Extensive projections of myenteric serotonergic neurons suggest they comprise the central processing unit in the colon.

Neurogastroenterology & Motility Neurogastroenterol Motil (2014) 26, 556–570

doi: 10.1111/nmo.12302

Extensive projections of myenteric serotonergic neurons suggest they comprise the central processing unit in the colon T. OKAMOTO , M. J. BARTON , G. W. HENNIG , G. C. BIRCH , N. GRAINGER , R. D. CORRIGAN , S. D. KOH , K. M. SANDERS

& T. K. SMITH Department of Physiology and Cell Biology, University of Nevada School of Medicine, Reno, NV, USA

Key Messages

• The significance of serotonergic neurons in the colon is uncertain. We therefore examined the projections of •

•

5-HT neurons throughout the enteric nervous system and ICC networks in the murine colon using immunohistochemical techniques combined with Fluoview software in 30 mice. Our results suggest that 5-HT neurons are large neurons that occur only in the myenteric plexus. Despite their relatively low numbers they have extensive projections throughout the myenteric plexus, submucous plexus and ICC networks, and line submucosal arterioles. They appear to innervate most nNOS neurons, Dogiel Type II neurons and glial cells. They also form an extensive ganglionated nerve plexus, which contains mainly nNOS neurons, lying over the submucosal pacemaker ICC layer, suggesting they regulate slow wave activity. In conclusion, the importance of myenteric 5-HT neurons has been unappreciated since they likely comprise a type of central processing unit in the colon that coordinates motility with secretion and blood flow.

Abstract Background 5-Hydroxytryptamine (5-HT, serotonin) is an important regulator of colonic motility and secretion; yet the role of serotonergic neurons in the colon is controversial. Methods We used immunohistochemical techniques to examine their projections throughout the enteric nervous system and interstitial cells of Cajal (ICC) networks in the murine proximal to mid colon. Key Results Serotonergic neurons, which were mainly calbindin positive, occurred only in myenteric ganglia (1 per 3 ganglia). They were larger than nNOS neurons but similar in size to Dogiel Type II (AH) neurons. 5-HT neurons, appeared to make numerous varicose contacts with each other, most nNOS neurons, Dogiel Type II/AH neurons and glial cells. 5-HT, calbindin and nNOS nerve fibers also formed a thin perimuscular nerve plexus that was associated with

ganglia, which contained both nNOS positive and negative neurons, which lay directly upon the submucosal pacemaker ICC network. Neurons in perimuscular ganglia were surrounded by 5-HT varicosities. Submucous ganglia contained nNOS positive and negative neurons, and calbindin positive neurons, which also appeared richly supplied by serotonergic nerve varicosities. Serotonergic nerve fibers ran along submucosal arterioles, but not veins. Varicosities of serotonergic nerve fibers were closely associated with pacemaker ICC networks and with intramuscular ICC (ICC-IM). 5-HT2B receptors were found on a subpopulation of non-5-HT containing myenteric neurons and their varicosities, pacemaker ICC-MY and ICC-IM. Conclusions & Inferences Myenteric serotonergic neurons, whose axons exhibit considerable divergence, regulate the entire enteric nervous system and are important in coordinating motility with secretion. They are not just interneurons, as regularly assumed, but possibly also motor neurons to ICC and blood vessels, and some may even be sensory neurons.

Address for Correspondence T. K. Smith, Department of Physiology and Cell Biology, University of Nevada School of Medicine, Reno, Nevada, USA. Tel: 775 784 4885; fax: 775 784 6903; e-mail: [email protected] Received: 6 November 2013 Accepted for publication: 12 December 2013

Keywords 5-HT, 5-HT2B receptor, AH neuron, calbindin, cKit, colon, GFAP, Glia, ICC, Immunohistochem-

556

© 2014 John Wiley & Sons Ltd

Volume 26, Number 4, April 2014

Projections of serotonergic neurons

deletion of TPH2 leads to slow intestinal transit, accelerated gastric emptying, and reduced expulsion rate of beads from the rectum.25 In addition, inflammation is more severe in TPH2 KO than in TPH1 KO mice, as neuronal 5-HT shields the gut from inflammatory damage.3 Many studies demonstrate that activation of serotonergic receptors cause both fast (via activation of 5HT3 receptors) and slow (via activation of 5-HT7 receptors) postsynaptic responses, and presynaptically modulate (via activation of 5-HT1A, and 5-HT4 receptors) neurotransmitter release in enteric neurons.28–31 We and others have shown that both mucosal and neuronal 5-HT are important for fecal pellet transit; mucosal reflexes; tonic inhibition of the muscle and pacemaker ICC, which occurs between colonic migrating motor complexes (CMMCs), and the initiation, generation, and propagation of CMMCs and secretomotor reflexes.6,7,32,33,35–38 In fact, 5-HT7 and 5HT1A receptor antagonists acting at the level of the myenteric plexus (MP) blocks the CMMC6 that mediates fecal pellet propulsion.35 More recently, however, it has been proposed that neither neuronal nor mucosal 5-HT are important for fecal pellet propulsion or CMMCs39–42 as these were unaffected by reserpine pretreatment, which purportedly depleted all 5-HT from the colon.41,42 However, because 5-HT3 and 5-HT4 antagonists still reduced the amplitude of CMMCs and pellet propulsion in their reserpinized animals they postulated a non-neuronal action of these drugs. Although reserpine has been shown to deplete the brain of over 90% of its 5-HT, it does not block the synthesis of 5-HT by tyrosine hydroxylase; it depletes 5-HT from vesicles in the larger storage or reserved pool that is not responsive to nerve stimulation but does not affect 5-HT in vesicles in the smaller releasable or functional pool responsible for nerve evoked release of 5-HT (reviewed in 7 and 34). Therefore, reserpine has been used to study only the releasable pool of 5-HT.34 Given the controversies surrounding a role for neuronal 5-HT, we were interested in determining their projections and targets in the murine colon, because only the occurrence of myenteric 5-HT neurons have been observed previously in the mouse large intestine.14,15 Most studies of serotonergic neurons preincubate the GI tract with 5-HT in order to enhance neuronal 5-HT visibility for immunohistochemistry. However, this approach may non-specifically label other amine handling neurons that can take up but don’t normally synthesize 5-HT; therefore, they have been referred to as 5-HT-accumulating neurons.43 We have used immunohistochemistry without preincuba-

istry, Mouse, myenteric plexus, nNOS neuron, perimuscular plexus, serotonin, submucous plexus. Abbreviations: 5-HT, 5-Hydroxytryptamine; BV, blood vessel; CM, circular muscle; ECC, enterochromaffin cells; GFAP, glial fibrillary acidic protein; ICC-IM, intramuscular interstitial cells of Cajal; ICC-MY, myenteric pacemaker ICC; ICC-SM, submucosal pacemaker ICC; IMN, inhibitory motor neuron; LM, longitudinal muscle; MG, myenteric ganglia; MP, myenteric plexus; PMG, perimuscular ganglia; PMNP, perimuscular nerve plexus; PVG, prevertebral ganglia; SMG, submucous ganglia; VD, vasodilator neuron.

