the culture conditions were optimized for a reproducible and reliable expansion of MSCs.7) ELFMF exposure procedure. To induce astrocytic differentiation of hBM-MSCs, we modified previously reported protocols.7,12) EMF was produced by making a vertical magnetic field with various parameters, as previously described (Supplemental Fig. 1).6,12) After 6 days, the control and experimental groups were subcultured to maintain their exponential growth, and the ELFMF-exposed group was moved into the ELFMF after 1 day. The cells were continuously exposed to a sinusoidal ELFMF (Bm = 1 mT; F = 50 Hz sinusoidal) for 12 days. The cells in the control group were grown in a separate incubator without ELFMF exposure. The ambient EMF was recorded as 10 ± 5 μT (Bac) and 40 ± 5 μT (Bdc), respectively.
Proliferation assay. The assay was carried out using a Cell Counting Kit-8 (CCK-8) in accordance with the manufacturer’s protocol to measure cell proliferation during the treatment period. Briefly, the cells were cultured and grown in 96-well microplates to a density of 1500/well and exposed to 50 Hz, 1 mT ELFMF for 12 days7) as previously described. CCK-8 reagent (10 μL) was added to each well and the cells were incubated for 2 h at 37 °C. The cell proliferation and cytotoxicity were assessed by measuring absorbance at 450 nm by a microplate reader. Each experiment was performed in triplicate for each condition. Cell viability assay. Cells were seeded into 96-well microplates and incubated in 5% CO2 incubator at 37 °C for 24 h. Nicotinamide (NAM) was added at concentrations of 0, 5, 25, 50, and 75 mM for 1 h. Then, CCK-8 reagent was added to each well and the cells were incubated for 2 h at 37 °C. Cytotoxicity was assessed by measuring the absorbance at 450 nm using a microplate reader. Measurement of ROS. To measure the generation of intracellular ROS, the peroxide-sensitive fluorescent probe 2′,7′-dichlorodihydrofluorescin diacetate (DCFDA, Sigma) was used. hBM-MSCs were grown in 96-well plates for 24 h. The cells were washed with PBS three times and treated with 20 μM DCFDA dissolved in PBS for 30 min at 37 °C. Subsequently, DCF fluorescence was detected using 490 nm excitation filter and 520 nm emission filter and measured using a victor3 Multi-label Plate Reader (Perkin Elmer, Boston, MA). Reverse transcription polymerase chain reaction. Reverse transcription polymerase chain reaction (RT-PCR) was performed as previously described.7) The target regions were amplified in 20 ml reaction
1357
volume using the conditions as mentioned in Table 1. All PCR experiments were conducted for 29–33 cycles. Western blot assay. Protein concentration was determined by the Bradford assay.13) Western blotting was performed according to previously established methods.14) For immunoblotting, equal amounts of protein (20 μg for SIRT1, TLE1, HES1, MASH1, and GAPDH) were loaded in each lane, separated using 12% (w/v) SDS-PAGE, and transferred onto nitrocellulose membranes (PALL Corporation, Ann Arbor, MI). The membranes were blocked with 5% skim milk in Tris-buffered saline and Tween 20 (TBST) for 1 h and incubated with primary antibodies for 16 h at 4 °C. After incubation, horseradish peroxidase (HRP)-conjugated secondary antibodies were added and incubated for 1 h at room temperature, and the bands were developed using ECL detection system (Millipore, MA) and LAS-3000 (Fujifilm, Tokyo, Japan). The following primary antibodies were used for analysis: SIRT1 (Santa Cruz, CA), TLE1 (Abcam, Cambridge, UK), HES1 (Abcam, Cambridge, UK), MASH1 (Abcam, Cambridge, UK), and GAPDH (Abcam, Cambridge, UK). Bands from western blot were scanned by a flatbed scanner, and digitalized with multi gauge v3.0 (Fujifilm, Tokyo, Japan). Statistical analysis. All experimental tests were performed in triplicate by using 3 independent observations per experiment. All experimental results were expressed as mean ± standard error of the mean (SEM). Student’s t-test or one-way analysis of variance (ANOVA) was used to determine the statistical significance (*p < 0.05; **p < 0.01; ***p < 0.001) of the results and to compare the means of the groups using the SPSS 12.0 statistical software package (SPSS, Chicago, IL).
Results ELFMFs inhibited cell proliferation and induced astrocytic differentiation of hBM-MSCs The proliferation of the hBM-MSCs was estimated using CCK-8. Fig. 1A indicated that cells in the ELFMF-exposed group showed decreased proliferation rate (−38.56%, p < 0.001) as compared to that of the control group. In addition, the effect of ELFMFs on the gene expression levels was confirmed. Fig. 1B revealed the expression of nestin, OCT3/4, and GFAP in ELFMF-exposed and control groups. The expression of nestin (−0.62, p < 0.001) and OCT3/4 (−0.41, p < 0.001) was significantly decreased and that of GFAP (+0.47, p < 0.001) was significantly increased in the ELFMF-exposed group as compared to that in the control group. Therefore, these data indicated that ELFMF inhibited cell proliferation and induced astrocytic differentiation. ELFMF induces increase in intracellular ROS level ELFEF exposure is known to induce mild stress on hBM-MSCs.8) To confirm the increase in intracellular
1358
Downloaded by [Australian Catholic University] at 07:26 15 September 2017
Table 1.
W.-Y. Jeong et al. Primer sequences, expected size of PCR products, and annealing temperatures for RT-PCR analysis.
Gene
Forward primer
Reverse primer
GFAP Nestin SIRTI OCT3/4 GAPDH
ACTTTGCTCGTGCCTCAGTT TGGCTCAGAGGAAGAGTCTGA CTTTTTGGCTGTCCCGTTGG GTATTCAGCCAAACGACCATC AATGGGCAGCCGTTAGGAAA
GGATGTATCCATGGGGGCAG TCCCCCATTTACATGCTGTGA ACCATTACCGCACAAGAGCA CTGGTTCGCTTTCTCTTTCG AGGAAAAGCATCACCCGGAG
Size (bp) 282 169 279 183 136
Fig. 1. The proliferation and astrocytic differentiation of hBM-MSCs during ELFMF exposure. Cells were cultured up to 12 days in DMEM-LG (with 10% FBS and 1% P/S) with or without ELFMF stimulation at 50 Hz, 1 mT. (A) Proliferative.
