Aquatic Toxicology 169 (2015) 69–78

Contents lists available at ScienceDirect

Aquatic Toxicology journal homepage: www.elsevier.com/locate/aquatox

External gamma irradiation-induced effects in early-life stages of zebrafish, Danio rerio B. Gagnaire a,∗ , I. Cavalié a , S. Pereira b , M. Floriani a , N. Dubourg a , V. Camilleri a , C. Adam-Guillermin a a b

Institut de Radioprotection et de Sureté Nucléaire (IRSN), PRP-ENV/SERIS/LECO, Cadarache, Saint-Paul-lez-Durance 13115, France Neolys Diagnostics, Lyon 69373, France

a r t i c l e

i n f o

Article history: Received 26 June 2015 Received in revised form 4 September 2015 Accepted 7 October 2015 Available online 23 October 2015 Keywords: Gamma irradiation Zebrafish Danio rerio Embryo-larval development Biomarkers Gene expression Transmission electron microscopy

a b s t r a c t In the general context of validation of tools useful for the characterization of ecological risk linked to ionizing radiation, the effects of an external gamma irradiation were studied in zebrafish larvae irradiated for 96 h with two dose rates: 0.8 mGy/d, which is close to the level recommended to protect ecosystems from adverse effects of ionizing radiation (0.24 mGy/d) and a higher dose rate of 570 mGy/d. Several endpoints were investigated, such as mortality, hatching, and some parameters of embryo-larval development, immunotoxicity, apoptosis, genotoxicity, neurotoxicity and histological alterations. Results showed that an exposure to gamma rays induced an acceleration of hatching for both doses and a decrease of yolk bag diameter for the highest dose, which could indicate an increase of global metabolism. AChE activity decreased with the low dose rate of gamma irradiation and alterations were also shown in muscles of irradiated larvae. These results suggest that gamma irradiation can induce damages on larval neurotransmission, which could have repercussions on locomotion. DNA damages, basal ROS production and apoptosis were also induced by irradiation, while ROS stimulation index and EROD biotransformation activity were decreased and gene expression of acetylcholinesterase, choline acetyltransferase, cytochrome p450 and myeloperoxidase increased. These results showed that ionizing radiation induced an oxidative stress conducting to DNA damages. This study characterized further the modes of action of ionizing radiation in fish. © 2015 Elsevier B.V. All rights reserved.

1. Introduction The protection of the environment in the context of global change and sustainable management of resources and ecosystems is one of the priority aims of the European Commission. Environmental pollution is a major problem for human, animal and vegetal populations living in these receptor environments (Galloway and Depledge, 2001). In the context of chronic exposure of ecosystems to low contaminant levels (e.g. routine industrial disposal) or in the context of prospective evaluation of potential contamination, methods of environmental risk assessment have been developed for chemical contaminants. Among the different pollutants, radioactive compounds can be found naturally (e.g. uranium isotopes) but artificial radionuclides can also be released by human activities (normal functioning conditions of nuclear fuel cycle installations, controlled wastes from industrial and nuclear medicine activities, nuclear waste storage

∗ Corresponding author. Fax: +33 4 42 19 91 51. E-mail address: [email protected] (B. Gagnaire). http://dx.doi.org/10.1016/j.aquatox.2015.10.005 0166-445X/© 2015 Elsevier B.V. All rights reserved.

sites, deposits from nuclear tests, Chernobyl and Fukushima accidents) (UNSCEAR, 1996). For chemical pollutants, the biological effects are generally assessed regarding the absorbed concentration. In the case of ionizing radiation, the dose is linked to the energy absorbed in the body of living organisms. The radiation dose to an organism is the total quantity of energy absorbed from ionizing radiation per unit mass of tissue (1 Gy = 1 J/kg of tissues), and the dose rate refers to the energy absorbed over time (e.g. ␮Gy/h). It has been proposed that ecological risk assessment approaches developed for non-radioactive contaminants could be applied to the protection of the environment from ionizing radiation (GarnierLaplace et al., 2006). The IAEA (1992) suggested, as a general guideline, that a dose rate of 10 mGy/d can be considered as the upper limit an individual can be exposed to ensure adequate protection to populations of freshwater organisms. More recent studies, based on statistical extrapolation models, proposed an ecosystem screening benchmark (HDR5 , Hazard Dose Rate corresponding to 5% of species affected at the 50% effect level) of 0.24 mGy/d for the protection of freshwater ecosystems from radioactive substances (Garnier-Laplace et al., 2010). However, there is a lack of data on biological effects induced by chronic low levels of exposure.

70

B. Gagnaire et al. / Aquatic Toxicology 169 (2015) 69–78

Ecotoxicity of ionizing radiation has indeed not been extensively studied, particularly for aquatic vertebrates such as fish. Information regarding mechanisms of toxicity, early and sub-lethal effects of ionizing radiation exposure in freshwater fish is scarce (AdamGuillermin et al., 2012). Better knowledge of interactions between these pollutants and living organisms at environmentally relevant doses is therefore needed to predict the possible consequences of exposure to them. Although DNA lesions constitute major damages caused by ionizing radiation on cells and individuals, effects other than genotoxicity have been observed in organisms exposed to ionizing radiation induced by tritium or gamma emitters (Adam-Guillermin et al., 2012). Disruption of immune response and anti-inflammatory mechanisms (Strand et al., 1982) and hormonal effects (Erickson, 1971) have been observed. Tritiated thymidine can also induce neurotoxic effects (Adam-Guillermin et al., unpublished data). Defense from oxidative stress, detoxification and general metabolism can therefore be compromised. These various effects can have consequences on survival (particularly for early life stages), development, fecundity and behavior of organisms. More generally, the ability of organisms to develop responses adapted to their environment can be altered. In this context, the present study aims to improve knowledge on effects and mechanisms of action of ionizing radiation on physiology of fish in the case of chronic contaminations at low and high doses. Fish are indeed relevant sentinels for the detection of environmental hazards and, as efficient and cost-effective model systems, they have been used for mechanistic toxicology and environmental risk assessment studies for several years (van der Oost et al., 2003). Among them, zebrafish, Danio rerio, with its entirely sequenced genome, has been widely used as a model organism in ecotoxicological studies due to its small size that minimizes the cost and waste volume of toxicants (Hill et al., 2005). Moreover, the use of early life stages of zebrafish, considered to be the most toxicant-sensitive in the animal’s life cycle (Scholz et al., 2008), has been proposed as a relevant experimental bioassay to assess toxic effects of contaminants (Oberemm, 2000; OECD, 2004a,b). In the present study, experiments were conducted on zebrafish in order to assess the effects of gamma rays on larvae. Freshly spawned eggs were irradiated for 4 days at dose rates of 0, 0.8 and 570 mGy/d. 0.8 mGy/j is referred as the low dose as it is close to the environmental protection criterium of 0.24 mGy/d (Garnier-Laplace et al., 2010); 570 mGy/j is referred as the high dose. Irradiation of embryo-larvae was performed using indoor 137 Cs irradiators. At the end of egg irradiation, biomarkers related to defence system (reactive oxygen species (ROS) production, phenoloxidase-like (PO) activity, detoxification enzyme (EROD) activity), as described before (Gagnaire et al., 2013), were measured. Acetylcholinesterase (AChE) activity as well as DNA damages and apoptosis were also measured. Moreover, expression of genes involved in these mechanisms was also followed. Histology of tail muscle was also analysed. These early responses were related to endpoints measured on individual fish considered to be significant of the health of populations (mortality, developmental parameters and hatching success of embryos). 2. Material and methods 2.1. Chemicals The following chemicals were purchased from Sigma–Aldrich (St Quentin-Fallavier, France): bovine serum albumin (BSA, CAS 9048-46-8), Bradford reagent, 2 ,7 -dichlorofluorescin diacetate (H2 DCFDA, CAS 4091-99-0), 3,4-dihydroxy-l-phenylalanine (LDopa, CAS 59-92-7), dimethylsulfoxide (DMSO, CAS 67-68-5), ethoxyresorufin (CAS 5725-91-7), Hanks’ Balanced Salt solution