INTRODUCTION 5-Hydroxytryptamine (5-HT, serotonin) is a widespread biogenic amine found in vertebrates, invertebrates, and plants that has been the focus of research for over 50 years.1–3 Most of the body’s 5-HT (~95%) is in the GI tract, where it is synthesized in enterochromaffin cells (ECC) and in ~1% of myenteric interneurons.3,16 5-Hydroxytryptamine is an important regulator of colonic motility and its various receptors are important targets for the treatment of disease; the 5-HT system is the one that has proved most reliable for therapeutic manipulation of motility.3–8 Although there can be significant variation in the chemical coding of enteric neurons among species, myenteric 5-HT neurons are conserved in different regions of the GI tract and among mammals,9–17 including humans,18 suggesting that 5-HT released from these neurons is a primary neurotransmitter.19 5Hydroxytryptamine neuron cell bodies are also cholinergic,9,15,16 however less than one-third of their nerve varicosities contain VACht,20 suggesting that although 5-HT is likely to be a primary neurotransmitter, some varicosities may release and uptake acetylcholine.6 5-Hydroxytryptamine neurons also contain calbindin (calcium binding protein) in the guinea-pig stomach,21 together with CGRP in the colon,16 which are also markers for Dogiel type II (AH) sensory neurons.22,23 Similarly, in the enteric nervous system of fish (sculpin) all serotonergic neurons appear to be calbindin positive.24 Several lesion studies (myectomy) suggest that serotonergic neurons are descending interneurons (length >6 mm) that synapse with one another.9,11,13–16 The rate limiting enzyme in the synthesis of 5-HT is tyrosine hydroxylase 1 (TPH1) in ECC and TPH2 in central and enteric serotonergic neurons.3,25 Serotonergic neurons are important precursors in the development of specific classes of enteric neurons, interstitial cells of Cajal (ICC) and the mucosa.25–27 Genetic


557

T. Okamoto et al.

Neurogastroenterology and Motility

Image capture and processing

tion with 5-HT in order to determine the projections of 5-HT neurons throughout the enteric nervous system of the murine proximal to mid colon.

Tissues were examined using the Fluoview FV1000 confocal microscope (Olympus, Center Valley, PA, USA). Confocal micrographs of whole mounts were digital composites of the Z-series of scans (0.15–0.5-lm optical sections). Final images were constructed using FV10-ASW 2.1 software (Olympus) and converted to Tiff files for final processing in Adobe Photoshop CS3 & 5 (Adobe Co., Mountain View, CA, USA). Panoramas were constructed by combining confocal Tiff images using Adobe Photoshop CS3.

METHODS Thirty adult c57/BL6 male mice were euthanized (4–6 weeks of age; Charles River Labs, Reno, NV, USA) by isofluorane inhalation and cervical dislocation in accordance to the guidelines set by the Animal Ethics Committee at the University of Nevada Reno.

To measure the overlap between 5-HT and calbindin varicosities, confocal stacks captured at 1009 (Z slice spacing 0.15 lm) were imported in custom-written software (Volumetry G8a, GWH). Maximum intensity projections were calculated and histograms of each color channel adjusted (2.5 SD). To calculate the degree of overlap between 5-HT and calbindin cell bodies and varicosities, the two channels were combined using a Boolean ‘AND’ procedure, followed by a Gaussian filter (0.4 9 0.4 lm; SD = 1.5).

Tissue preparation Following ventral midline incision, the entire GI tract was removed and the colon was separated from the rest of the tissue in a Sylgard (Dow-Corning, Midland, MI, USA) lined dish containing cold (4 °C) Krebs-Ringer-Buffer (composition (mM): NaCl: 120.35; KCl: 5.9; NaHCO3: 15.5; MgCl2: 1.2; NaH2PO4: 1.2; glucose: 1.5; CaCl2: 2.5; pH: 7.4; 4 °C); bubbled with 97% O2–3% CO2. The proximal to the mid colon was then cut open longitudinally and pinned flat.

Cell purification, RNA isolation, reversetranscription PCR, and quantitative PCR We determined the relative RNA expression of 5-HT3 and 5-HT2B receptors in ICC and smooth muscle cells (SMCs) of the murine colon dispersed from Kit+/copGFP and eGFP/SMC (mice bred at the University of Nevada). These were purified by fluorescenceactivated cell sorting (FACS; Becton Dickinson FACSAria using the blue laser [488 nm] and the GFP emission detector; 530/ 30 nm).44 Total RNA was isolated from these cells using illustra RNAspin Mini RNA Isolation kit (GE Healthcare, Little Chalfont, UK), and first-strand cDNA was synthesized using SuperScript III (Invitrogen, Carlsbad, CA, USA), according to the manufacturer’s instructions. Reverse-transcription PCR (RT-PCR) was performed with specific primers (Table 3) using Go-Taq Green Master Mix (Promega Corp., Madison, WI, USA). PCR products were analyzed on 2% agarose gels and visualized using ethidium bromide.

Immunohistochemistry Tissues were fixed using paraformaldehyde (4% in phosphate buffered saline [PBS] 0.01 M, pH 7.2) for 12 h at 4 °C. Following fixation, longitudinal muscle and mucosa were carefully peeled away and tissues were washed in PBS for 10 h with a change of PBS every hour. The tissues were then blocked using bovine serum albumin (1%) for 120 min at room temperature and incubated for 48 h at 4 °C with primary antibodies (Table 1). After washing the tissues for 5–6 h, they were subsequently placed in secondary antibodies (Table 2) for 1 h at room temperature. Tissues were washed 5–6 h in PBS before being mounted on glass microscope slides (Fisher Scientific, Pittsburgh, PA, USA) using Aquamount (VWR International, West Chester, PA, USA).

Quantitative PCR (q-PCR) was performed with the same primers as PCR using Fast Syber green chemistry (Applied

Table 1 Primary antibodies Antibody

Host species

Dilution

Supplier

Catalog No.

5-HT 5-HT 5-HT-2B receptor nNOS c-Kit GFP GFAP Calbindin

Rabbit Goat Rabbit Sheep Goat Chicken Guinea-Pig Rabbit

1 1 1 1 1 1 1 1

ImmunoStar, Hudson, WI, USA

20080 20079 AP52127PU-N

: : : : : : : :

1000 1000 100 1000 500 1000 1000 1000

Acris, San Diego, CA, USA P.C. Emson, UK (gift) RD Systems, Minneapolice, MN, USA Abcam, Cambridge, MA, USA Advanced Immunochemical, Long Beach, CA, USA Swant, Marly, Switzerland

AF1356 ab13970 31223 CB-38a

Transgenic mice used for immunohistochemistry: FVB/N-Tg(GFAPGFP)14Mes/J, #003257 (Jackson Laboratory, Bar Harbor, ME, USA). Table 2 Secondary antibodies Antibody fluophore Rabbit Rabbit Goat Goat Sheep Chicken Guinea-Pig

Alexa Alexa Alexa Alexa Alexa Alexa Cy3

Fluor Fluor Fluor Fluor Fluor Fluor

488 594 488 594 594 488

Host species

Dilution

Supplier

Catalog No.

Donkey Donkey Donkey Donkey Donkey Donkey Donkey

1 1 1 1 1 1 1

Molecular Probe, Eugene, OR, USA

A21206 A21207 A11055 A11058 A11016 A11039 706-165-148

: : : : : : :

500 500 500 500 500 500 500

558

Jackson ImmunoResearch Laboratories, West Grove, PA, USA




Table 3 Primers mHTr2b-F mHtr2b-R mHtr3a-F mHtr3b-R

A TAAGCCACCTCAACGCCTAA TGTGAGACCCATCCAGCATT CACACCTCTGATTGGGGTCT CATAAGAGGCCGTTCTTGCC

NM_008311 NM_020274

Biosystems, Foster City, CA, USA) on the 7900HT Real Time PCR System (Applied Biosysytems). Regression analysis of the mean values of two multiplex q-PCRs for the log10 diluted cDNA was used to generate standard curves. Unknown amounts of messenger RNA (mRNA) were plotted relative to the standard curve for each set of primers and graphically plotted using Microsoft Excel. This gave transcriptional quantification of each gene relative to the endogenous Glyceraldehyde 3-phosphate dehydrogenase standard after log transformation of the corresponding raw data. A total of six mice were divided into two groups consisting each of three mice; qPCR analysis ran in duplicates in the two groups. There was high repeatability between the two groups and the average was used for comparison between sorted cells (ICCs or SMCs) and unsorted cells.