ROS level in hBM-MSCs due to ELFMF exposure, DCFDA, which is an ROS-detectable dye, was used. Fig. 2A indicated that the intracellular ROS level in the ELFMF-exposed group was significantly increased (+76%, p < 0.001) as compared to that in the control group. ELFMF increased SIRT1 expression and altered expression of SIRT1 downstream molecules The association between increased ROS level due to ELFMFs and expression of SIRT1 and SIRT1 downstream molecules, such as TLE1, HES1, and MASH1, was verified. Figure 2B indicated that SIRT1 expression was increased in ELFMF-exposed group as compared to that in the control group, both at the gene and protein levels. This increase affected the expression of SIRT1 downstream molecules. As shown in Fig. 3, TLE1
expression was significantly increased and MASH1 expression was significantly decreased in the ELFMFexposed group as compared to that in the control group. HES1 expression was unaltered in both the groups. SIRT1 inhibition significantly regulates astrocytic differentiation of hBM-MSCs NAM has been widely used to inhibit the functional SIRT1 activity. In this study, hBM-MSCs were treated with NAM at concentrations of 0, 5, 10, 25, 50, and 75 mM for 1 h, respectively. As shown in Fig. 4(A), NAM at 5 mM concentration exhibited less toxicity than that exhibited at other concentrations; therefore, 5 mM NAM was used in the following experiments. hBMMSCs were treated with 5 mM NAM for 1 h before ELFEF exposure. To evaluate the effect of NAM, SIRT1 expression at the gene and protein levels was measured
Downloaded by [Australian Catholic University] at 07:26 15 September 2017
Effect of Electromagnetic Fields on Neural Differentiation
1359
Fig. 2. ROS production and SIRT1 expression in hBM-MSCs during ELFMF exposure. (A) Intracellular ROS productions measured with DCF-DA solution. (B) SIRT1 activation was identified to RT-PCR and Western blot, respectively. Notes: The data represent the relative density normalized to GAPDH. Error bars represent mean ± SEM. *p < 0.05; **p < 0.01; ***p < 0.001.
Fig. 3. Expression of SIRT1 downstream candidates by ELFMF. (A) Western blot analysis of co-repressor TLE1, neural transcription factor HES1 and pro-neural gene MASH1. The intensity of the bands was normalized to GAPDH. Notes: Error bars represent mean ± SEM. *p < 0.05; **p < 0.01; ***p < 0.001.
using RT-PCR and western blotting, respectively (Fig. 4(B)). The gene and protein levels of SIRT1 were significantly upregulated in the ELFEF-exposed group, while they were significantly downregulated in the
NAM-treated ELFMF-exposed group. After treatment of hBM-MSCs with NAM, RT-PCR analysis was conducted to examine the effects of SIRT1 inhibition on ELFEF-induced astrocytic differentiation.
Downloaded by [Australian Catholic University] at 07:26 15 September 2017
1360
W.-Y. Jeong et al.
Fig. 4. SIRT1 inhibition by NAM. (A) Cell viability of various NAM concentrations was measured through a CCK assay. (B) SIRT1 inhibition was identified to RT-PCR and Western blot, respectively. (C) The mRNA expressions of proneural marker; nestin, stemness markers; OCT3/4 and astrocytic marker; GFAP were determined using RT-PCR. Notes: The data represent the relative density normalized to GAPDH. The error bars represent the mean ± SEM. *p < 0.05; **p < 0.01; ***p < 0.001.
Fig. 5. Expression of SIRT1 downstream candidates by NAM. (A) Western blot analysis of co-repressor TLE1, neural transcription factor HES1 and pro-neural gene MASH1. (B) The intensity of the bands was normalized to GAPDH. Notes: Error bars represent mean ± SEM. *p < 0.05; **p < 0.01; ***p < 0.001.
The astrocyte-specific and stemness markers were differently expressed at the transcriptional level in NAM-treated and untreated cells (Fig. 4(C)). The expression of nestin and OCT 3/4 increased and that of the astrocyte marker, GFAP, decreased in the NAMtreated ELFMF-exposed group as compared to that in the ELFMF-exposed group.
Fig. 6. Schematic of ELFMF effected molecules. Oxidative conditions are triggered by increased ROS due to ELFMF exposure. Under oxidative conditions, SIRT1 binds to HES1 to form a complex which bind with TEL1. It causes inhibition of MASH1 expression. This event leads fate of hBM-MSCs to astrocyte.
Downstream targets of SIRT1 are differentially expressed during astrocytic differentiation To confirm the involvement of SIRT1-related proteins, TLE1, HES1, and MASH1, in astrocytic differentiation, western blot analysis was performed to determine their levels in control, ELFMF-exposed, and NAM-treated ELFMF-exposed groups. TLE1 and MASH1 were differentially expressed in the control and ELFMF-exposed cells (Fig. 5); TLE1 was
Effect of Electromagnetic Fields on Neural Differentiation
upregulated, whereas MASH1 was downregulated in the ELFMF-exposed group. TLE1 expression was significantly downregulated and MASH1 expression was significantly upregulated in the NAM-treated ELFMFexposed group than in the ELFMF-exposed group. However, HES1 expression remained unaltered in both the groups.