(HBSS), resorufin (CAS 635-78-9), 5,5 -dithiobis(2-nitrobenzoic acid) (DTNB, CAS 69-78-3), acetylthiocholine iodide (ATCi, CAS 1866-15-5), Hepes (CAS 7365-45-9), trypan blue (CAS 72-57-1), acridine orange (CAS 65-61-2), ultrapure water (CAS 7732-185), sodium cacodylate (CAS 6131-99-3), glutaraldhehyde (CAS 111-30-8), osmium tetroxide (CAS 20816-12-0), toluidine blue (CAS 6586-04-5). 4␣-phorbol 12-myristate 13-acetate (PMA, CAS 63597-44-4) was purchased from Molecular Probes (Invitrogen, Cergy-Pontoise, France).

2.2. Egg production All experimental procedures were approved by the Animal Care Committee of the Institute of Radioprotection and Nuclear Safety (IRSN) and complied with French regulations for animal experimentation (registration number of IRSN laboratory: A13-013-07, protocol: P2013-21). The eggs were produced using 20 6-months old couples (GIS Amagen, Gif sur Yvette, France). Genitors were maintained in a Techniplast® rearing system (10 fish per tank) in a mix of half tap water and half osmosis water with a photoperiod of 14 h/10 h and a temperature of 28 ± 0.5 ◦ C. They were fed three times per day with Tetramin® fish food (Tetra, Melle, Germany). Embryos were obtained by mixing 5 males and 5 females in tanks (V = 25 L) at 30 ± 0.5 ◦ C equipped with a grid to avoid the predation of newly spawned eggs. Spawning was induced by light. The whole eggs spawned were pooled, counted and the malformed eggs were discarded; egg viability was confirmed when the blastula stage was reached at 3 hpf (hours post fertilization) without visible abnormalities. The brood was considered to be of good quality for the experiment when an egg viability of at least 80% was attained at 6 hpf.

2.3. Egg exposure to external gamma irradiation Twenty-five 3 hpf eggs were randomly distributed in 5 wells of a 25-well plate containing 2 mL of egg medium per well (Westerfield, 2007). Four plates were used for each dose and for control. The whole experimental units were placed in an incubator (temperature 28 ± 1 ◦ C, photoperiod 12 h/12 h). Eggs were exposed for 96 h to gamma rays emitted by a liquid 137 Cs source in a polystyrene tube (20 MBq in HCl 0.1 M) or a solid 137 Cs line source (1.85 GBq). Dose rates of both sources were characterized using RPL glass dosimeter measurements (Chiyoada Technologies, Japan) at 0.8 and 570 mGy/d (Dubourg, pers. comm.).

2.4. Monitoring of embryo-larvae development Embryo-larvae mortality was monitored daily during the whole experiment. At 48 hpf, larvae started to hatch and were followed every day until 96 hpf. Hatching rate was calculated as the percentage of hatched egg reported to living eggs for a given sampling time. Hatching time 50% (HT50 ), which represents the time necessary for half of the eggs to hatch, was calculated by logistic curve-fitting procedure using REGTOX® (http://www.normalesup.org/∼vindimian/ fr index.html). Every 24 h, pictures for anterior–posterior length measurements and egg and yolk bag diameters were acquired according to the procedure of Fraysse et al. (2006). Pictures were taken using a binocular microscope (ZEISS SteREO Discovery V20, 103X for eggs and 73X for larvae) connected to a camera (Nikon D5000). Several parameters were measured using Image J software (Fig. 1).

B. Gagnaire et al. / Aquatic Toxicology 169 (2015) 69–78

71

Fig. 1. Image analysis in embryo (A): yolk bag diameter (A), egg diameter (B); image analysis in larva (B): total length (A), yolk bag diameter (B), eye diameter (C).

2.5. Alkaline comet assay The alkaline comet assay, detecting DNA strand breaks (singleand double-strand breaks, and alkali-labile sites), was applied according to the procedure of Devaux et al. (1998). Larvae were mechanically crushed (Potter–Elvehjem type apparatus, VWR, France) and isolated cells obtained according to Kosmehl et al. (2008) by filtering through a 60 ␮m mesh. After centrifugation (110 g, 10 min, 8 ◦ C), pellets were suspended in 1 mL of L15-HEPES and immediately used. Cells were counted on a Malassez cell and their viability was assessed using trypan blue. One hundred nucleoids per slide were analysed at ×400 magnification under a fluorescence microscope (Nikon Eclipse E600) equipped with a 515–560 nm excitation filter. Comet pictures were analysed using Comet IV software (Perceptive Instruments). This assay was done on three pools of ten 24 hpf eggs and on ten individual 96 hpf larvae. The Tail Moment was defined as the percentage of DNA in the tail multiplied by the length between the center of the head and tail (Olive et al., 1990). 2.6. Apoptosis measurement Apoptosis was measured on 24 hpf dechorionated eggs according to Tucker and Lardelli (2007). Eggs were placed in egg medium containing 2 ␮g/mL of acridine orange for 30 min in the dark at 28 ◦ C. Eggs were rinsed three times during 10 min. Pictures were obtained using a fluorescence microscope (Nikon Eclipse E600). 2.7. Measurement of immunotoxicity and neurotoxicity biomarkers PO-like activity, EROD activity and ROS production were measured in vivo on 96 hpf larvae as described before (Gagnaire et al., 2013). Briefly, larvae were placed in HBSS medium. For PO-like activity, 7–10 larvae per condition were placed individually in a 96 well microplate. Measurements were done after addition of substrate (L-Dopa) by following absorbance at 490 nm every 30 min during 15 h, one unit of enzyme (1 U) corresponding to an increase of 0.001 in absorbance per minute (Molecular Device SpectraMax Plus384). At the end of the incubation period, larvae were assessed alive (detection of movement). Values were expressed in U/larva. For ROS detection, 16–20 larvae per condition were placed individually in a 96-well microplate. H2 DCFDA was added to each well. In order to determine ROS production at basal and stimulated levels, half of the larvae received PMA and the other half DMSO. Fluorescence was followed every 2 min for 90 min (excitation 500 nm, emission 525 nm) (TECAN Infinite M1000). Results were expressed in ROS stimulation index (PMA/DMSO). For EROD activity, 4 pools of five larvae were constituted in a 25-well microplate. Ethoxyresorufin was added to 3 pools per condition, one other pool was the control. Every hour during 6 h after addition of substrate, 100 ␮L of each pool were transferred in a 96-well microplate and

