Fungal Genetics and Biology 80 (2015) 43–52

Contents lists available at ScienceDirect

Fungal Genetics and Biology journal homepage: www.elsevier.com/locate/yfgbi

Tools and Techniques

Expression vectors for C-terminal fusions with fluorescent proteins and epitope tags in Candida glabrata Patricia Yáñez-Carrillo, Emmanuel Orta-Zavalza, Guadalupe Gutiérrez-Escobedo, Araceli Patrón-Soberano, Alejandro De Las Peñas, Irene Castaño ⇑ IPICYT, Instituto Potosino de Investigación Científica y Tecnológica, División de Biología Molecular, Camino a la Presa San José # 2055, Lomas 4a sección, San Luis Potosí, San Luis Potosí 78216, Mexico

a r t i c l e

i n f o

Article history: Received 10 January 2015 Revised 1 April 2015 Accepted 27 April 2015 Available online 15 May 2015 Keywords: Candida glabrata Translational fusion Fluorescent tag Epitope tag Overexpression vector Integrative vector

a b s t r a c t Candida glabrata is a haploid yeast considered the second most common of the Candida species found in nosocomial infections, accounting for approximately 18% of candidemias worldwide. Even though molecular biology methods are easily adapted to study this organism, there are not enough vectors that will allow probing the transcriptional and translational activity of any gene of interest in C. glabrata. In this work we have generated a set of expression vectors to systematically tag any gene of interest at the carboxy-terminus with three different fluorophores (CFP, YFP and mCherry) or three epitopes (HA, FLAG or cMyc) independently. This system offers the possibility to generate translational fusions in three versions: under the gene’s own promoter integrated in its native locus in genome, on a replicative plasmid under its own promoter, or on a replicative plasmid under a strong promoter to overexpress the fusions. The expression of these translational fusions will allow determining the transcriptional and translational activity of the gene of interest as well as the intracellular localization of the protein. We have tested these expression vectors with two biosynthetic genes, HIS3 and TRP1. We detected fluorescence under the microscope and we were able to immunodetect the fusions using the three different versions of the system. These vectors permit coexpression of several different fusions simultaneously in the same cell, which will allow determining protein–protein and protein–DNA interactions. This set of vectors adds a new toolbox to study expression and protein interactions in the fungal pathogen C. glabrata. Ó 2015 Elsevier Inc. All rights reserved.

1. Introduction Several Candida species are part of the microbiota that normally colonizes the oral, vaginal and gastrointestinal mucosa in healthy individuals. However, critically ill patients with a severely compromised immune system can become susceptible to invasive fungal infections that can be life threatening. Different species of the genus Candida are the most commonly found fungal pathogen in nosocomial blood stream infections (BSI) worldwide (Pfaller et al., 2012: 323–31; Yapar, 2014: 95–105). The incidence of candidemia rose considerably in the late 1990s and has continued to increase in the last decade, particularly in the US where the proportion of Candida species from blood cultures increased from 8% in 1995 to 12% in 2002 (Wisplinghoff et al., 2004: 309–17). In a population-based study the incidence of hospitalizations due to candidemia rose approximately by 50% from 2000 to 2005 (Zilberberg et al., 2008: 978–80); while in some in some ⇑ Corresponding author. Tel.: +52 444 834 2038; fax: +52 444 834 2010. E-mail address: [email protected] (I. Castaño). http://dx.doi.org/10.1016/j.fgb.2015.04.020 1087-1845/Ó 2015 Elsevier Inc. All rights reserved.

European countries the incidence has also increased sharply from 1999 to 2009 (Tortorano et al., 2013: 655–62). More recently, in the US the incidence has still not decreased (Pfaller et al., 2012: 323–31; Yapar, 2014: 95–105). Some of the risk factors associated with candidemia are prolonged stays in the Intensive Care Units (ICU), the use of vascular catheters, long course treatment with antimicrobial drugs, invasive surgical procedures and immunosuppression of the host due to underlying diseases or chemotherapy treatment (Pappas et al., 2003: 634–43, Pfaller et al., 2012: 323– 31). In addition, the associated mortality of invasive candida infections is very high, from 30% to 70% (Gudlaugsson et al., 2003: 1172–7; Horn et al., 2009: 1695–703, Lass-Florl, 2009: 197–205, Richardson and Lass-Florl, 2008: 5–24, Wisplinghoff et al., 2004: 309–17). Even though there are more than 150 different species of the Candida genus, only 17 of them are known to cause disease in humans. The distribution of Candida species varies from region to region, but worldwide, over 90% of the candidemias are due to 5 species (Lass-Florl, 2009: 197–205). Even though Candida albicans is the most frequent of these 5 species, its frequency has declined from 1993 to 2009, and Candida glabrata is the second