Downloaded by [Australian Catholic University] at 07:26 15 September 2017
Discussion In our previous studies, we observed that exposure to 50 Hz, 1 mT of ELFMF for 12 days induced neural differentiation of hBM-MSCs. The wavelength between 0 and 1000 Hz constitutes ELFMFs. Notably, neurological studies have reported that 50 Hz wavelength affects nerves and neuronal cells.7,15−17) ELFMF-exposed hBM-MSCs became morphologically more similar to neuron-like cells, and showed increased expression of specific neural markers at 12 days.7,18) Furthermore, to determine the effects of ELFMF-induced neural differentiation at the cellular level, proteomics analysis was performed. The results indicated that upregulated ferritin promotes neural differentiation of hBM-MSCs through regulation of actin reorganization, particularly by regulation of cofilin activity. Additionally, this study was focused on the role of SIRT1 in ELFMF-induced astrocytic differentiation and suggests the mechanism underlying astrocytic differentiation of hBM-MSCs. The expression levels of the astrocytic marker (GFAP), pro-neural marker (Nestin), and stemness marker (OCT3/4) were measured by RTPCR analysis. Additionally, to identify ELFMF-induced ROS generation and SIRT1 activation, DCF method, RT-PCR, and western blotting were performed. We hypothesized that SIRT1 plays an important role in differentiating hBM-MSCs into astrocytes. To confirm this hypothesis, hBM-MSCs were treated with NAM to inhibit SIRT1. Deacetylation of SIRT1 is catalyzed by NAD+. NAM acts as a non-competitive inhibitor of SITR1 by binding to NAD+. This binding prevents NAD+ hydrolysis.19) SIRT1 inhibition significantly reversed the expression of astrocytic, pro-neural, and stemness markers at the mRNA level. This result demonstrated that SIRT1 plays an important role in astrocytic differentiation induced by ELFMF exposure. To investigate the mechanism of SIRT1 related to astrocytic differentiation, SIRT1 downstream molecules, HES1, TLE1, and MASH1, were targeted. After ELFMF exposure, the expression of each downstream candidate was also altered. TLE1 expression was upregulated and MASH1 expression was downregulated in the ELFMF-exposed group as compared to the control group. However, HES1 expression was unaltered in both the groups. When SIRT1 inhibition was induced by NAM, TLE1 expression decreased and MASH1 expression was further downregulated in the NAM-treated ELFMF-exposed group as compared to the ELFMF-exposed group. However, HES1 expression was unaltered in both the groups. These results showed that the SIRT1 downstream molecules, HES1, TLE1,
1361
and MASH1, are specifically involved in ELFMFinduced astrocytic differentiation. Many studies have reported that ELFMFs can affect the brain development at the cellular level,20) but the underlying mechanism is largely unknown. Recent studies demonstrated that ELFMF exposure may alter the cellular processes by increasing intracellular ROS concentration.8) Our results indicated that ELFMF exposure induces ROS production and SIRT1 overexpression in hBM-MSCs. Recent studies have indicated that SIRT1 influences fate determination of NPCs during development.21) SIRT1 activity is affected by redox state and oxidative stress; downregulation of SIRT1 and promotion of the expression of pro-neuronal transcription factor, MASH1, at the gene level partially stimulates differentiation of NPCs into the astroglial lineage.11) Several authors suggest that SIRT1 inhibition or silencing leads to neuronal differentiation.11,22) SIRT1 may play a role in redox modulation because NAD+ regulates its activity. Therefore, it is sensitive towards the redox state and cellular metabolism. Recent research has shown that SIRT1 is linked to neurogenesis, which can mediate cellular responses to alter the redox state in several different cell types.23) Redox state influences the fate of NPCs in vitro; oxidizing conditions favor astrocytic differentiation, while reducing conditions favor neuron formation.11) Under oxidizing conditions, SIRT1 and HES1 form a complex that binds to the MASH1 promoter and deacetylates histones at its promoter while recruiting TLE1 as a co-repressor. This event causes low expression of MASH1 and blockage of neuronal differentiation.23) When SIRT1 was inhibited, SIRT1, HES1, and TEL1 complex was not formed. Thus, the MASH1 promoter was activated and NPCs were differentiated into neurons. Conversely, when SIRT1 was activated, SIRT1, HES1, and TEL1 formed a complex to inhibit the activity of MASH1, which induced astrocytic differentiation.11) Our results indicated that oxidative conditions, such as ROS production, due to ELFMF exposure repressed MASH1 expression in hBM-MSCs and suggested that the repression of MASH1 was mediated by the complex of HES1 and SIRT1 (Fig. 6). In conclusion, 50 Hz ELFMF induces ROS concentration in hBM-MSCs, and under oxidative stress conditions, upregulated SIRT1 promotes astrocytic differentiation of hBM-MSCs through regulation of HES1 and MASH1. This approach would be powerful to investigate the scientific clues and mechanisms underlying the effect of ELFMFs. Further studies are required to identify the involvement and effectiveness of SIRT1 in targeted functional researches.
Author contributions WYJ designed the study and wrote the manuscript. HJK and CWK contributed to the development of the manuscript. WYJ and JBK carried out the experiments and analyzed the data. All authors have read and approved the final manuscript.
1362
W.-Y. Jeong et al.
Acknowledgments I thank all my research collaborators and the members of the Laboratory of Bio Pharmaceutical Processes department of Life Sciences and Biotechnology at Korea University for their help and technical support.
Disclosure statement No potential conflict of interest was reported by the authors.
Downloaded by [Australian Catholic University] at 07:26 15 September 2017
Funding This work was supported by Korea University; Research Program of the National Research Foundation of Korea; Ministry of Education, Science, and Technology [grant number 2009-0082946]; School of Life Sciences and Biotechnology, Korea University Grant and BK21 Plus Program.
Supplemental material The supplemental material for this paper is available at http://dx.doi.org/10.1080/09168451.2017.1308243
References [1] Long X, Olszewski M, Huang W, et al. Neural cell differentiation in vitro from adult human bone marrow mesenchymal stem cells. Stem Cells Dev. 2005;14:65–69. [2] Sanchez-Ramos J, Song S, Cardozo-Pelaez F, et al. Adult bone marrow stromal cells differentiate into neural cells in vitro. Exp Neurol. 2000;164:247–256. [3] Jiang Y, Jahagirdar BN, Reinhardt RL, et al. Pluripotency of mesenchymal stem cells derived from adult marrow. Nature. 2002;418:41–49. [4] Bertani N, Malatesta P, Volpi G, et al. Neurogenic potential of human mesenchymal stem cells revisited: analysis by immunostaining, time-lapse video and microarray. J Cell Sci. 2005;118: 3925–3936. [5] Burdon TJ, Paul A, Noiseux N, et al. Bone marrow stem cell derived paracrine factors for regenerative medicine: current perspectives and therapeutic potential. Bone Marrow Res. 2011; 2011:207–326. [6] Cho H, Seo YK, Yoon HH, et al. Neural stimulation on human bone marrow-derived mesenchymal stem cells by extremely low frequency electromagnetic fields. Biotechnol Prog. 2012;28: 1329–1335. [7] Kim HJ, Jung J, Park JH, et al. Extremely low-frequency electromagnetic fields induce neural differentiation in bone marrow derived mesenchymal stem cells. Exp Biol Med (Maywood). 2013;238:923–931.