fluorescence read (excitation 545 nm, emission 570–610 nm), which gave resorufin (RR) production, calibrated by a standard curve (TECAN Infinite M1000). Results were expressed in the amount of resorufin excreted per hour and per larva. AChE activity was measured on ten larvae per condition with a modified version of the protocol of Yen et al. (2011). Each larva was individually crushed in 500 ␮L of phosphate buffer. 120 ␮L was transferred in duplicates on a 96-well microplate, where 40 ␮L of chromogenic agent DTNB (4 mg/mL) and 40 ␮L of ATCi (75 mM) were added. Absorption of 2-nitro-5-thiobenzoate anion, formed in the reaction, was followed every minute at 412 nm during 15 min (Molecular Device SpectraMax Plus384). Protein concentrations were determined by Bradford technique (Bradford, 1976). Results were expressed in nmol ATCi/min/mg of protein. 2.8. Gene expression Total RNA was extracted from three pools of ten larvae per condition using the absolutely RNA Miniprep Kit and cDNA was synthetized using the AffinityScript QPCR cDNA synthesis kit (Stratagene, Agilent) from 30 ng of RNA according to the manufacturer instructions. A step of phenol/chloroform extraction was added in order to eliminate lipids and proteins before loading the homogenate on the RNA-linking column. cDNAs were stored at −20 ◦ C. RNA concentrations were measured using a NanoDrop (Thermo ScientificTM ). Several genes were followed by real-time PCR in order to study the transcriptional actions of irradiation. Genes were selected so that they were involved in different physiological processes: immune response (lysozyme C), oxidative stress (myeloid specific peroxidase), nervous system (acetylcholinesterase, choline acetyltransferase), detoxification (cytochrome P450CYP1A, glutathione-S-transferase, metallothionein) and apoptosis (bcl2associated X protein). A reference gene (elongation factor 1) was also followed (Table 1). The relative levels of gene transcripts in controls and irradiated larvae were investigated by real-time PCR using an Mx3000P (Stratagene, Agilent) on 96-well microplates. For each gene and each condition, 1 ␮L of cDNA sample was added to reaction mix composed of 10 ␮L Brillant III Ultra-Fast SYBR® Green QPCR Master Mix (Stratagene, Agilent), 2 ␮L reverse and forward primers diluted to 2 ␮M each, 0.3 ␮L of referent dye diluted at 0.2 ␮M (Stratagene, Agilent) and 6.3 ␮L of ultrapure water. All amplification reactions were done under the following cycling conditions: 1 cycle of pre-incubation at 95 ◦ C for 10 min, then 45 cycles of amplification at 95 ◦ C for 30 s, 60 ◦ C for 1 min and 72 ◦ C for 1 min and a final step for melting curve analysis at 95 ◦ C for 1 min, 60 ◦ C for 30 s and 95 ◦ C for 30 s. The specificity of PCR products was checked using the melting curves. All samples were analysed in triplicates. Each run included the cDNA control, negative controls (total RNA treated with DNase I) and blank controls (distilled water). For each gene, the threshold cycle Ct, corresponding to the number of

72

B. Gagnaire et al. / Aquatic Toxicology 169 (2015) 69–78

Table 1 List of studied genes and primer sequences. Abbreviation

GenBank number or reference

Name of gene

Forward primer sequence

Reverse primer sequence

ache bax chat cyp1a ef1 gstp1 lyz mpx mt2

NM 131846.1 AF231015.1 NM 001130719.1 Barros-Becker et al. (2012) NM 131263 201 NM 131734.3 NC 007135.5 NM 212779.1 NM 194273 50

Acetylcholinesterase bcl2-Associated X protein Choline acetyltransferase Cytochrome P450CYP1A Elongation factor1 Glutathione-S-transferase Lysozyme C Myeloid specific peroxidase Metallothionin

GTGGCAACTCGCATGGT GGCTATTTCAACCAGGGTTCC GGACTGCCATAAAAGCCCAA GCATTACGATACGTTCGATAAGGAC GTGCTGTGCTGATTGTTGCT CGGATTCCTGGTTGGCG GAATGAAGGGCTTGATGGAT TGAGAATGTGGACCCTACCA CCCATCTGGTTGCAGCAAGT

AGTGCGGGCGAAATTAGC TGCGAATCACCAATGCTGT TTGGGACGACTGGACCAT GCTCCGAATAGGTCATTGACGAT TGTATGCGCTGACTTCCTTG TGCCATTGATGGGCAGTTT TCTGGAAGATCCCGTAGTCC CTGGGAAACTGAGGATGGTT GAATTGCCTTTGCAGACGC