B

Statistical analysis Where applicable, results are expressed as mean SEM. Student’s unpaired t-test was used, where appropriate. p < 0.05 was regarded as statistically significant. n values represent the number of animals observations were taken from.

C

RESULTS Myenteric plexus We examined the distribution of serotonergic neurons in the myenteric plexus (MP) of the proximal to mid colon, mainly in the dense ganglionated area situated away from the mesenteric and antimesenteric borders where myenteric ganglia (MG) were larger and denser (Fig. 1).45 Myenteric serotonergic neurons occurred one every three ganglia (20 neurons; n = 3). On several occasions, two serotonergic neurons were observed in the same MG (Figs 1 and 2). They were also observed in ganglia in the hypoganglionated regions at the mesenteric and antimesenteric borders (Figs 1A and 2D). The cell bodies of serotonergic neurons were large compared to the cell bodies of nNOS neurons, but were similar in size to mitotracker/calbindin positive Type II/AH neurons.22 5-HT neurons often had ‘trowel’ like laminar dendrites confined to a single plane around the cell body (Figs 2 and 3D). As the somas of serotonergic neurons were surrounded by a dense neuropil of 5-HT varicose nerve processes, we were unable to trace their individual axons, even after 3-D image processing; as such, we were unclear whether they were unipolar descending interneurons, as suggested by previous studies10–17 or multipolar neurons13 (Fig. 2A). Serotonergic neurons formed a dense network of 5-HT


Figure 1 Distribution of 5-Hydroxytryptamine (5-HT) neurons in the myenteric plexus of the murine colon. (A) 5-HT (green) and nNOS (red) immunohisto-chemistry. Left hand panel (LHP): Top to bottom=circumferential direction. 5-HT neurons (dotted white circles) were mostly observed in the hyperganglionated region at the lateral edges of the antimesenteric border, although sparse 5-HT neurons were observed in the hypoganglionated region of the mesenteric and antimesenteric borders. Right hand panel: Enlargement of the orange square shown in the LHP. Note extensive projections of 5-HT nerve fibers throughout the myenteric plexus, even in regions without 5-HT cell bodies. Double overlapping dotted white circles indicate two 5-HT neurons in same ganglia. (B) Enlargement of yellow rectangle (A) shows the relationship between nNOS neurons (*) and 5-HT (dotted white circles) neurons. Note the numerous nNOS neurons compared to 5-HT neurons. (C) Expanded view of the pink squares shown in B. Note that 5-HT neurons (green arrows) are surrounded by a dense neuropil of 5HT varicose fibers and nNOS neurons (red arrows).

containing non-varicose and varicose nerve fibers throughout the MP, even in regions of the MP that contained no 5-HT neurons, implying that 5-HT axons

559

T. Okamoto et al.


A

B

C Figure 2 Relationship of 5Hydroxytryptamine (5-HT) neurons and nNOS neurons. (A) Hyperganglionic region of colon. Left hand panel (LHP): Two 5-HT neurons (green arrows) in the same ganglia surrounded by smaller nNOS neurons (red arrows). Center panel: 5-HT only (green channel) shows dense neuropil of 5-HT containing nerve fibers and varicosities around 5-HT neurons. Note that the lower 5-HT neuron appears to be multipolar. Right hand panel (RHP): nNOS neurons and fibers only (red channel; red arrows indicate soma). (B) Similar to A. (C) Similar to A, except figure shows one 5-HT neuron. Dark streak crossing 5-HT neuron is a muscle fiber. (D) Same as C except 5-HT neuron is in the hypoganglionic region within the mesenteric border. (A–D) Dotted yellow circles indicate 5-HT varicosities over nNOS and 5-HT neurons.

D

fibers and their varicosities were often closely associated nNOS varicose nerve fibers, especially when they projected into secondary strands within the circular muscle (CM; Fig. 3A and B). Nearly all 5-HT neurons (13 out of 14 5-HT neurons, 87%; n = 5) were calbindin positive, and on rare occasions, appeared to have Dogiel Type II morphology (Fig. 4). Analysis of their nerve fibers revealed that 5-HT varicosities were also usually co-localized with calbindin. 5-HT varicosities were also closely associated with all calbindin positive neurons, which were 5-HT negative, but had Dogiel Type II/AH neuron morphology (Fig. 4C). Moreover, we observed calbindin varicosities on 5-HT neurons that were not co-localized with 5-HT suggesting that they originated from calbindin positive Dogiel Type II sensory neurons (Fig. 4).

must have considerable divergence (Fig. 1A). Furthermore, there were fewer 5-HT neurons in the distal colon (data not shown). Serotonergic nerve fibers surrounded and coursed over and appeared to make varicose contacts with the cell bodies of all 5-HT neurons and most nNOS neurons (Fig. 2), including inhibitory motor neurons (IMN) with laminar dendrites and dew drop shaped interneurons22. The ratio of serotonergic nerve cell bodies to nNOS neurons was 1 : 14.5 1.9 (5-HT neurons = 19; nNOS neurons = 268; n = 3). Moreover, we occasionally observed that finger like processes (>4 lm in length) projected from the soma of a 5-HT neuron that imbedded themselves into the soma of an nNOS neuron (Fig. 3C). We rarely observed nNOS varicosities closely associated with the soma of serotonergic neurons, although serotonergic nerve

560



A


B

C

D

Figure 3 Relationship between 5-Hydroxytryptamine (5-HT) nerve fibers and nNOS neurons. (A) 5-HT (green arrow) and nNOS (red arrow) neurons and their fibers in and outside a myenteric ganglion. (B) Expanded view of red rectangle (A) shows nNOS and 5-HT fibers on the surface of the circular muscle. Yellow dotted circles show examples of 5-HT varicosities closely associated with nNOS varicosities. (C) 5-HT neuron (green arrow) surrounded by nNOS neurons (red arrows). Yellow dotted circles are regions of 5-HT varicosities closely associated with the 5-HT neuron and n NOS neurons. White arrows indicate finger like processes from the 5-HT neuron embedding into an nNOS neuron. (D) Plot of short axis of neurons against long axis. Green hexagon-5-HT neurons; red circle-calbindin positive but 5HT negative neurons; open rectangle-all nNOS neurons. Note that 5-HT neurons were as large as AH (mitotracker positive) neurons22 but larger than all nNOS neurons (open square). There were two distinct sizes of nNOS neurons; the larger neurons (dark blue square) included inhibitory motor neurons and the smaller neurons included dew drop shaped interneurons (light blue square).

Serotonergic varicosities and glial cells

circumferential orientation (Fig. 6A). The nNOS PMNP was closer to the CM by about 1 lm than the 5-HT nerve plexus. The PMNP contained calbindin positive nerve fibers that may have arisen from 5-HT neurons (see above). The PMNP appeared to sit upon, or be mixed in with, the submucosal pacemaker network (ICC-SM), which like CM cells, were also orientated in a circumferential orientation. Associated with this nerve plexus were often small (one to two neurons) or long, thin ‘perimuscular’ ganglia up to 200 lm in length containing up to eight neurons; these ganglia were only observed in small bands on the lateral side of the mesenteric and antimesenteric borders. Perimuscular ganglia (PMG) contained mainly nNOS positive neurons although nNOS negative neurons were also observed; these neurons were surrounded by numerous serotonergic and nNOS varicosities (Fig. 6B). The PMG moved with the muscle during movements of the colon suggesting they were tightly held in position by the PMNP. They were, however, often observed to join to

We examined the distribution of serotonergic nerve fibers in glial fibrillary acidic protein (GFAP) copGFP mice, which was enhanced by the addition of an antibody to GFAP (n = 4). An intense network of glia cell bodies and their processes throughout the MP were observed (Fig. 5A–C). Using Fluoview software, we observed that glial cell bodies and their processes were closely associated with 5-HT varicosities within a single optical section (0.15 lm; Fig. 5C). However, GFAP staining alone demonstrated cytoskeletal structures in glial cells but not many glial cell bodies (Fig. 5D).