[8] Park JE, Seo YK, Yoon HH, et al. Electromagnetic fields induce neural differentiation of human bone marrow derived mesenchymal stem cells via ROS mediated EGFR activation. Neurochem Int. 2013;62:418–424. [9] Salminen A, Kaarniranta K, Kauppinen A. Crosstalk between oxidative stress and SIRT1: impact on the aging process. Int J Mol Sci. 2013;14:3834–3859. [10] Hisahara S, Chiba S, Matsumoto H, et al. Histone deacetylase SIRT1 modulates neuronal differentiation by its nuclear translocation. Proc Natl Acad Sci USA. 2008;105:15599–15604. [11] Prozorovski T, Schulze-Topphoff U, Glumm R, et al. Sirt1 contributes critically to the redox-dependent fate of neural progenitors. Nat Cell Biol. 2008;10:385–394. [12] Jung IS, Kim HJ, Noh R, et al. Effects of extremely low frequency magnetic fields on NGF induced neuronal differentiation of PC12 cells. Bioelectromagnetics. 2014;35:459–469. [13] Noble JE, Bailey MJ. Quantitation of protein. Methods Enzymol. 2009;463:73–95. [14] Kim SH, Jang YW, Hwang P, et al. The reno-protective effect of a phosphoinositide 3-kinase inhibitor wortmannin on streptozotocin-induced proteinuric renal disease rats. Exp Mol Med. 2012;44:45–51. [15] Grassi C, D’Ascenzo M, Torsello A, et al. Effects of 50 Hz electromagnetic fields on voltage-gated Ca2+ channels and their role in modulation of neuroendocrine cell proliferation and death. Cell Calcium. 2004;35:307–315. [16] Lisi A, Ciotti MT, Ledda M, et al. Exposure to 50 Hz electromagnetic radiation promote early maturation and differentiation in newborn rat cerebellar granule neurons. J Cell Physiol. 2005;204:532–538. [17] Cuccurazzu B, Leone L, Podda MV, et al. Exposure to extremely low-frequency (50 Hz) electromagnetic fields enhances adult hippocampal neurogenesis in C57BL/6 mice. Exp Neurol. 2010;226:173–182. [18] Lee HN, Ko KN, Kim HJ, et al. Ferritin is associated with neural differentiation of bone marrow-derived mesenchymal stem cells under extremely low-frequency electromagnetic field. Cell Mol Biol (Noisy-le-grand). 2015;61:55-59. [19] Bitterman kJ, Anderson RM, Cohen HY, et al. Inhibition of silencing and accelerated aging by nicotinamide, a putative negative regulator of yeast Sir2 and human SIRT1. J Biol Chem. 2002;277:45099–45107. [20] Ma Q, Deng P, Zhu G, et al. Extremely low-frequency electromagnetic fields affect transcript levels of neuronal differentiation-related genes in embryonic neural stem cells. PLoS ONE. 2014;9:e90041. [21] Cai Y, Xu L, Xu H, et al. SIRT1 and neural cell fate determination. Mol Neurobiol. 2016;53:2815–2825. [22] Zhang Y, Wang J, Chen G, et al. Inhibition of SIRT1 promotes neural progenitors toward motoneuron differentiation from human embryonic stem cells. Biochem Biophys Res Commun. 2011;404:610–614. [23] Liu DJ, Hammer D, Komlos D, et al. SIRT1 knockdown promotes neural differentiation and attenuates the heat shock response. J Cell Physiol. 2014;229:1224–1235.
ISSN: 0916-8451 (Print) 1347-6947 (Online) Journal homepage: http://www.tandfonline.com/loi/tbbb20
Extremely low-frequency electromagnetic field promotes astrocytic differentiation of human bone marrow mesenchymal stem cells by modulating SIRT1 expression Won-Yong Jeong, Jun-Beom Kim, Hyun-Jung Kim & Chan-Wha Kim To cite this article: Won-Yong Jeong, Jun-Beom Kim, Hyun-Jung Kim & Chan-Wha Kim (2017) Extremely low-frequency electromagnetic field promotes astrocytic differentiation of human bone marrow mesenchymal stem cells by modulating SIRT1 expression, Bioscience, Biotechnology, and Biochemistry, 81:7, 1356-1362, DOI: 10.1080/09168451.2017.1308243 To link to this article: http://dx.doi.org/10.1080/09168451.2017.1308243
View supplementary material
Published online: 29 Mar 2017.
Submit your article to this journal
Article views: 113
View related articles
View Crossmark data
Citing articles: 1 View citing articles
Full Terms & Conditions of access and use can be found at http://www.tandfonline.com/action/journalInformation?journalCode=tbbb20 Download by: [Australian Catholic University]
Date: 15 September 2017, At: 07:26
Bioscience, Biotechnology, and Biochemistry, 2017 Vol. 81, No. 7, 1356–1362
Extremely low-frequency electromagnetic field promotes astrocytic differentiation of human bone marrow mesenchymal stem cells by modulating SIRT1 expression Won-Yong Jeong, Jun-Beom Kim, Hyun-Jung Kim and Chan-Wha Kim* College of Life Sciences and Biotechnology, Korea University, Seoul, Korea Received January 12, 2017; accepted March 3, 2017
Downloaded by [Australian Catholic University] at 07:26 15 September 2017
https://doi.org/10.1080/09168451.2017.1308243
It has been shown that extremely low-frequency electromagnetic fields (ELFMF) affect regulation of cell fate and differentiation. Thus, the aim of this study was to investigate the role of ELFMFs in the enhancement of astrocytic differentiation. ELFMF exposure reduced the rate of proliferation and enhanced astrocytic differentiation. The ELFMFtreated cells showed increased levels of the astrocyte marker (GFAP), while those of the early neuronal marker (Nestin) and stemness marker (OCT3/4) were downregulated. The reactive oxygen species (ROS) level was observed to be significantly elevated after ELFMF exposure, which strengthens the modulatory role of SIRT1 and SIRT1 downstream molecules (TLE1, HES1, and MASH1) during astrocytic differentiation. After nicotinamide (5 mM) mediated inhibition of SIRT1, levels of TLE1, HES1, and MASH1 were examined; TLE1 was significantly upregulated and MASH1 was downregulated. These results suggest that ELFMFs induce astrocytic differentiation through activation of SIRT1 and SIRT1 downstream molecules. Key words:
extremely low-frequency electromagnetic fields; hBM-MSCs; astrocytic differentiation; SIRT1; TLE1
Neural cell regeneration potentially benefits patients with degenerative diseases or injuries of the nervous system, such as Alzheimer’s disease (AD), Parkinson’s disease (PD), Huntington’s disease, spinal cord and brain trauma, brain tumors, or spinal cord injuries. Recently, there has been a lot of research on the possibility of generating neural cells from embryonic stem cells (ESCs), neural stem (NS) cells from the brain, and mesenchymal stem cells (MSCs) from adult bone marrow (BM).1) BM-MSCs can ultimately differentiate into osteoblasts, adipocytes, chondrocytes, myoblasts, and early