cycles at which the fluorescence emission monitored in real time exceeded the threshold limit and entered the exponential phase, was determined. The relative expression ratio of mRNA of every gene (irradiated/control) normalized by the reference gene was calculated using REST-384© version 2 software (Relative Expression Software Tool, http://www.gene-quantification.de/rest-384. html) (Pfaffl et al., 2002). The steady-state expression of the housekeeping gene ef1 was validated between the three conditions: Ct means ± SE for controls and irradiated larvae at 0.8 and 570 mGy/d were not different (19.66 ± 0.32, 19.34 ± 0.3 et 19.78 ± 0.21, respectively, p = 0,53). 2.9. Microscopical observations Three 96 hpf larvae for each condition were used for microscopical observations. Larvae were assessed to be alive and without abnormalities before processing. Each larva was individually fixed with 2.5% glutaraldehyde in 0.1 M sodium cacodylate buffer (pH 7.4) for 24 h at 4 ◦ C. Larvae were washed with the same buffer, then post-fixed with 1% osmium tetroxide in cacodylate buffer for 1 h, dehydrated in ethanol, and embedded in Epon 812. Sections for optical and electron microscopy, of 500 and 80 nm, respectively, were obtained using an ultramicrotome (UCT, Leica). Each larva was cut and photographed using optic microscope (DM750 Leica, equipped with a ICC50 camera and LAS EZ software) after toluidine blue coloration before performing the cuts of tail muscle for electron microscopy observations. For ultrastructural analysis, ultrathin sections were mounted on copper grids and examined in a Tecnai G2 Biotwin (FEI) electron microscope equipped with a CCD camera (Megaview III, Eloise) using an accelerating voltage of 100 keV. 2.10. Statistical analyses Results are expressed as means ± standard error (se). Normality assumption was checked through Shapiro–Wilk tests. When necessary, data were transformed using Boxcox to achieve normality. Differences between conditions were tested with t-tests or ANOVAs followed by an a posteriori least significant difference (LSD) posthoc test in the case of rejection of H0 . Kruskal–Wallis tests were used when data were not normal. Analyses were performed using STATISTICA Software version 10 (StatSoft, Inc., Tulsa, OK, USA). Significance was set at p < 0.05. 3. Results 3.1. Effects on mortality, hatching and embryo-larvae development No significant difference in mortality was observed between control and irradiated larvae for both doses on three separated experiments (data not shown, mean cumulated mortality at 96 hpf of 33%).

Fig. 2. Median hatching time (HT50 ) in control zebrafish larvae and those irradiated at 0.8 and 570 mGy/d (n = 128, 155 and 169 for control, 0.8 and 570 mGy/d, respectively). Statistical testing was done using ANOVA followed by LSD test, p < 0.05; a < b.

An acceleration of hatching process of 21% and 27% was observed for 24 hpf embryos irradiated at 0.8 and 570 mGy/d, respectively, compared to controls, for the three different experiments with pooled data in the different conditions in every experiment (Fig. 2). In one of our experiments, 24 hpf embryos were dechorionated. 570 mGy/d irradiated eggs (Fig. 3B) showed more vertebral malformations (Fig. 3A) than controls (60% vs 10%, data not shown); however, this difference was not found after hatching at 72 and 96 hpf. Other morphological analyses (egg diameter and yolk bag diameter at 24 and 48 hpf) on eggs did not show any differences between control and irradiated embryos (data not shown). On larvae, no differences appeared on eye diameter (data not shown). However, a significant decrease of total larval length was observed in 570 mGy/d irradiated larvae compared to controls but only at 48 hpf (Fig. 4A). Moreover, a significant decrease of yolk bag diameter was observed in 96 hpf 570 mGy/d-irradiated larvae compared to controls (Fig. 4B). At 48 hpf, the same trend was observed but was not significant (Fig. 4B). 3.2. Effects on DNA damages and apoptosis 96 hpf larvae irradiated at 0.8 mGy/d showed more DNA strand breaks revealed by comet assay than controls (Fig. 5A). At 24 hpf, differences between controls and irradiated larvae were not significant due to high variability of results (Fig. 5A). 24 hpf embryos irradiated at 570 mGy/d showed more DNA strand breaks than controls (Fig. 5B). However, this result was reversed at 96 hpf, with less DNA damages in irradiated larvae than in controls (Fig. 5B). Images of normal/altered nuclei obtained with comet assay are shown in Fig. 6A and B. The 24 hpf embryos irradiated at 570 mGy/d (Fig. 7B) showed more apoptotic signals than controls (Fig. 7A) (42 ± 10 vs 106 ± 9, p = 0.02, data not shown). This apoptosis was localized mostly on the head and somites (Fig. 7B).

B. Gagnaire et al. / Aquatic Toxicology 169 (2015) 69–78

73

Fig. 3. Abnormalities of embryonic development observed in 24 hpf dechorionated zebrafish embryos irradiated at 570 mGy/d (B) compared to control (A).

Fig. 4. Measurements of total length (A) and yolk bag diameter (B) in mm in control zebrafish larvae and thosr irradiated at 0.8 and 570 mGy/d at 48 hpf (n = 1, 5 and 8 for control, 0.8 and 570 mGy/d, respectively), 72 hpf (n = 14, 16 and 12) and 96 hpf (n = 9, 12 and 13). Statistical testing was done using ANOVA followed by LSD test, p < 0.05; a < b.

Fig. 5. Results of the comet assay expressed by mean tail moments obtained for zebrafish 24 hpf embryos (n = 3 pools of 10) and 96 hpf larvae (n = 10); controls and irradiated at 0.8 mGy/d (A) and control and irradiated at 570 mGy/d (B). Statistical testing was done with Mann Whitney test, p < 0.01; a < b.

Table 2 EROD activity (fmol RR/min/larva), PO-like activity (U/larva), ROS stimulation index and AChE activity (nmol ATCi/min/mg protein) in D. rerio larvae irradiated at 0.8 and 570 mGy/d for 96 h. Values are means of 10 replicates for controls and 7 replicates for irradiated larvae for EROD and PO, 16 replicates for controls and 20 replicated for irradiated larvae for ROS and 10 replicates for AChE; standard error is presented. a, b: significantly different, p < 0.05, a < b.

Control 0.8 mGy/d 570 mGy/d

EROD (fmol RR/h/larva)

PO (U/larva)

ROS stimulation index

AChE (nmol ATCi/min/mg proteins)

167.57 ± 29.68 b 85.22 ± 5.08 a 50.57 ± 18.69 a

1.93 ± 0.15 a 1.58 ± 0.11 a 1.59 ± 0.14 a

1.42 ± 0.10 b 0.90 ± 0.11 a 1.38 ± 0.11 b

1006.08 ± 106.54 b 796.03 ± 72.02 a 1140.90 ± 109.81 b

3.3. Effects on immunotoxic and neurotoxic biomarkers No effect of gamma irradiation was observed on phenoloxidase activity after 96 h of irradiation, whatever the dose used (Table 2). 96 hpf larvae irradiated at both doses showed a lower resorufin production compared to controls, indicating a decrease of EROD biotransformation activity (Table 2). 96 hpf larvae irradiated at 0.8 mGy/d showed a decrease of ROS stimulation index compared to controls, however this difference was not true for 570 mGy/d irradiated larvae (Table 2). This difference was due to an increase of basal ROS level in larvae irradiated with 0.8 mGy/d compared

to other conditions (data not shown). Activated ROS level was not different between conditions. Gamma rays induced a decrease of AChE activity after 96 h of exposure but only in larvae irradiated at 0.8 mGy/d (Table 2). 3.4. Effects on gene expression Results showed that several genes were overexpressed in irradiated larvae compared to controls: ache, chat and cyp1a were 3.75, 1.82 and 1.70 times more expressed in 570 mGy/d irradiated larvae compared to controls, respectively (Table 3). Mpx was

74

B. Gagnaire et al. / Aquatic Toxicology 169 (2015) 69–78

Fig. 6. Images of cell nucleus obtained using comet assay in 24 hpf dechorionated zebrafish embryos irradiated at 570 mGy/d (B) compared to control (A).