Perimuscular nerve plexus On the mucosal side of the CM, serotonergic nerve fibers were closely associated with nNOS nerve fibers and formed a thin (~2 lm) but extensive perimuscular nerve plexus (PMNP) that had a predominantly


561

T. Okamoto et al.


A

B

C

D

Figure 4 Calbindin immunohistochemistry in myenteric and submucous plexus. (A) 5-Hydroxytryptamine (5-HT) staining (green channel) shows 1 neuron labeled for 5-HT (green arrow) in the ganglia. 3 neurons were labeled for calbindin (red channel). Overlaying these images demonstrated that a 5-HT neuron was not co-labeled with calbindin (green arrow). However, a number of varicose nerve fibers were co-labeled for both 5-HT and calbindin (shown in white image-RHS), suggesting they arose from other 5-HT neurons that were calbindin positive. (B) One neuron was 5-HT positive (left panel; green arrow); 2 neurons were calbindin positive (red channel; red arrows). Overlaying these images demonstrated that 1 neuron co-labeled for 5-HT and calbindin, whereas 1 calbindin neuron that was 5-HT negative had Dogiel Type II morphology, and was associated with 5-HT varicosities. Note that the 5-HT neuron appeared to have Dogiel Type I morphology (white arrow points to axon). A number of varicose nerve fibers were co-labeled for both 5-HT and calbindin (shown in white image-RHS). (C) Two 5-HT neurons (green channel) in the hypoganglionic region were also calbindin positive (red channel). The upper and lower neurons appeared to have Dogiel Type II and I morphology, respectively. A number of varicose nerve fibers were co-labeled for both 5-HT and calbindin (shown in white image-RHS). Note the 5-HT varicosities (green) and calbindin varicosities (red channel) around these neurons, some of which show overlap, whereas others do not show colocalization implying they arise from Dogiel Type II neurons. (D) Calbindin positive neurons in a submucous ganglia that was surrounded by 5-HT varicosities, which appeared to arise from a single nerve fiber.

the larger submucosal ganglia by loosely coiled nerve trunks that contained serotonergic nerve fibers. These coiled nerve trunks likely gave flexibility to the submucosal ganglia during movements of the colon. Perimuscular ganglia contained no calbindin or calretinin positive neurons that were observed in submucosal ganglia (n = 3),38 nor any serotonergic neurons, suggesting that these neurons have a different function than neurons in larger submucosal ganglia (see Discussion).

Submucosal ganglia The larger submucosal ganglia contained both nNOS positive and nNOS negative neurons, as we have previously described38 (Fig. 6). All submucous neurons, none of which were 5-HT positive, were, like neurons in PMG, surrounded by dense serotonergic nerve varicosities, which often formed dense baskets of serotonergic nerve fiber varicosities. Several submucosal ganglia also contained calbindin immunoreactive

562



A


but were not associated with veins (n = 5; Fig. 6A and D). These fibers were observed to send out radial fibers that encompassed the arterial.

B

Serotonergic varicosities and ICC We used c-Kit labeling to examine the relationship between ICC and 5-HT. Serotonergic nerve fiber varicosities were closely associated with myenteric pacemaker ICC (ICC-MY), mainly near the MP, and submucosal pacemaker ICC (ICC-SM; Fig. 7A and B).41,46 Serotonergic varicose nerve fibers were also observed in the CM layer where they were associated with intramuscular ICC (ICC-IM); a close association was observed in a single optical section of 0.15 lm (Fig. 7C).

C

Localization of 5-HT2B receptors RT-PCR was used to determine the relative RNA expression of 5-HT3 and 5-HT2B receptors in isolated ICC and SMCs of the murine colon. Interstitial cells of Cajal express 5-HT2B (gene Htr2b) receptors more readily than 5-HT3 (gene Htr3a) receptors, which had a relatively minor expression in ICC (Fig. 8A). 5-HT2B receptors were observed on the cell bodies and processes of ICC-MY (Fig. 8B) and ICC-IM (Fig. 8C). 5-HT2B receptors were also localized to nerve fiber varicosities throughout MG (Fig. 8D). They were also observed on the soma of a few myenteric neurons. Co-labeling for 5HT and 5-HT2B receptors revealed that they were on different nerve fibers; although, 5-HT varicosities were often closely associated with 5-HT2B varicosities, as this association was observed in a single optical section of 0.15 lm (Fig. 8E). This suggests that 5-HT2B receptors are both postsynaptic and presynaptic receptors.

D

Figure 5 5-Hydroxytryptamine (5-HT) varicosities associated with glia. (A and B) glial fibrillary acidic protein (GFAP) labeling was used to enhance staining of glia in GFAP copGFP mouse. 5-HT nerve varicosities (red) were associated with some glial cell bodies and processes. (C) Expanded area of yellow rectangular region shown in (B). Cross sections (right and lower thin panels) taken through the vertical and horizontal yellow lines with Fluoview software demonstrate that 5-HT varicosities were on the same plane and closely associated with glia (green). (D) Double labeling with 5-HT (green) and GFAP (red). Note GFAP doesn’t clearly show nuclei but mainly glial cell processes. However, 5-HT varicosities (green) are closely associated with many glial cell processes.

DISCUSSION Despite the relative scarcity of myenteric 5-HT neurons, even in the proximal to mid murine colon where their density is the highest, they probably innervate a large number of targets, some of which we have identified, as shown schematically in Fig. 9. Moreover, our studies demonstrate a number of important features of myenteric 5-HT neurons, as they: (1) have cell bodies only in the MP; (2) most are calbindin positive; (3) larger than myenteric nNOS neurons, but similar in size to Dogiel TypeII/AH neurons; (4) their axons form a dense varicose network throughout the MP; (5) appear to synapse with each other; (6) appear to make varicose contacts with many myenteric nNOS and calbindin positive neurons, and glial cells; (7) are sparse compared to

neurons (one to six per ganglia) that were also surrounded by 5-HT varicosities (Fig. 4D). Submucous ganglia, like PMG, appeared to be asymmetrically distributed around the proximal to mid colon, being mainly confined to four bands close to the lateral sides of the mesenteric and antimesenteric borders (see below).