neural progenitor cells (NPCs). Generally, researchers use specific factors, such as growth factors, neurotrophins, and cytokines, or specific chemical compounds, such as β-mercaptoethanol, dimethyl sulfoxide (DMSO), and butylated hydroxyanizole (BHA), to induce differentiation of BM-MSCs into neural cells.2−4) However, specific factors have disadvantages, such as restricted sources, high cost, risk of rejection, and disease propagation. Additionally, specific chemical compounds have disadvantages, such as reduced viability of MSCs and difficulty of acquiring functional neurons.5) Therefore, researchers are making efforts to find a more affordable and efficient way to differentiate MSCs into neural cells. Previously, we reported that extremely low-frequency electromagnetic fields (ELFMFs) induce neural differentiation of human BM-MSCs (hBM-MSCs).6,7) One of the neural differentiation mechanisms is related to reactive oxygen species (ROS) generated by ELFMFs. ROS have been known to be significant chemical mediators, regulating signal transduction processes related to cell growth and differentiation.8) High expression levels of ROS can directly or indirectly regulate the expression of sirtuin1 (SIRT1).9) SIRT1 is an NAD+-dependent class III histone deacetylase (HADC) that deacetylates histones and transcription factors.10) Under oxidative conditions, SIRT1 expression is upregulated in NPCs. Subsequently, SIRT1 binds to the transcription factor Hairy/enhancer of split 1 (Hes1) and inhibits Mash1 expression.11) Therefore, in this study, we investigated the involvement of ELFMF-induced activation of SIRT1 and SIRT1 downstream molecules in MSC differentiation.
Materials and methods Cell culture. hBM-MSCs (PT-2501, Walkersville Inc, MD) were thawed and maintained in culture in non-hematopoietic expansion medium (Miltenyi Biotec, Bergisch Gladbach, Germany) supplemented with
*Corresponding author. Email: [email protected] Abbreviations: AD, Alzheimer’s disease; hBM-MSC, human bone marrow-derived mesenchymal stem cell; ELFMF, extremely low-frequency electromagnetic field; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; FBS, fetal bovine serum; HES1, hairy and enhancer of split1; NPC, neural progenitor cell; PD, Parkinson’s disease; ROS, reactive oxygen species; SIRT1, sirtuin1; TLE1, transducin-like enhancer protein1. © 2017 Japan Society for Bioscience, Biotechnology, and Agrochemistry
Effect of Electromagnetic Fields on Neural Differentiation
Downloaded by [Australian Catholic University] at 07:26 15 September 2017
100 U/mL penicillin and 100 μg/mL streptomycin (Gibco BRL, Gaithersburg, MD) in 5% CO2 incubator at 37 °C. The non-hematopoietic expansion medium was standardized and the culture conditions were optimized for a reproducible and reliable expansion of MSCs.7) ELFMF exposure procedure. To induce astrocytic differentiation of hBM-MSCs, we modified previously reported protocols.7,12) EMF was produced by making a vertical magnetic field with various parameters, as previously described (Supplemental Fig. 1).6,12) After 6 days, the control and experimental groups were subcultured to maintain their exponential growth, and the ELFMF-exposed group was moved into the ELFMF after 1 day. The cells were continuously exposed to a sinusoidal ELFMF (Bm = 1 mT; F = 50 Hz sinusoidal) for 12 days. The cells in the control group were grown in a separate incubator without ELFMF exposure. The ambient EMF was recorded as 10 ± 5 μT (Bac) and 40 ± 5 μT (Bdc), respectively.
Proliferation assay. The assay was carried out using a Cell Counting Kit-8 (CCK-8) in accordance with the manufacturer’s protocol to measure cell proliferation during the treatment period. Briefly, the cells were cultured and grown in 96-well microplates to a density of 1500/well and exposed to 50 Hz, 1 mT ELFMF for 12 days7) as previously described. CCK-8 reagent (10 μL) was added to each well and the cells were incubated for 2 h at 37 °C. The cell proliferation and cytotoxicity were assessed by measuring absorbance at 450 nm by a microplate reader. Each experiment was performed in triplicate for each condition. Cell viability assay. Cells were seeded into 96-well microplates and incubated in 5% CO2 incubator at 37 °C for 24 h. Nicotinamide (NAM) was added at concentrations of 0, 5, 25, 50, and 75 mM for 1 h. Then, CCK-8 reagent was added to each well and the cells were incubated for 2 h at 37 °C. Cytotoxicity was assessed by measuring the absorbance at 450 nm using a microplate reader. Measurement of ROS. To measure the generation of intracellular ROS, the peroxide-sensitive fluorescent probe 2′,7′-dichlorodihydrofluorescin diacetate (DCFDA, Sigma) was used. hBM-MSCs were grown in 96-well plates for 24 h. The cells were washed with PBS three times and treated with 20 μM DCFDA dissolved in PBS for 30 min at 37 °C. Subsequently, DCF fluorescence was detected using 490 nm excitation filter and 520 nm emission filter and measured using a victor3 Multi-label Plate Reader (Perkin Elmer, Boston, MA). Reverse transcription polymerase chain reaction. Reverse transcription polymerase chain reaction (RT-PCR) was performed as previously described.7) The target regions were amplified in 20 ml reaction
1357
volume using the conditions as mentioned in Table 1. All PCR experiments were conducted for 29–33 cycles. Western blot assay. Protein concentration was determined by the Bradford assay.13) Western blotting was performed according to previously established methods.14) For immunoblotting, equal amounts of protein (20 μg for SIRT1, TLE1, HES1, MASH1, and GAPDH) were loaded in each lane, separated using 12% (w/v) SDS-PAGE, and transferred onto nitrocellulose membranes (PALL Corporation, Ann Arbor, MI). The membranes were blocked with 5% skim milk in Tris-buffered saline and Tween 20 (TBST) for 1 h and incubated with primary antibodies for 16 h at 4 °C. After incubation, horseradish peroxidase (HRP)-conjugated secondary antibodies were added and incubated for 1 h at room temperature, and the bands were developed using ECL detection system (Millipore, MA) and LAS-3000 (Fujifilm, Tokyo, Japan). The following primary antibodies were used for analysis: SIRT1 (Santa Cruz, CA), TLE1 (Abcam, Cambridge, UK), HES1 (Abcam, Cambridge, UK), MASH1 (Abcam, Cambridge, UK), and GAPDH (Abcam, Cambridge, UK). Bands from western blot were scanned by a flatbed scanner, and digitalized with multi gauge v3.0 (Fujifilm, Tokyo, Japan). Statistical analysis. All experimental tests were performed in triplicate by using 3 independent observations per experiment. All experimental results were expressed as mean ± standard error of the mean (SEM). Student’s t-test or one-way analysis of variance (ANOVA) was used to determine the statistical significance (*p < 0.05; **p < 0.01; ***p < 0.001) of the results and to compare the means of the groups using the SPSS 12.0 statistical software package (SPSS, Chicago, IL).