Fig. 7. Apoptotic signals revealed by acridine orange in 24 hpf dechorionated zebrafish embryos irradiated at 570 mGy/d (B) compared to control (A). X60 magnification.

overexpressed 2.06 and 2.04 times in 0.8 and 570 mGy/d irradiated larvae compared to controls, respectively (Table 3). Other genes did not show any significant differences (Table 3).

in cells and tissues in differentiation. However, no structural differences appeared in mitochondria between irradiated larvae and controls (data not shown).

3.5. Histopathological observations

4. Discussion

Observations were made on the tail muscular part in order to assess damages to skeletal striated muscle and mitochondria. TEM observations showed a degradation of myofibrils with an alteration of myosin filaments for both doses and all replicates, with a higher number of these damages at 570 mGy/d (Fig. 8A–C). Numerous mitochondria were observed by TEM in different tissues of 96 hpf larvae, which indicated a high energetic activity

4.1. Macroscopic effects of gamma irradiation

Table 3 Relative expression of genes compared to control in larvae irradiated at 0.8 and 570 mGy/d (n = 9). Results were normalized using reference gene ef1. Analysis with REST-384© , p < 0.05; bold values indicate a significant difference compared to control. 0.8 mGy/d ache bax chat cyp1a gstp1 lyz mpx mt2

1.94 1.05 1.49 1.93 1.72 −1.01 2.06 −1.48

570 mGy/d 3.75 1.01 1.82 1.70 −1.08 1.31 2.04 1.14

We showed in our study that gamma irradiation decreased HT50 . Previous experiments using the same high dose of gamma irradiation also showed an acceleration of hatching process in zebrafish larvae (decrease of 10–25% of HT50 between control and irradiated larvae) (Pereira et al., 2011; Simon et al., 2011). The same result was observed by Miyachi et al. (2003) after exposure of zebrafish to 0.43 Gy/min X-rays. On the contrary, in the case of an acute gamma irradiation (3 hpf embryos irradiated at 0.3, 1 or 2 Gy during 1 min), a delay in hatching was observed in zebrafish embryos for all tested doses (increase of HT50 ) (Pereira et al., 2011). In the same way, mortality was observed after an acute irradiation (1–10 Gy) of zebrafish (McAleer et al., 2005). The same result was obtained after an acute irradiation (2.5–10 Gy) on embryos of the hermaphroditic fish, Kryptolebias marmoratus (Rhee et al., 2012). A delay in hatching is more commonly observed after exposure to metals like uranium and cadmium (Bourrachot et al., 2008; Fraysse et al., 2006). No differences of mortality were observed between controls and irradiated larvae. We also observed a decrease of yolk bag diameter in 96 hpf larvae irradiated at 570 mGy/d. The decrease of yolk bag

B. Gagnaire et al. / Aquatic Toxicology 169 (2015) 69–78

75

Fig. 8. Muscular tissue observed by TEM in 96 hpf zebrafish larvae control (A) and irradiated at 0.8 (B) and 570 mGy/d (C). E: endomysium, M: myofibrils, Mi: mitochondria.

diameter found in this study could indicate an increase in the consumption of energy reserved in irradiated larvae, and therefore, an increase of global metabolism of larvae, which could explain the acceleration of hatching process and the higher late larval mortality observed by Bourrachot (2009). These results reinforce the hypothesis proposed by Simon et al. (2011) on the link between irradiation, acceleration of hatching and early consumption of energy reserves. 4.2. Developmental abnormalities, histological observations and neuromuscular effects We showed some vertebral malformations on 24 hpf dechorionated larvae irradiated at 570 mGy/d. Fusion of three vertebrae, incomplete formation of vertebra or lack of vertebral process also occurred in medaka embryos irradiated during embryo-larval development witj 430 mGy/d (Hyodo-Taguchi and Etoh, 1993). Moreover, in the case of an acute gamma irradiation, abnormalities were also observed in zebrafish larvae, with tail atrophy and malformations of the trunk axis of irradiated larvae (Pereira et al., 2011) and with multiple morphological defects (McAleer et al., 2005). Abnormalities were also observed in zebrafish larvae exposed to tritiated thymidine, another radioactive component, with twisted larvae (Adam-Guillermin, unpublished data). In the case of tritiated thymidine, these malformations could come from neuromuscular disorders inducing negative effects on vertebral column muscles. AChE activity was decreased in larvae irradiated at low dose, while ache (acetylcholinesterase) and chat (choline acetyltransferase) gene expression (the latter being involved in the acetylcholine synthesis), were induced by the high dose of irradiation. We can

hypothesize that the kinetics of response at the mRNA and protein levels differs for both doses: at high dose, gamma irradiation may disrupt AChE at the mRNA and protein levels earlier in the experiment, therefore when we measured gene expression at 96 hpf, we saw a second type of response to irradiation with an increase at the mRNA level, possibly leading to an increase at the protein level if we had continued the experiment. At low dose, the decrease observed at 96 hpf could reflect the first response of zebrafish to gamma irradiation. This kind of bimodal pattern of time-dependent response was already shown for brain AChE in adult zebrafish exposed to DU, with a decrease of AChE activity during the first three days of exposure, and then an increase (Barillet et al., 2007). Moreover, expression of ache gene was also increased in adult zebrafish brain after 10 days of exposure to 100 ␮g DU/L (Lerebours et al., 2009). This result indicates that zebrafish neurotransmission can be impaired by radionuclides of different natures via different exposure modalities (external irradiation/metallic contamination). Histological observations showed a tissue degeneration of tail muscle for both doses, leading to a dilatation of endomysium. Previous studies showed that adult zebrafish exposed during 28 days to 20 ␮g DU/L showed endomysium dilatation of the skeletal muscles; myofibrils and sarcomere were also disorganized (Lerebours et al., 2010). The dilatation of endomysium can affect muscle contractility. This result, taken together with modifications of AChE activity and gene expression and malformations, seems to show that gamma irradiation induces effects on neurotransmission at different levels of biological organization (transcript, protein, tissue). We can hypothesize that this alteration of neurotransmission could affect the muscular development and the locomotion capacities