Sumucosal arterioles Serotonergic nerve fibers were also observed running along and parallel to the adventitial border of arteries


563

T. Okamoto et al.


A

B

C

D

Figure 6 Perimuscular and submucous plexus and blood vessels. (A) 5-Hydroxytryptamine (5-HT; green) and nNOS (red) immunohistchemstry of submucosal layer. White and yellow ellipses outline submucosal and perimuscular ganglia and arteries. White filled arrows border arterioles lined by 5-HT fibers (green), whereas the white circles are inside and track the arterioles. (B) Left hand panels, i and ii). Small perimuscular ganglia containing nNOS (red arrows) and nNOS negative (purple arrow) neurons lying within the thin perimuscular nerve network of nNOS and 5-HT fibers. Orange circles indicate close apposition of 5-HT varicosities. Right hand panel: long perimuscular ganglia, orientated circumferentially, containing nNOS positive (red) and negative (purple) neurons surrounded by 5-HT varicosities (example in orange circle). (C) i) A submucosal ganglia containing nNOS positive (red arrows) and negative (purple arrows) neurons surrounded by a dense network of 5-HT varicosities (green). ii) submucosal ganglia, without nNOS neurons, encapsulated by 5-HT varicosities. (D) Dotted lines outline arteriole (left) and vein (right). Note that 5-HT fibers run along the adventitial border and over the body of the arteriole (white circles) but not the vein.

myenteric nNOS neurons (ratio of 5-HT to nNOS neurons 1 : 15); (8) appear to receive varicose inputs from Dogiel Type II sensory neurons; (9) along with nNOS fibers, form a thin nerve plexus associated with the ICC-SM pacemaker network; (10) surround neurons in PMG, and submucosal ganglia, which also include calbindin positive neurons; (11) are closely associated with submucosal arterioles but not veins; and (12) appear to make direct varicose contacts with pacemaker ICC-MY and ICC-SM, and with ICC-IM in the CM. Furthermore, (13) 5-HT2B receptors are expressed on ICC-IM and ICC-MY, and on a subpopulation of non-5-HT neurons and their axons. The axons of serotonergic neurons must be very divergent to form the two extensive neural networks in the myenteric and perimuscular plexus, and innervate all submucosal ganglia and project to ICC and blood vessels. Our studies strongly suggest that 5-HT neurons are not just interneurons, as commonly assumed, but may also function as motor neurons to ICC and arterioles, and some may even be sensory neurons.24

Relationship of 5-HT varicosities to myenteric nNOS neurons It appeared that 5-HT varicosities were closely associated with most myenteric nNOS neurons that include both the larger inhibitory motor neurons (IMNs) and the smaller interneurons.22 Although 5HT varicosities are rarely associated with nNOS neurons in the small intestine,12,47 this doesn’t appear to be the case in the colon. Our immunohistochemical data supports the hypothesis that 5-HT neurons synapse with myenteric IMNs to generate tonic inhibition of the CM, and the preceding inhibition necessary for propagating CMMCs down the murine large intestine.6,7,22,35–37,48 Vagal pathways appear to activate 5-HT neurons that excite IMNs to produce receptive relaxation of the stomach49; whereas, 5-HT neurons in the small intestine appear to be involved in ascending excitation but not descending inhibition.50

564




which are sensory neurons,16,22 suggesting that they activate AH sensory neurons to generate the CMMC.6 The fact that some varicosities on 5-HT neurons were calbindin positive but 5-HT negative suggests that they also receive inputs from AH neurons that project to the mucosa.16,22 Furthermore, we also found calbindin positive neurons in several submucosal ganglia, which were also surrounded by 5-HT varicosities. Whether these neurons have a sensory function in the mouse colon needs further examination.16

A

B

5-HT varicosities and myenteric glial cells We observed that myenteric glia cell bodies and their processes are closely associated with 5-HT varicosities, implying that 5-HT is likely a neurotransmitter to glia cells as well enteric neurons. We have recently shown that myenteric glial cells, which have nicotinic and tachykinin receptors, are not just supportive cells but function like neurons as integrators of synaptic input, and are active participators in colonic motility.51

C

Perimuscular ganglia Perimuscular ganglia appear to be part of the extensive PMNP lying directly upon the submucosal ICC-SM layer that is likely the murine equivalent of the ganglionated network called Henle’s plexus observed in large mammals,52 which regulates submucosal slow wave activity.53 nNOS neurons in PMG are likely to be IMNs to the ICC-SM layer. nNOS fibers in the perimuscular nerve network may arise from nNOS neurons in PMG.52

Figure 7 5-Hydroxytryptamine (5-HT) and ICC. (A) Left panel: c-Kit (red) mouse exhibited a dense network of myenteric pacemaker ICC (ICC-MY; red). 5-HT varicose nerve fibers (green) left the ganglion and entered the ICC-MY pacemaker network. Right panel: Enlargement of area outlined by yellow panel on left. Cross sections (Fluoview software) through the vertical (right) and horizontal (lower) directions (yellow lines) demonstrate that 5-HT varicosities (red) were on the same plane and closely associated with ICC-MY (green). (B) Left panel: c-Kit (red) combined with 5-HT (green) immunoreactivity demonstrated that 5-HT varicose nerve fibers also ran parallel to submucosal pacemaker ICC (ICC-SM), which had a circular orientation. Right hand panel: Enlargement of area outlined by yellow panel to the left. Cross sections through the vertical (right) and horizontal (lower) directions (yellow lines) demonstrate that 5-HT varicosities (green) were on the same plane and closely associated with ICC-SM (red). (C) c-Kit (red) combined with 5-HT (green) immunoreactivity demonstrated that 5-HT varicose nerve fibers entered the myenteric circular muscle and were observed running parallel and close to ICC-IM. Examples of close apposition between 5-HT varicosities and ICCs are shown by dotted yellow circles.

Submucosal arterioles and 5-HT It is generally assumed that extrinsic sympathetic nerves constrict intestinal blood vessels (BV)54, whereas vasodilator neurons (VD) in the submucous plexus, which release VIP and ACh, relax arterioles during secretomotor reflexes to increase blood flow.38,55,56 We were, therefore, surprised to find serotonergic nerve varicosities around all submucosal arterioles, because 5-HT normally constricts BVs.57,58 5-HT fibers are found around cerebral and small mesenteric arteries just outside the intestine, which probably derived from intrinsic 5-HT neurons, have also been observed.58,59 Therefore, myenteric 5-HTneurons, in contrast to submucosal neurons, may also directly constrict arterioles. This may explain why, when studying secretomotor reflexes38, we observed what we thought at the time was an

Myenteric 5-HT neurons and calbindin positive neurons In the murine colon, most 5-HT neurons where calbindin positive, as they are in the guinea-pig colon and fish gut,16,24 5-HT varicosities were closely associated with calbindin positive Dogiel Type II neurons,


565

T. Okamoto et al.


Figure 8 5-Hydroxytryptamine (5-HT2B) receptors. (A) RT-PCR: Relative intensity of expression of 5-HT3 (mHtr3) and 5-HT2B (mHTr2b expression) on isolated unsorted cells, smooth muscle cells (SMCs) and ICC from muscularis externa. (B) 5-HT2B receptors were observed surrounding the nucleus and on the processes of ICC-MY. (C) 5-HT2B receptors were sparsely associated with intramuscular ICC (ICC-IM). (D) 5-H2B receptor distribution through the myenteric plexus (green) lying over the ICC-MY layer (red). 5-HT2B receptors were found along nerve fibers and were associated with the cell body of 1 intensely stained neuron (green arrow) and surrounded two other neurons (pink arrows; large dotted circles). Small dotted circles are examples of 5-HT2B receptors on ICC-MY. (E) 5-HT2B receptors (red) were not co-localized with 5-HT nerve fibers (green), although 5-HT varicosities were often in close association with 5-HT2B receptors (see right hand panel).

mission60 and myenteric and ICC-SM, which generate myenteric potential oscillations and slow waves, respectively.6,37,46,53,48 The occurrence of 5-HT fiber varicosities associated with ICC suggest they may act to directly activate ICC and/or modulate neurotransmitter release from motor nerves.37 It has been demonstrated that 5-HT2B receptors are important in the development of ICC.27 We found that 5-HT2B receptors were located on the soma and varicose nerve fibers of a sub population of non-5-HT myenteric neurons, suggesting that they are both postsynaptic and presynaptic receptors. They also surround and are upon pacemaker ICC suggesting that these receptors may mediate direct responses from serotonergic nerves. What is known is that blocking

anomalous local constriction of some submucosal BVs during an evoked CMMC (Okamoto & Smith, unpublished results). These differences may be attributed to the fact that previous studies have preconstricted BVs by 80–90% in order to observe dilation during neural reflexes.55,56 Regulation of colonic blood flow in the colon is possibly more complex than is generally assumed, because myenteric 5-HT neurons conceivably not only activate submucous VDs but also directly constrict submucosal arterioles.