Results ELFMFs inhibited cell proliferation and induced astrocytic differentiation of hBM-MSCs The proliferation of the hBM-MSCs was estimated using CCK-8. Fig. 1A indicated that cells in the ELFMF-exposed group showed decreased proliferation rate (−38.56%, p < 0.001) as compared to that of the control group. In addition, the effect of ELFMFs on the gene expression levels was confirmed. Fig. 1B revealed the expression of nestin, OCT3/4, and GFAP in ELFMF-exposed and control groups. The expression of nestin (−0.62, p < 0.001) and OCT3/4 (−0.41, p < 0.001) was significantly decreased and that of GFAP (+0.47, p < 0.001) was significantly increased in the ELFMF-exposed group as compared to that in the control group. Therefore, these data indicated that ELFMF inhibited cell proliferation and induced astrocytic differentiation. ELFMF induces increase in intracellular ROS level ELFEF exposure is known to induce mild stress on hBM-MSCs.8) To confirm the increase in intracellular
1358
Downloaded by [Australian Catholic University] at 07:26 15 September 2017
Table 1.
W.-Y. Jeong et al. Primer sequences, expected size of PCR products, and annealing temperatures for RT-PCR analysis.
Gene
Forward primer
Reverse primer
GFAP Nestin SIRTI OCT3/4 GAPDH
ACTTTGCTCGTGCCTCAGTT TGGCTCAGAGGAAGAGTCTGA CTTTTTGGCTGTCCCGTTGG GTATTCAGCCAAACGACCATC AATGGGCAGCCGTTAGGAAA
GGATGTATCCATGGGGGCAG TCCCCCATTTACATGCTGTGA ACCATTACCGCACAAGAGCA CTGGTTCGCTTTCTCTTTCG AGGAAAAGCATCACCCGGAG
Size (bp) 282 169 279 183 136
Fig. 1. The proliferation and astrocytic differentiation of hBM-MSCs during ELFMF exposure. Cells were cultured up to 12 days in DMEM-LG (with 10% FBS and 1% P/S) with or without ELFMF stimulation at 50 Hz, 1 mT. (A) Proliferative.
ROS level in hBM-MSCs due to ELFMF exposure, DCFDA, which is an ROS-detectable dye, was used. Fig. 2A indicated that the intracellular ROS level in the ELFMF-exposed group was significantly increased (+76%, p < 0.001) as compared to that in the control group. ELFMF increased SIRT1 expression and altered expression of SIRT1 downstream molecules The association between increased ROS level due to ELFMFs and expression of SIRT1 and SIRT1 downstream molecules, such as TLE1, HES1, and MASH1, was verified. Figure 2B indicated that SIRT1 expression was increased in ELFMF-exposed group as compared to that in the control group, both at the gene and protein levels. This increase affected the expression of SIRT1 downstream molecules. As shown in Fig. 3, TLE1
expression was significantly increased and MASH1 expression was significantly decreased in the ELFMFexposed group as compared to that in the control group. HES1 expression was unaltered in both the groups. SIRT1 inhibition significantly regulates astrocytic differentiation of hBM-MSCs NAM has been widely used to inhibit the functional SIRT1 activity. In this study, hBM-MSCs were treated with NAM at concentrations of 0, 5, 10, 25, 50, and 75 mM for 1 h, respectively. As shown in Fig. 4(A), NAM at 5 mM concentration exhibited less toxicity than that exhibited at other concentrations; therefore, 5 mM NAM was used in the following experiments. hBMMSCs were treated with 5 mM NAM for 1 h before ELFEF exposure. To evaluate the effect of NAM, SIRT1 expression at the gene and protein levels was measured
Downloaded by [Australian Catholic University] at 07:26 15 September 2017
Effect of Electromagnetic Fields on Neural Differentiation
1359
Fig. 2. ROS production and SIRT1 expression in hBM-MSCs during ELFMF exposure. (A) Intracellular ROS productions measured with DCF-DA solution. (B) SIRT1 activation was identified to RT-PCR and Western blot, respectively. Notes: The data represent the relative density normalized to GAPDH. Error bars represent mean ± SEM. *p < 0.05; **p < 0.01; ***p < 0.001.
Fig. 3. Expression of SIRT1 downstream candidates by ELFMF. (A) Western blot analysis of co-repressor TLE1, neural transcription factor HES1 and pro-neural gene MASH1. The intensity of the bands was normalized to GAPDH. Notes: Error bars represent mean ± SEM. *p < 0.05; **p < 0.01; ***p < 0.001.
using RT-PCR and western blotting, respectively (Fig. 4(B)). The gene and protein levels of SIRT1 were significantly upregulated in the ELFEF-exposed group, while they were significantly downregulated in the
NAM-treated ELFMF-exposed group. After treatment of hBM-MSCs with NAM, RT-PCR analysis was conducted to examine the effects of SIRT1 inhibition on ELFEF-induced astrocytic differentiation.
Downloaded by [Australian Catholic University] at 07:26 15 September 2017
1360
W.-Y. Jeong et al.
Fig. 4. SIRT1 inhibition by NAM. (A) Cell viability of various NAM concentrations was measured through a CCK assay. (B) SIRT1 inhibition was identified to RT-PCR and Western blot, respectively. (C) The mRNA expressions of proneural marker; nestin, stemness markers; OCT3/4 and astrocytic marker; GFAP were determined using RT-PCR. Notes: The data represent the relative density normalized to GAPDH. The error bars represent the mean ± SEM. *p < 0.05; **p < 0.01; ***p < 0.001.