76

B. Gagnaire et al. / Aquatic Toxicology 169 (2015) 69–78

of the fish. Overall, our study showed that neurotransmission and muscular integrity can represent relevant targets for the evaluation of fish response to radionuclides. 4.3. DNA damages, immune biomarkers, oxidative stress and apoptosis Increase of DNA damages was observed for both doses but at different times. More surprisingly, for the highest dose at 96 hpf, a decrease of damages was observed, which suggests that the 96 hpf larvae could be able to develop repair mechanisms when the dose is high. An alternative hypothesis would be that affected larvae had died earlier in the experiment, then only the surviving ones were able to develop repair mechanisms. An increase of DNA strand breaks and micronucleus frequency were shown previously on zebrafish embryos and ZF4 embryonic culture cells after 24 h of irradiation to 10–750 mGy/d (Pereira et al., 2011). DNA damages were also increased in zebrafish embryos irradiated at 1–1000 mGy/d during 24 and 48 hpf (Simon et al., 2011) and in 5–6 dpf zebrafish larvae irradiated at 29 and 173 mGy/d for 24 h but not at 10 mGy/d (Jarvis and Knowles, 2003). DNA double strand breaks were also increased in medaka, Oryzias latipes, irradiated at 2.4 and 21 mGy/d (Grygoryev et al., 2013). An increase of DNA damages can also lead to apoptosis. In our study, apoptosis was increased in 24 hpf embryos irradiated at 570 mGy/d. Other studies showed cell death mostly in the head and the eye region after irradiation of zebrafish larvae at 0.25–4 Gy (Mena et al., 2010). Apoptosis was also induced after acute gamma irradiation of zebrafish embryos (5–20 Gy) (Yabu et al., 2001). Irradiation of K. marmoratus larvae at 4–6 Gy also induced p53 gene expression and DNA damages (Rhee et al., 2013). However, the expression of bax (bcl2-associated X protein), a pro-apoptotic gene, was not modified in our study. All these results show the role of apoptosis in embryogenesis under stress conditions and confirm the link between DNA damages and apoptosis in irradiated zebrafish larvae. In our study, ROS stimulation index decreased in irradiated larvae, due to an increase of basal ROS level in larvae irradiated only to 0.8 mGy/j. This result was previously shown on zebrafish larvae exposed to depleted uranium where the results showed an increase of basal ROS level with no modification of PMA-stimulated ROS level, leading to a reduction of ROS stimulation index (Gagnaire et al., 2014). After an acute irradiation, K. marmoratus embryos also had higher basal ROS levels than controls, while the activities of several antioxidant enzymes were increased (Rhee et al., 2012). Therefore, increased basal ROS levels seem to be common responses to exposures to several radioactive stressors. However, this result was not obtained at the high dose of gamma irradiation. As we saw an effect for the low dose at 96 hpf, we could hypothesize that at the high dose of irradiation, the effect on ROS production occurred earlier in the experiment, and at 96 hpf the oxidative stress has already started but is no longer seen at the protein level. Another important result is that in our study, PMAstimulated ROS levels were not modified by irradiation. This result could indicate that fish may not be able to stimulate its defence capacities towards infectious diseases. When looking at the molecular level, mpx (myeloid specific peroxidase) gene expression, the product of which is involved in H2 O2 reduction in the oxidative burst, increased in both doses. Olsvik et al. (2010) showed that gamma rays induced significant up-regulation of genes known to respond to ROS generating agents (GR, GPX) in the Atlantic salmon, Salmo salar, after 5 h at 75 mGy. Therefore, indirect effects of gamma irradiation, by the increase of basal ROS levels, could also be responsible of the observed DNA damages. EROD activity was decreased in irradiated larvae, while cyp1a (cytochrome P450 CYP1A) gene expression was increased and

gstp1 (glutathione-S-transferase) and mt2 (metallothionein) gene expressions, also involved in detoxification mechanisms, were not affected. The expression of lyz (lysozyme C) gene was also not modified. After exposure of adult zebrafish to DU, ROS production was increased (Gagnaire et al., 2013) and expression of genes involved in apoptosis, oxidative stress, inflammation and detoxification was affected (Lerebours et al., 2009). The induction of an oxidative stress by uranium as sublethal toxic effect has been shown in other fish species (Cooley et al., 2000). These results show that mechanisms involved in response to radioactive stressors can be different concerning detoxification and inflammation, but the induction of an oxidative stress seems to be common for both kinds of exposure: metallic contamination and external irradiation. As a whole, our results clarify the previous results observed in fish by proving the existence of an oxidative stress which leads to DNA damages after exposure to radionuclides. 4.4. Relationships between cellular and molecular levels Ache, cyp1a and mpx genes were over-expressed for both doses, when AChE enzymatic activity and ROS stimulation index decreased only at 0.8 mGy/d and EROD activity decreased for both doses. The same kind of results was observed after an acute irradiation of K. marmoratus embryos, where antioxidant activities were increased and expression of antioxidant genes was down-regulated (Rhee et al., 2012). However, it is important to note that mechanisms disrupted at the protein level were also altered at the mRNA level (AChE and CYP1A activities, ROS production). We can therefore hypothesize that the transcriptional up-regulation of genes can be initiated in order to compensate for the low levels of proteins. Therefore, gene expression is a powerful and relevant tool allowing the identification of mechanisms susceptible to the chosen stressor, gamma irradiation in this work. In our study, we only measured the expression of some selected genes involved in different functions, which were also studied at the protein level and we saw some interesting results and links to make within these different organization levels. It would be very interesting to further study molecular responses via other techniques of global analysis of response patterns of a high number of genes involved in multiple pathways related to general metabolism, immunity, DNA damage response and neural development. This kind of approach could provide some important information of the response of gene expression during the embryolarvae development after long and short-term exposure to gamma irradiation and could help us to understand how such an exposure at early life stage can affect the physiological functions when these fish reach adult stage. In order to explore more these relationships between molecular and cellular levels, and in order to assess the relevance of our results in the in vivo experiments, it would be very interesting to study the effects of gamma rays on cells in culture in a complementary in vitro approach. In vitro studies present several advantages: testing important quantities of experimental conditions in a minimal time, studying the potential reversibility of effects, limiting the quantity of radionuclides and animals used and validating another type of bioassay widely used in ecotoxicology. Overall, our results showed some differences in the sensitivity of biomarkers measured. The biomarkers linked to neurotoxicity seemed to be the most sensitive ones as alterations were shown at gene, protein, tissue and individual levels. The biomarkers linked to oxidative stress were also highly sensitive with disruptions observed at the mRNA and protein levels; it should be noted that both doses induced mRNA responses. The biomarkers of detoxification also showed modifications at both levels, but only the cytochrome P450 family seemed to respond to irradiation. The biomarkers of immune response were less sensitive with only