5-HT2B receptors on myenteric neurons and ICC We found that 5-HT varicosities were closely associated with ICC-IM that mediate nitrergic neurotrans-

566




5-HT2B receptors, which are also located in the MP of the human colon, reduces the nerve evoked contractions and excitatory responses to 5-HT in human colon and peristaltic contractions in rat colon, implying that targeting this receptor, like the 5-HT4 receptor, could be important clinically.61,62

A

CONCLUSIONS The proposed targets of serotonergic neurons are shown in Fig. 9. We have assumed that 5-HT neurons have a preferential anal direction, as suggested by lesion studies (see Introduction). Whether each 5-HT neuron synapses with every target was not determined. Although, this possibility certainly exists as there are a relatively small number of these neurons. We suggest that despite their relatively low number, 5-HT neurons may function, via their great divergence, as a type of ‘central processing unit’ in the colon. By innervating many targets, these neurons may help coordinate complex behaviors requiring responses from several functional units of the colon. For example, they may generate or coordinate stereotypical patterns of behavior, such as tonic inhibition of the muscle and ICC between CMMCs, generate or propagate CMMCs, and couple these activities to secretomotor reflexes and blood flow.6,7,22,35–38,48 Although myenteric IMNs reduce their activity during the CMMC,22,37 5-HT neurons continue firing (Birch, Okamoto & Smith, unpublished observations). Their importance is emphasized by the observation that tyrosine hydroxylase nerve varicosities preferentially form pericellular baskets around 5-HT neurons.63 In turn, myenteric 5-HT neurons appear to innervate sympathetic neurons in prevertebral ganglia suggesting they are intestinofugal neurons.63 Underscoring the significance of neuronal 5-HT, the giant cerebral serotonergic neuron in Aplysia (sea slug) which mediates a number of behaviors including arousal and feeding, also has a diverse array of postsynaptic targets that include glial cells, other neurons and their axons, muscle, gut, and glands.64 In invertebrate neurobiology, a neuron (or a group of neurons) that initiates a complete, coordinated stereotypical patterns of behavior is referred to as a command neuron.65

B

Figure 9 Schematic illustration of the potential projections of myenteric 5-Hydroxytryptamine (5-HT) neurons. (A) Myenteric 5-HT neurons (red): appear to synapse with one another; innervate most myenteric nNOS positive inhibitory motor neurons (IMNs) that innervate ICC-MY and the upper circular muscle; synapse with myenteric interneurons (Int neuron), which likely contain ACh and nNOS16; make close contacts with glia (yellow); form the perimuscular nerve plexus along with nNOS fibers, which probably originate from perimuscular ganglia (PMG), innervate the ICC-SM layer and lower circular muscle; synapse with nNOS neurons (IMNs) in perimuscular ganglia (PMG) that likely control ICC-SM; synapse with all neurons in submucous ganglia (SMG) that regulates secretomotor reflexes and relaxes arterioles (-); directly innervate arterioles to produce contraction (+); synapse directly with ICC-MY, which generate myenteric potential oscillations (MPOs), and ICC-SM, which generate slow waves, and make close contacts with ICC-IM, which mediate nitrergic neurotransmission. MPO and slow wave activity recorded from murine colonic ICC-MY and ICC-SM respectively, using Ca2+ imaging after TTX (1 lM).22 CM and LM: circular and longitudinal muscle; PVG-prevertebral ganglia; MP: myenteric plexus; VD: vasodilator; BV: blood vessel. (B) A cartoon illustrating the asymmetric distribution of the LM, myenteric (MG), perimuscular (PMG) and submucosal ganglia around the murine proximal-mid colon. MG are smaller at the mesenteric and antimesenteric borders. SMG and PMG appear to be more dense on the lateral sides of the mesenteric and antimesenteric borders. The 5-HT neurons and their proposed projections are shown in red. Several myenteric ICC (ICC-MY; orange), submucosal ICC (ICC-SM; blue) and intramuscular ICC (purple; ICCIM) are drawn in for illustrative purposes only, as these networks are dense and, as yet, we don’t know their distribution around the colon. BV is arteriole.


ACKNOWLEDGMENTS Loren E Peri (funded by KMS) carried out RT-PCR analysis.

FUNDING Support: National Institute of Diabetes and Digestive and Kidney Diseases: RO1 DK45713 (TKS); PO1 DK 041315-26 (KMS and

567

T. Okamoto et al.


SDK). Imaging was performed in a Core lab, funded by NIH Grant P20 RR-1875.

and helped with the methods section. GWH developed methods to analyze varicosity distributions around specific neurons using his own software (volumetry GWH9). SDK supervised RT-PCR analysis on dispersed ICC and provided the antibody to 5-HT2B receptors. KMS provided valuable discussion, suggestions for figures and reviewed the manuscript. TKS wrote the final manuscript, directed the overall project, data analysis, and construction of figures. All authors read and approved the manuscript.

DISCLOSURE There are no conflicts of interest to disclose.

AUTHOR CONTRIBUTION TO performed and trained MJB, GCB, NG, RDC in 5-HT immunohistochemistry, confocal analysis and image acquisition

REFERENCES 1 Azmitia EC. Modern views on an ancient chemical: serotonin effects on cell proliferation, maturation, and apoptosis. Brain Res Bull 2001; 56: 413–24. 2 Wu WH, Cooper RL. Serotonin and synaptic transmission at invertebrate neuromuscular junctions. Exp Neurobiol 2012; 21: 101–12. 3 Gershon MD. Serotonin is a sword and a shield of the bowel: serotonin plays offense and defense. Trans Am Clin Climatol Assoc 2012; 123: 268– 80. 4 Cirillo C, Vanden Berghe P, Tack J. Role of serotonin in gastrointestinal physiology and pathology. Minerva Endocrinol 2011; 36: 311–24. Review. 5 De Giorgio R, Barbara G, Furness JB, Tonini M. Novel therapeutic targets for enteric nervous system disorders. Trends Pharmacol Sci 2007; 28: 473– 81. 6 Dickson EJ, Heredia DJ, Smith TK. Critical role of 5-HT1A, 5-HT3, and 5-HT7 receptor subtypes in the initiation, generation, and propagation of the murine colonic migrating motor complex. Am J Physiol Gastrointest Liver Physiol 2010; 299: G144– G157. 7 Heredia DJ, Gershon MD, Koh SD, Corrigan RD, Okamoto T, Smith TK. Important role of mucosal serotonin in colonic propulsion and peristaltic reflexes: in vitro analyses in mice lacking tryptophan hydroxylase 1. J Physiol 2013; 591: 5939–57. 8 Hoffman JM, Tyler K, MacEachern SJ, Balemba OB, Johnson AC, Brooks EM, Zhao H, Swain GM et al. Activation of colonic mucosal 5-HT(4) receptors accelerates propulsive motility and inhibits visceral hypersensitivity. Gastroenterology 2012; 142: 844–854.