Fig. 5. Expression of SIRT1 downstream candidates by NAM. (A) Western blot analysis of co-repressor TLE1, neural transcription factor HES1 and pro-neural gene MASH1. (B) The intensity of the bands was normalized to GAPDH. Notes: Error bars represent mean ± SEM. *p < 0.05; **p < 0.01; ***p < 0.001.
The astrocyte-specific and stemness markers were differently expressed at the transcriptional level in NAM-treated and untreated cells (Fig. 4(C)). The expression of nestin and OCT 3/4 increased and that of the astrocyte marker, GFAP, decreased in the NAMtreated ELFMF-exposed group as compared to that in the ELFMF-exposed group.
Fig. 6. Schematic of ELFMF effected molecules. Oxidative conditions are triggered by increased ROS due to ELFMF exposure. Under oxidative conditions, SIRT1 binds to HES1 to form a complex which bind with TEL1. It causes inhibition of MASH1 expression. This event leads fate of hBM-MSCs to astrocyte.
Downstream targets of SIRT1 are differentially expressed during astrocytic differentiation To confirm the involvement of SIRT1-related proteins, TLE1, HES1, and MASH1, in astrocytic differentiation, western blot analysis was performed to determine their levels in control, ELFMF-exposed, and NAM-treated ELFMF-exposed groups. TLE1 and MASH1 were differentially expressed in the control and ELFMF-exposed cells (Fig. 5); TLE1 was
Effect of Electromagnetic Fields on Neural Differentiation
upregulated, whereas MASH1 was downregulated in the ELFMF-exposed group. TLE1 expression was significantly downregulated and MASH1 expression was significantly upregulated in the NAM-treated ELFMFexposed group than in the ELFMF-exposed group. However, HES1 expression remained unaltered in both the groups.
Downloaded by [Australian Catholic University] at 07:26 15 September 2017
Discussion In our previous studies, we observed that exposure to 50 Hz, 1 mT of ELFMF for 12 days induced neural differentiation of hBM-MSCs. The wavelength between 0 and 1000 Hz constitutes ELFMFs. Notably, neurological studies have reported that 50 Hz wavelength affects nerves and neuronal cells.7,15−17) ELFMF-exposed hBM-MSCs became morphologically more similar to neuron-like cells, and showed increased expression of specific neural markers at 12 days.7,18) Furthermore, to determine the effects of ELFMF-induced neural differentiation at the cellular level, proteomics analysis was performed. The results indicated that upregulated ferritin promotes neural differentiation of hBM-MSCs through regulation of actin reorganization, particularly by regulation of cofilin activity. Additionally, this study was focused on the role of SIRT1 in ELFMF-induced astrocytic differentiation and suggests the mechanism underlying astrocytic differentiation of hBM-MSCs. The expression levels of the astrocytic marker (GFAP), pro-neural marker (Nestin), and stemness marker (OCT3/4) were measured by RTPCR analysis. Additionally, to identify ELFMF-induced ROS generation and SIRT1 activation, DCF method, RT-PCR, and western blotting were performed. We hypothesized that SIRT1 plays an important role in differentiating hBM-MSCs into astrocytes. To confirm this hypothesis, hBM-MSCs were treated with NAM to inhibit SIRT1. Deacetylation of SIRT1 is catalyzed by NAD+. NAM acts as a non-competitive inhibitor of SITR1 by binding to NAD+. This binding prevents NAD+ hydrolysis.19) SIRT1 inhibition significantly reversed the expression of astrocytic, pro-neural, and stemness markers at the mRNA level. This result demonstrated that SIRT1 plays an important role in astrocytic differentiation induced by ELFMF exposure. To investigate the mechanism of SIRT1 related to astrocytic differentiation, SIRT1 downstream molecules, HES1, TLE1, and MASH1, were targeted. After ELFMF exposure, the expression of each downstream candidate was also altered. TLE1 expression was upregulated and MASH1 expression was downregulated in the ELFMF-exposed group as compared to the control group. However, HES1 expression was unaltered in both the groups. When SIRT1 inhibition was induced by NAM, TLE1 expression decreased and MASH1 expression was further downregulated in the NAM-treated ELFMF-exposed group as compared to the ELFMF-exposed group. However, HES1 expression was unaltered in both the groups. These results showed that the SIRT1 downstream molecules, HES1, TLE1,
1361
and MASH1, are specifically involved in ELFMFinduced astrocytic differentiation. Many studies have reported that ELFMFs can affect the brain development at the cellular level,20) but the underlying mechanism is largely unknown. Recent studies demonstrated that ELFMF exposure may alter the cellular processes by increasing intracellular ROS concentration.8) Our results indicated that ELFMF exposure induces ROS production and SIRT1 overexpression in hBM-MSCs. Recent studies have indicated that SIRT1 influences fate determination of NPCs during development.21) SIRT1 activity is affected by redox state and oxidative stress; downregulation of SIRT1 and promotion of the expression of pro-neuronal transcription factor, MASH1, at the gene level partially stimulates differentiation of NPCs into the astroglial lineage.11) Several authors suggest that SIRT1 inhibition or silencing leads to neuronal differentiation.11,22) SIRT1 may play a role in redox modulation because NAD+ regulates its activity. Therefore, it is sensitive towards the redox state and cellular metabolism. Recent research has shown that SIRT1 is linked to neurogenesis, which can mediate cellular responses to alter the redox state in several different cell types.23) Redox state influences the fate of NPCs in vitro; oxidizing conditions favor astrocytic differentiation, while reducing conditions favor neuron formation.11) Under oxidizing conditions, SIRT1 and HES1 form a complex that binds to the MASH1 promoter and deacetylates histones at its promoter while recruiting TLE1 as a co-repressor. This event causes low expression of MASH1 and blockage of neuronal differentiation.23) When SIRT1 was inhibited, SIRT1, HES1, and TEL1 complex was not formed. Thus, the MASH1 promoter was activated and NPCs were differentiated into neurons. Conversely, when SIRT1 was activated, SIRT1, HES1, and TEL1 formed a complex to inhibit the activity of MASH1, which induced astrocytic differentiation.11) Our results indicated that oxidative conditions, such as ROS production, due to ELFMF exposure repressed MASH1 expression in hBM-MSCs and suggested that the repression of MASH1 was mediated by the complex of HES1 and SIRT1 (Fig. 6). In conclusion, 50 Hz ELFMF induces ROS concentration in hBM-MSCs, and under oxidative stress conditions, upregulated SIRT1 promotes astrocytic differentiation of hBM-MSCs through regulation of HES1 and MASH1. This approach would be powerful to investigate the scientific clues and mechanisms underlying the effect of ELFMFs. Further studies are required to identify the involvement and effectiveness of SIRT1 in targeted functional researches.