B. Gagnaire et al. / Aquatic Toxicology 169 (2015) 69–78

modification of tissue apoptosis. DNA damages represent a sensitive biomarker of irradiation but were only assessed by the comet assay. It would be interesting to follow the expression of genes involved in DNA repair mechanisms in order to assess their sensitivity to irradiation. Moreover, some of the biomarkers used in this study (ROS, DNA damages, PO) were also assessed after a DU contamination of zebrafish larvae (Bourrachot et al., 2014; Gagnaire et al., 2014). Only PO-like activity was modified by DU and not by gamma irradiation. Therefore, none of the biomarkers tested seemed to be specific of gamma irradiation. We observed effects of gamma irradiation on zebrafish larvae at several levels at the dose of 0.8 mGy/d, which is lower than the ICRP (International Commission on Radiological Protection)-derived consideration reference levels (DCRLs) for fish of 1–10 mGy/d (ICRP, 2008). DCRLs correspond to a “band of dose rate within which there is likely to be some chance of deleterious effects of ionizing radiation occurring to individuals”. However, the dose we tested is higher than the benchmark value of 0.24 mGy/d proposed by Garnier-Laplace et al. (2010) for the protection of freshwater ecosystems towards radioactive substances. It would be interesting to test a dose lower than this value in order to confirm the relevance of this protection threshold. 5. Conclusion Our study explored the effects of an external gamma irradiation on several biomarkers and parameters in zebrafish larvae. We showed that at low doses relevant to environmental levels, gamma rays could modify zebrafish parameters including ROS production, EROD and AChE activities and gene expression and could also induce DNA damages, muscle alterations and effects on development. Most of these responses were confirmed at a higher dose of gamma rays. These parameters could therefore represent relevant parameters for assessing ionizing radiation-related stress. This work allows to show that multi-scale approach, by the measurement of biomarkers representative of different physiological functions of fish, associated to measurement of expression of genes involved in underlying mechanisms and coupled to morphological observations and tissue analyses, constitutes a powerful tool to identify the biological targets of an exposure to external gamma irradiation and helps to understand the modes of action of ionizing radiation. This approach could therefore be extended to other radionuclides. Acknowledgments This work was supported by the GGP research program supported by IRSN and EDF (Electricité de France). References Adam-Guillermin, C., Pereira, S., Della-Vedova, C., Hinton, T., Garnier-Laplace, J., 2012. Genotoxic and reprotoxic effects of tritium and external gamma irradiation on aquatic animals. Rev. Environ. Contam. Toxicol. 220, 67–103. Barillet, S., Adam, C., Palluel, O., Devaux, A., 2007. Bioaccumulation, oxidative stress, and neurotoxicity in Danio rerio exposed to different isotopic compositions of uranium. Environ. Toxicol. Chem. 26, 497–505. Barros-Becker, F., Romero, J., Pulgar, A., Feijóo, C.G., 2012. Persistent oxytetracycline exposure induces an inflammatory process that improves regenerative capacity in zebrafish larvae. PLoS One 7, e36827. Bourrachot, S., 2009. Etude des effets biologiques de l’exposition à l’uranium chez le poisson zèbre (D. rerio)—impact sur les stades de vie, Environnement et Santé. Université de Provence, Marseille, p. 253. Bourrachot, S., Brion, F., Pereira, S., Floriani, M., Camilleri, V., Cavalié, I., Palluel, O., Adam-Guillermin, C., 2014. Effects of depleted uranium on the reproductive success and F1 generation survival of zebrafish (Danio rerio). Aquat. Toxicol. 154, 1–11. Bourrachot, S., Simon, O., Gilbin, R., 2008. The effects of waterborne uranium on the hatching success, development, and survival of early life stages of zebrafish (Danio rerio). Aquat. Toxicol. 90, 29–36.