9 Furness JB, Costa M. Neurons with 5-hydroxytryptamine-like immunoreactivity in the enteric nervous system: their projections in the guinea-pig small intestine. Neuroscience 1982; 7: 341–9. 10 Mawe GM, Schemann M, Wood JD, Gershon MD. Immunocytochemical analysis of potential neurotransmitters present in the myenteric plexus and muscular layers of the corpus of the guinea pig stomach. Anat Rec 1989; 224: 431–42. 11 Wardell CF, Bornstein JC, Furness JB. Projections of 5-hydroxytryptamineimmunoreactive neurons in guineapig distal colon. Cell Tissue Res 1994; 278: 379–87. 12 Young HM, Furness JB. Ultrastructural examination of the targets of serotonin-immunoreactive descending interneurons in the guinea pig small intestine. J Comp Neurol 1995; 356: 101–14. 13 Barbiers M, Timmermans JP, Adriansen D, De Groodt-Lasseel MH, Scheuermann DW. Projections of neurochemically specified neurons in the porcine colon. Histochem Cell Biol 1995; 103: 115–26. 14 Sang Q, Williamson S, Young HM. Projections of chemically identified myenteric neurons of the small and large intestine of the mouse. J Anat 1997; 190(Pt 2): 209–22. 15 Sang Q, Young HM. The identification and chemical coding of cholinergic neurons in the small and large intestine of the mouse. Anat Rec 1998; 251: 185–99. 16 Lomax AE, Furness JB. Neurochemical classification of enteric neurons in the guinea-pig distal colon. Cell Tissue Res 2000; 302: 59–72. 17 Tassicker BC, Hennig GW, Costa M, Brookes SJ. Rapid anterograde and retrograde tracing from mesenteric nerve trunks to the guinea-pig small

568

18

19

20

21

22

23

24

25

intestine in vitro. Cell Tissue Res 1999; 295: 437–52. Griffith SG, Burnstock G. Serotoninergic neurons in human fetal intestine: an immunohistochemical study. Gastroenterology 1983; 85: 929–37. Furness JB, Young HM, Pompolo S, Bornstein JC, Kunze WA, McConalogue K. Plurichemical transmission and chemical coding of neurons in the digestive tract. Gastroenterology 1995; 108: 554–63. Sharrad DF, Chen BN, Brookes SJ. Neurochemical coding compared between varicose axons and cell bodies of myenteric neurons in the guinea-pig ileum. Neurosci Lett 2013; 534: 171–6. Reiche D, Huber K, Hoppe S, Schemann M. Neurochemically distinct myenteric neurone populations containing calbindin have specific distribution patterns around the circumference of the gastric corpus. Cell Tissue Res 2001; 303: 319–28. Bayguinov PO, Hennig GW, Smith TK. Calcium activity in different classes of myenteric neurons underlying the migrating motor complex in the murine colon. J Physiol 2010a; 588: 399–421. Furness JB, Robbins HL, Xiao J, Stebbing MJ, Nurgali K. Projections and chemistry of Dogiel type II neurons in the mouse colon. Cell Tissue Res 2004; 317: 1–12. Olsson C. Calbindin-immunoreactive cells in the fish enteric nervous system. Auton Neurosci 2011; 159: 7–14. Li Z, Chalazonitis A, Huang YY, Mann JJ, Margolis KG, Yang QM, Kim DO, Cote F et al. Essential roles of enteric neuronal serotonin in gastrointestinal motility and the development/survival of enteric dopaminergic neurons. J Neurosci 2011; 31: 8998–9009.



26 Fiorica-Howells E, Maroteaux L, Gershon MD. Serotonin and the 5HT(2B) receptor in the development of enteric neurons. J Neurosci 2000; 20: 294–305. 27 Tharayil VS, Wouters MM, Stanich JE, Roeder JL, Lei S, Beyder A, Gomez-Pinilla PJ, Gershon MD et al. Lack of serotonin 5-HT2B receptor alters proliferation and network volume of interstitial cells of Cajal in vivo. Neurogastroenterol Motil 2010; 22: 462–10. 28 Wood JD, Mayer CJ. Slow synaptic excitation mediated by serotonin in Auerbach’s plexus. Nature 1978; 276: 836–7. 29 Pan H, Galligan JJ. 5-HT1A and 5HT4 receptors mediate inhibition and facilitation of fast synaptic transmission in enteric neurons. Am J Physiol 2001; 266: G230–G238. 30 Galligan JJ. Electrophysiological studies of 5-hydroxytryptamine receptors on enteric neurons. Behav Brain Res 1996; 73: 199–201. 31 Monro RL, Bornstein JC, Bertrand PP. Slow excitatory post-synaptic potentials in myenteric AH neurons of the guinea-pig ileum are reduced by the 5-hydroxytryptamine7 receptor antagonist SB 269970. Neuroscience 2005; 134: 975–86. 32 Grider JR, Kuemmerle JF, Jin JG. Distinct 5-HT receptors mediate the peristaltic reflex induced by mucosal stimuli in human and guinea pig intestine. Am J Physiol 1996; 270(5 Pt 1): G778–G782. 33 Foxx-Orenstein AE, Kuemmerle JF, Grider JR. Propulsion in guinea pig colon induced by 5-hydroxytryptamine (HT) via 5-HT4 and 5-HT3 receptors. Gastroenterology 1996; 111: 1281–90. 34 Kuhn DM, Wolf WA, Youdim MB. 5Hydroxytryptamine release in vivo from a cytoplasmic pool: studies on the 5-HT behavioural syndrome in reserpinized rats. Br J Pharmacol 1985; 84: 121–29. 35 Heredia DJ, Dickson EJ, Bayguinov PO, Hennig GW, Smith TK. Localized release of serotonin (5-hydroxytryptamine) by a fecal pellet regulates migrating motor complexes in murine colon. Gastroenterology 2009; 136: 1328–38. 36 Heredia DJ, Grainger N, McCann CJ, Smith TK. Insights from a novel model of slow-transit constipation generated by partial outlet obstruction in the murine large intestine.



37

38

39

40

41

42

43

44

45

Am J Physiol Gastrointest Liver Physiol 2012; 303: G1004–G1016. Bayguinov PO, Hennig GW, Smith TK. Ca2+ imaging of activity in ICCMY during local mucosal reflexes and the colonic migrating motor complex in the murine large intestine. J Physiol 2010b; 588: 4453–74. Okamoto T, Bayguinov PO, Broadhead MJ, Smith TK. Ca(2+) transients in submucous neurons during the colonic migrating motor complex in the isolated murine large intestine. Neurogastroenterol Motil 2012; 24: 769–78, e354. Spencer NJ, Nicholas SJ, Robinson L, Kyloh M, Flack N, Brookes SJ, Zagorodnyuk VP, Keating DJ. Mechanisms underlying distension-evoked peristalsis in guinea pig distal colon: is there a role for enterochromaffin cells? Am J Physiol Gastrointest Liver Physiol 2011; 301: G519–G527. Spencer NJ, Nicholas SJ, Sia TC, Staikopoulos V, Kyloh M, Beckett EA. By what mechanism does ondansetron inhibit colonic migrating motor complexes: does it require endogenous serotonin in the gut wall? Neurogastroenterol Motil 2013; 25: 677–85. Sia TC, Flack N, Robinson L, Kyloh M, Nicholas SJ, Brookes SJ, Wattchow DA, Dinning P et al. Is serotonin in enteric nerves required for distensionevoked peristalsis and propulsion of content in guinea-pig distal colon? Neuroscience 2013; 240: 325–35. Sia TC, Whiting M, Kyloh M, Nicholas SJ, Oliver J, Brookes SJ, Dinning PG, Wattchow DA et al. 5-HT3 and 5-HT4 antagonists inhibit peristaltic contractions in guinea-pig distal colon by mechanisms independent of endogenous 5-HT. Front Neurosci 2013; 7: 136. Meedeniya AC, Brookes SJ, Hennig GW, Costa M. The projections of 5-hydroxytryptamine-accumulating neurones in the myenteric plexus of the small intestine of the guinea-pig. Cell Tissue Res 1998; 291: 375–84. Hwang SJ, Blair PJ, Britton FC, O’Driscoll KE, Hennig G, Bayguinov YR, Rock JR, Harfe BD et al. Expression of anoctamin 1/TMEM16A by interstitial cells of Cajal is fundamental for slow wave activity in gastrointestinal muscles. J Physiol 2009; 587(Pt 20): 4887–904. Sibaev A, Franck H, Vanderwinden JM, Allescher HD, Storr M. Structural differences in the enteric neural net-