Author contributions WYJ designed the study and wrote the manuscript. HJK and CWK contributed to the development of the manuscript. WYJ and JBK carried out the experiments and analyzed the data. All authors have read and approved the final manuscript.
1362
W.-Y. Jeong et al.
Acknowledgments I thank all my research collaborators and the members of the Laboratory of Bio Pharmaceutical Processes department of Life Sciences and Biotechnology at Korea University for their help and technical support.
Disclosure statement No potential conflict of interest was reported by the authors.
Downloaded by [Australian Catholic University] at 07:26 15 September 2017
Funding This work was supported by Korea University; Research Program of the National Research Foundation of Korea; Ministry of Education, Science, and Technology [grant number 2009-0082946]; School of Life Sciences and Biotechnology, Korea University Grant and BK21 Plus Program.
Supplemental material The supplemental material for this paper is available at http://dx.doi.org/10.1080/09168451.2017.1308243
References [1] Long X, Olszewski M, Huang W, et al. Neural cell differentiation in vitro from adult human bone marrow mesenchymal stem cells. Stem Cells Dev. 2005;14:65–69. [2] Sanchez-Ramos J, Song S, Cardozo-Pelaez F, et al. Adult bone marrow stromal cells differentiate into neural cells in vitro. Exp Neurol. 2000;164:247–256. [3] Jiang Y, Jahagirdar BN, Reinhardt RL, et al. Pluripotency of mesenchymal stem cells derived from adult marrow. Nature. 2002;418:41–49. [4] Bertani N, Malatesta P, Volpi G, et al. Neurogenic potential of human mesenchymal stem cells revisited: analysis by immunostaining, time-lapse video and microarray. J Cell Sci. 2005;118: 3925–3936. [5] Burdon TJ, Paul A, Noiseux N, et al. Bone marrow stem cell derived paracrine factors for regenerative medicine: current perspectives and therapeutic potential. Bone Marrow Res. 2011; 2011:207–326. [6] Cho H, Seo YK, Yoon HH, et al. Neural stimulation on human bone marrow-derived mesenchymal stem cells by extremely low frequency electromagnetic fields. Biotechnol Prog. 2012;28: 1329–1335. [7] Kim HJ, Jung J, Park JH, et al. Extremely low-frequency electromagnetic fields induce neural differentiation in bone marrow derived mesenchymal stem cells. Exp Biol Med (Maywood). 2013;238:923–931.
[8] Park JE, Seo YK, Yoon HH, et al. Electromagnetic fields induce neural differentiation of human bone marrow derived mesenchymal stem cells via ROS mediated EGFR activation. Neurochem Int. 2013;62:418–424. [9] Salminen A, Kaarniranta K, Kauppinen A. Crosstalk between oxidative stress and SIRT1: impact on the aging process. Int J Mol Sci. 2013;14:3834–3859. [10] Hisahara S, Chiba S, Matsumoto H, et al. Histone deacetylase SIRT1 modulates neuronal differentiation by its nuclear translocation. Proc Natl Acad Sci USA. 2008;105:15599–15604. [11] Prozorovski T, Schulze-Topphoff U, Glumm R, et al. Sirt1 contributes critically to the redox-dependent fate of neural progenitors. Nat Cell Biol. 2008;10:385–394. [12] Jung IS, Kim HJ, Noh R, et al. Effects of extremely low frequency magnetic fields on NGF induced neuronal differentiation of PC12 cells. Bioelectromagnetics. 2014;35:459–469. [13] Noble JE, Bailey MJ. Quantitation of protein. Methods Enzymol. 2009;463:73–95. [14] Kim SH, Jang YW, Hwang P, et al. The reno-protective effect of a phosphoinositide 3-kinase inhibitor wortmannin on streptozotocin-induced proteinuric renal disease rats. Exp Mol Med. 2012;44:45–51. [15] Grassi C, D’Ascenzo M, Torsello A, et al. Effects of 50 Hz electromagnetic fields on voltage-gated Ca2+ channels and their role in modulation of neuroendocrine cell proliferation and death. Cell Calcium. 2004;35:307–315. [16] Lisi A, Ciotti MT, Ledda M, et al. Exposure to 50 Hz electromagnetic radiation promote early maturation and differentiation in newborn rat cerebellar granule neurons. J Cell Physiol. 2005;204:532–538. [17] Cuccurazzu B, Leone L, Podda MV, et al. Exposure to extremely low-frequency (50 Hz) electromagnetic fields enhances adult hippocampal neurogenesis in C57BL/6 mice. Exp Neurol. 2010;226:173–182. [18] Lee HN, Ko KN, Kim HJ, et al. Ferritin is associated with neural differentiation of bone marrow-derived mesenchymal stem cells under extremely low-frequency electromagnetic field. Cell Mol Biol (Noisy-le-grand). 2015;61:55-59. [19] Bitterman kJ, Anderson RM, Cohen HY, et al. Inhibition of silencing and accelerated aging by nicotinamide, a putative negative regulator of yeast Sir2 and human SIRT1. J Biol Chem. 2002;277:45099–45107. [20] Ma Q, Deng P, Zhu G, et al. Extremely low-frequency electromagnetic fields affect transcript levels of neuronal differentiation-related genes in embryonic neural stem cells. PLoS ONE. 2014;9:e90041. [21] Cai Y, Xu L, Xu H, et al. SIRT1 and neural cell fate determination. Mol Neurobiol. 2016;53:2815–2825. [22] Zhang Y, Wang J, Chen G, et al. Inhibition of SIRT1 promotes neural progenitors toward motoneuron differentiation from human embryonic stem cells. Biochem Biophys Res Commun. 2011;404:610–614. [23] Liu DJ, Hammer D, Komlos D, et al. SIRT1 knockdown promotes neural differentiation and attenuates the heat shock response. J Cell Physiol. 2014;229:1224–1235.