77

Bradford, M.M., 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248–254. Cooley, H.M., Evans, R.E., Klaverkamp, J.F., 2000. Toxicology of dietary uranium in lake whitefish (Coregonus clupeaformis). Aquat. Toxicol. 48, 495–515. Devaux, A., Flammarion, P., Bernardon, V., Garric, J., Monod, G., 1998. Monitoring of the chemical pollution of the river Rhone through measurement of DNA damage and cytochrome P4501A induction in Chub (Leuciscus cephalus). Mar. Environ. Res. 46, 257–262. Erickson, R.C., 1971. Effects of Chronic Irradiation by Tritiated Water on Poecilia reticulata, the Guppy. National Technical Information Service, US Department of Commerce, Springfield. Fraysse, B., Mons, R., Garric, J., 2006. Development of a zebrafish 4-day embryo-larval bioassay to assess toxicity of chemicals. Ecotoxicol. Environ. Saf. 63, 253–267. Gagnaire, B., Bado-Nilles, A., Sanchez, W., 2014. Depleted uranium disturbs immune parameters in zebrafish, Danio rerio: an ex vivo/in vivo experiment. Arch. Environ. Contam. Toxicology 1 67, 426. Gagnaire, B., Cavalie, I., Camilleri, V., Adam-Guillermin, C., 2013. Effects of depleted uranium on oxidative stress, detoxification, and defence parameters of zebrafish Danio rerio. Arch. Environ. Contam. Toxicol. 64, 140–150. Galloway, T.S., Depledge, M.H., 2001. Immunotoxicity in invertebrates: measurement and ecotoxicological relevance. Ecotoxicology 10, 5–23. Garnier-Laplace, J., Della-Vedova, C., Andersson, P., Copplestone, D., Cailes, C., Beresford, N.A., Howard, B.J., Howe, P., Whitehouse, P., 2010. A multi-criteria weight of evidence approach for deriving ecological benchmarks for radioactive substances. J. Radiol. Prot. 30, 215–233. Garnier-Laplace, J., Della-Vedova, C., Gilbin, R., Copplestone, D., Hingston, J., Ciffroy, P., 2006. First derivation of predicted-no-effect values for freshwater and terrestrial ecosystems exposed to radioactive substances. Environ. Sci. Technol. 40, 6498–6505. Grygoryev, D., Moskalenko, O., Hinton, T.G., Zimbrick, J.D., 2013. DNA damage caused by chronic transgenerational exposure to low dose gamma radiation in medaka fish (Oryzias latipes). Radiat. Res. 180, 235–246. Hill, A.J., Teraoka, H., Heideman, W., Peterson, R.E., 2005. Zebrafish as a model vertebrate for investigating chemical toxicity. Toxicol. Sci. 86, 6–19. Hyodo-Taguchi, Y., Etoh, H., 1993. Vertebral malformations in medaka (teleost fish) after exposure to tritiated water in the embryonic stage. Radiat. Res. 135, 400–404. IAEA, 1992. Effects of Ionizing Radiation on Plants and Animals at Levels Implied by Current Radiation Protection Standards. International Atomic Energy Agency, Vienna. ICRP, 2008. ICRP Publication 108. Environmental protection: the concept and use of reference animals and plants. Ann. ICRP 37, 1–242. Jarvis, R.B., Knowles, J.F., 2003. DNA damage in zebrafish larvae induced by exposure to low-dose rate ␥-radiation: detection by the alkaline comet assay. Mutat. Res.—Genet. Toxicol. Environ. Mutagen. 541, 63–69. Kosmehl, T., Hallare, A.V., Braunbeck, T., Hollert, H., 2008. DNA damage induced by genotoxicants in zebrafish (Danio rerio) embryos after contact exposure to freeze-dried sediment and sediment extracts from Laguna Lake (The Philippines) as measured by the comet assay. Mutat. Res.—Genet. Toxicol. Environ. Mutagen. 650, 1–14. Lerebours, A., Adam-Guillermin, C., Brethes, D., Frelon, S., Floriani, M., Camilleri, V., Garnier-Laplace, J., Bourdineaud, J.P., 2010. Mitochondrial energetic metabolism perturbations in skeletal muscles and brain of zebrafish (Danio rerio) exposed to low concentrations of waterborne uranium. Aquat. Toxicol. 100, 66–74. Lerebours, A., Gonzalez, P., Adam, C., Camilleri, V., Bourdineaud, J.P., Garnier-Laplace, J., 2009. Comparative analysis of gene expression in brain, liver, skeletal muscles, and gills of zebrafish (Danio rerio) exposed to environmentally relevant waterborne uranium concentrations. Environ. Toxicol. Chem. 28, 1271–1278. McAleer, M.F., Davidson, C., Davidson, W.R., Yentzer, B., Farber, S.A., Rodeck, U., Dicker, A.P., 2005. Novel use of zebrafish as a vertebrate model to screen radiation protectors and sensitizers. Int. J. Radiat. Oncol. Biol. Phys. 61, 10–13. Mena, P., Allende, M., Morales, J.R., 2010. Survival study of zebrafish embryos under gamma irradiation. In: 8th Latin American Symposium on Nuclear Physics and Applications. LASNPA, Santiago, pp. 455–456. Miyachi, Y., Kanao, T., Okamoto, T., 2003. Marked depression of time interval between fertilization period and hatching period following exposure to low-dose X-rays in zebrafish. Environ. Res. 93, 216–219. Oberemm, A., 2000. The use of a refined zebrafish embryo bioassay for the assessment of aquatic toxicity. Lab. Anim. 29, 32–40. OECD, 2004a. OECD guidelines for testing of chemicals, advance copy. Test 210: Fish, early-life stage toxicity test. OECD, 2004b. OECD guidelines for testing of chemicals, advance copy. Test 212: Fish, short-term toxicity test on embryo and sac-fry stages. Olive, P.L., Banath, J.P., Durand, R.E., 1990. Heterogeneity in radiation induced DNA damage and repair in tumor and normal cells using the comet assay. Radiat. Res. 122, 86–94. Olsvik, P.A., Heier, L.S., Rosseland, B.O., Teien, H.C., Salbu, B., 2010. Effects of combined ␥-irradiation and metal (Al + Cd) exposures in Atlantic salmon (Salmo salar L.). J. Environ. Radioact. 101, 230–236. Pereira, S., Bourrachot, S., Cavalie, I., Plaire, D., Dutilleul, M., Gilbin, R., Adam-Guillermin, C., 2011. Genotoxicity of acute and chronic

78

B. Gagnaire et al. / Aquatic Toxicology 169 (2015) 69–78

gamma-irradiation on zebrafish cells and consequences for embryo development. Environ. Toxicol. Chem. 30, 2831–2837. Pfaffl, M.W., Horgan, G.W., Dempfle, L., 2002. Relative expression software tool (REST) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res. 30, 1–10. Rhee, J.S., Kim, B.M., Kang, C.M., Lee, Y.M., Lee, J.S., 2012. Gamma irradiation-induced oxidative stress and developmental impairment in the hermaphroditic fish, Kryptolebias marmoratus embryo. Environ. Toxicol. Chem. 31, 1745–1753. Rhee, J.S., Kim, B.M., Kim, R.O., Seo, J.S., Kim, I.C., Lee, Y.M., Lee, J.S., 2013. Co-expression of antioxidant enzymes with expression of p53, DNA repair, and heat shock protein genes in the gamma ray-irradiated hermaphroditic fish Kryptolebias marmoratus larvae. Aquat. Toxicol. 140–141, 58–67. Scholz, S., Fischer, S., Gündel, U., Küster, E., Luckenbach, T., Voelker, D., 2008. The zebrafish embryo model in environmental risk assessment—applications beyond acute toxicity testing. Environ. Sci. Pollut. Res. 15, 394–404. Simon, O., Massarin, S., Coppin, F., Hinton, T.G., Gilbin, R., 2011. Investigating the embryo/larval toxic and genotoxic effects of Î3 irradiation on zebrafish eggs. J. Environ. Radioact. 102, 1039–1044.

Strand, J.A., Fujihara, M.P., Poston, T.M., Abernethy, C.S., 1982. Permanence of suppression of the primary immune response in rainbow trout, Salmo gairdneri, sublethally exposed to tritiated water during embryogenesis. Radiat. Res. 91, 533–541. Tucker, B., Lardelli, M., 2007. A rapid apoptosis assay measuring relative acridine orange fluorescence in zebrafish embryos. Zebrafish 4, 113–116. UNSCEAR, 1996. Sources and effects of ionising radiation, report for the general assembly, New York. van der Oost, R., Beyer, J., Vermeulen, N.P.E., 2003. Fish bioaccumulation and biomarkers in environmental risk assessment: a review. Environ. Toxicol. Pharmacol. 13, 57–149. Westerfield, M., 2007. The Zebrafish Book: A Guide for the Laboratory Use of Zebrafish (Danio rerio). University of Oregon Press, Eugene. Yabu, T., Todoriki, S., Yamashita, M., 2001. Stress-induced apoptosis by heat shock, UV and (␥-ray irradiation in zebrafish embryos detected by increased caspase activity and whole-mount TUNEL staining. Fish. Sci. 67, 333–340. Yen, J., Donerly, S., Levin, E.D., Linney, E.A., 2011. Differential acetylcholinesterase inhibition of chlorpyrifos, diazinon and parathion in larval zebrafish. Neurotoxicol. Teratol. 33, 735–741.