569

46

47

48

49

50

51

52

53

54

55

work in murine colon: impact on electrophysiology. Am J Physiol Gastrointest Liver Physiol 2003; 285: G1325–34. Lee HT, Hennig GW, Park KJ, Bayguinov PO, Ward SM, Sanders KM, Smith TK. Heterogeneities in ICC Ca2+ activity within canine large intestine. Gastroenterology 2009; 136: 2226–36. Bornstein JC, Costa M, Grider JR. Enteric motor and interneuronal circuits controlling motility. Neurogastroenterol Motil 2004; 16(Suppl 1): 34–88. Dickson EJ, Heredia DJ, McCann CJ, Hennig GW, Smith TK. The mechanisms underlying the generation of the colonic migrating motor complex in both wild-type and nNOS knockout mice. Am J Physiol Gastrointest Liver Physiol 2010b; 298: G222– G232. B€ ulbring E, Gershon MD. 5-hydroxytryptamine participation in the vagal inhibitory innervation of the stomach. J Physiol 1967; 192: 823–46. Yuan SY, Bornstein JC, Furness JB. Investigation of the role of 5-HT3 and 5-HT4 receptors in ascending and descending reflexes to the circular muscle of guinea-pig small intestine. Br J Pharmacol 1994; 112: 1095–100. Broadhead MJ, Bayguinov PO, Okamoto T, Heredia DJ, Smith TK. Ca2+ transients in myenteric glial cells during the colonic migrating motor complex in the isolated murine large intestine. J Physiol 2012; 590: 335–50. Furness JB, Lloyd KC, Sternini C, Walsh JH. Projections of substance P, vasoactive intestinal peptide and tyrosine hydroxylase immunoreactive nerve fibres in the canine intestine, with special reference to the innervation of the circular muscle. Arch Histol Cytol 1990; 53: 129–40. Sanders KM, Smith TK. Motoneurones of the submucous plexus regulate electrical activity of the circular muscle of canine proximal colon. J Physiol 1986; 380: 293–310. Evans RJ, Surprenant A. Vasoconstriction of guinea-pig submucosal arterioles following sympathetic nerve stimulation is mediated by the release of ATP. Br J Pharmacol 1992; 106: 242–9. Vanner S. Myenteric neurons activate submucosal vasodilator neurons in guinea pig ileum. Am J Physiol Gas-

T. Okamoto et al.

56

57

58

59

trointest Liver Physiol 2000; 279: G380–387. Reed DE, Vanner SJ. Long vasodilator reflexes projecting through the myenteric plexus in guinea-pig ileum. J Physiol 2003; 553(Pt 3): 911–24. Vanhoutte PM. Cardiovascular effects of serotonin. J Cardiovasc Pharmacol 1987; 10(Suppl 3): S8–11. Lincoln J. Innervation of cerebral arteries by nerves containing 5-hydroxytryptamine and noradrenaline. Pharmacol Ther 1995; 68: 473–501. Griffith SG, Burnstock G. Immunohistochemical demonstration of serotonin in nerves supplying human cerebral and mesenteric blood-vessels. Some speculations about their involvement in vascular disorders. Lancet 1983; 1: 561–2.


60 Sanders KM, Koh SD, Ro S, Ward SM. Regulation of gastrointestinal motility–insights from smooth muscle biology. Nat Rev Gastroenterol Hepatol 1986; 9: 633–45. 61 Borman RA, Tilford NS, Harmer DW, Day N, Ellis ES, Sheldrick RL, Carey J, Coleman RA et al. 5-HT(2B) receptors play a key role in mediating the excitatory effects of 5-HT in human colon in vitro. Br J Pharmacol 2002; 135: 1144–51. 62 Bassil AK, Taylor CM, Bolton VJ, Gray KM, Brown JD, Cutler L, Summerfield SG, Bruton G et al. Inhibition of colonic motility and defecation by RS-127445 suggests an involvement of the 5-HT2B receptor in rodent large bowel physiology. Br J Pharmacol 2009; 158: 252–8.

570

63 Karhula T, Soinila S, Lakomy M, Majewski M, Kaleczyk J, H€app€ ol€a O. 5-Hydroxytryptamine-immunoreactive nerve fibers in the rat and porcine prevertebral sympathetic ganglia: effect of precursor loading and relation to catecholaminergic neurons. Neurosci Lett 1995; 194: 85–8. 64 Schwartz JH, Shkolnik LJ. The giant serotonergic neuron of Aplysia: a multi-targeted nerve cell. J Neurosci 1981; 1: 606–19. 65 Edwards DH, Heitler WJ, Krasne FB. Fifty years of command neurons: the neurobiology of escape behavior in the crayfish. Trends Neurosci 1999; 22: 153–61.


Subset specification of central serotonergic neurons.

Quantitative re-evaluation of descending serotonergic and non-serotonergic projections from the medulla of the rodent: evidence for extensive co-existence of serotonin and peptides in the same spinally projecting neurons, but not from the nucleus raphe magnus.

Microiontophoresis and single-unit recordings of serotonergic neurons in the awake cat.

Efferent projections of different subpopulations of central noradrenaline neurons.

Evidence for projections from medullary nuclei onto serotonergic and dopaminergic neurons in the midbrain dorsal raphe nucleus of the rat.

Trypanosomiasis-induced megacolon illustrates how myenteric neurons modulate the risk for colon cancer in rats and humans.

Role of central serotonergic neurons in the effect of sertraline in rats in the forced swimming test.

Projections of ventromedial hypothalamic neurons to the midbrain central gray: an ultrastructural study.

Inhibitory motor neurons of the esophageal myenteric plexus are mechanosensitive.

Effects of endorphins on single myenteric neurons.

The ganglionic origins and central projections of primary sensory neurons innervating the upper and lower lips in the rat.

An immunohistochemical study of the myenteric plexus of the colon in the rat and mouse.

Central projections of gustatory receptor neurons in the medial and the lateral sensilla styloconica of Helicoverpa armigera larvae.

Serotonergic projections from the nucleus raphe dorsalis to the amygdala in the rat.

Tryptophan hydroxylase: activation in vivo following stimulation of central serotonergic neurons.

Serotonergic neurons in the brainstem modulate animal hypnosis.

Locations and central projections of neurons associated with the retrocerebral neuroendocrine complex of the cockroach Periplaneta americana (L.).

Cannabinoid type-1 receptor signaling in central serotonergic neurons regulates anxiety-like behavior and sociability.

Population projections: why they are often wrong.

Central projections of auditory nerve fibers in the barn owl.

Central projections of cochlear nerve fibers in the alligator lizard.

Neurochemical characterization of extrinsic nerves in myenteric ganglia of the guinea pig distal colon.

Serotonergic neurons in the ventral nerve cord of Chilopoda - a mandibulate pattern of individually identifiable neurons.

Prostaglandins and central serotonergic activity in the rat.