44

P. Yáñez-Carrillo et al. / Fungal Genetics and Biology 80 (2015) 43–52

most commonly found in the US (Pfaller et al., 2012: 323–31, Pfaller and Diekema, 2007: 133–63). In Latin America the distribution is different, and while C. albicans is also the most common species isolated from candidemia patients in all the countries where it has been reported, C. glabrata is the third (Corzo-Leon et al., 2014: e97325) or the fourth most common species depending on the country where the study has been conducted (Nucci et al., 2013: e59373). C. glabrata is a haploid yeast that causes superficial and invasive infections, and it is the second most frequent species in candidemias in intensive care units in the US (Pfaller and Diekema, 2010: 1–53). Invasive infections caused by C. glabrata are difficult to treat because it is innately less susceptible to azole compounds that are used in hospitals (Kaur et al., 2005: 378–84). Several virulence factors have been studied in C. glabrata, such as the ability to adhere tightly to epithelial cells in vitro (Castano et al., 2005: 1246–58; Cormack et al., 1999: 578–82; De Las Penas et al., 2003: 2245–58), its high resistance to oxidative stress (Cuellar-Cruz et al., 2008: 814–25) and the ability to form biofilms on plastic surfaces (Iraqui et al., 2005: 1259–71; Kaur et al., 2005: 378–84; Martinez-Jimenez et al., 2013: 207–19). However, there are still several factors characteristic of the commensal life-style and the transition to virulence that are not well understood. More studies are needed to understand and control these important hospital acquired infections. C. glabrata is an accessible organism to study and the close phylogenetic relationship with the model yeast Saccharomyces cerevisiae has allowed the use in C. glabrata of most of the molecular biology methods designed for S. cerevisiae. The rate of homologous recombination is relatively high so that constructs in plasmids can easily be introduced in the homologous site in the genome to generate mutants in the corresponding locus (Cormack and Falkow, 1999: 979–87) some vectors have also been designed to express genes under different promoters in C. glabrata (Zordan et al., 2013: 1675–86). However, there are not enough vectors available to generate a range of protein fusions to study transcriptional and translational regulation of any gene, protein– protein interactions and the intracellular localization of the corresponding proteins in C. glabrata. For this reason, we decided to generate a set of expression vectors that would allow us the generation of translational fusions at the 30 end of any gene of C. glabrata with either three different fluorophores or three different epitopes independently. We aimed to construct a series of vectors where the fusions constructed could be expressed from their own promoters in replicative vectors, or overexpressed from a strong promoter (PTEF1). Also, we decided to construct a group of integrative vectors so that a given gene fusion could be integrated at its native locus by homologous recombination in one step, by selecting for resistance to nourseothricin (NatR).

2. Materials and methods 2.1. Strains and growth conditions Escherichia coli strain DH10 (Gibco BRL) was used for plasmid transformations. Storage was made in 15% glycerol at 80 °C. Bacteria were grown at 30 °C in LB medium containing 5 g/L yeast extract, 10 g/L tryptone, 5 g/L NaCl. All plasmid constructs were introduced into strain DH10 by electroporation (Dower et al., 1988: 6127–45), and 50 lg/mL carbenicillin (A.G. Scientific. Inc. #C-1385) was added to LB to select for plasmids. For LB plates, 1.5% agar was used. Gel purifications and plasmid extractions were performed using Qiagen columns (Qiagen, QIAquick Gel Extraction Kit Cat. No. 28706; QIAprep Spin Miniprep Kit Cat. No. 27106).

C. glabrata strains were grown at 30 °C in YPD media containing 10 g/L yeast extract, 20 g/L peptone, supplemented with 2% glucose and 2% agar was added for plates. Nourseothricin (StreptothricinSulfate, NTC, cloNAT, CAT#N-500-1) was supplemented to liquid and solid YPD at 100 lg/mL to select for C. glabrata strains containing replicative vectors with native promoter fusions derived from empty vector pMJ22 and integrative vectors derived from pYC44. Strains containing URA3-marked plasmids derived from pYC12 were grown in SD-Ura containing 1.7 g/L yeast nitrogen base, 5 g/L ammonium sulfate, 6 g/L casamino acids, 2% dextrose). All C. glabrata mutant strains were generated in the BG14 strain background (Cormack and Falkow, 1999: 979–87). For complementation assays, strains were grown in YNB plates containing 1.7 g/L yeast nitrogen base, 5 g/L ammonium sulfate, 2% dextrose and 2% agar. Yeast strains were stored at 80 °C in 10% glycerol. All strains and plasmids will be available to the scientific community. The plasmids have been deposited in two public collections from where they can be distributed upon request: Addgene (accession numbers are listed in Table 1) and at the Fungal Genetics Stock Center (FGSC http://www.fgsc.net/). The DNA sequences of all the plasmids are available also from GenBank and the accession numbers are listed in Table 1. 2.2. Recipient vectors construction All plasmids generated in this work are summarized in Table 1. The replicative overexpressing vectors (URA3-marked) are derived from pGRB2.1 (Frieman et al., 2002: 479–92), replicative with native promoter vectors (NAT-marked) are derived from pMJ22 (laboratory collection) and integrative vectors (NAT-marked) are derived from pRS306 (Sikorski and Hieter, 1989: 19–27). The replicative overexpressing initial vector (pYC12), was created by cloning the promoter of the S. cerevisiae TEF1 gene (PTEF1), into pGRB2.1. PTEF1 sequence was subcloned from pTP3 (laboratory collection) as a 407 bp SacI/XbaI fragment. To construct the overexpressing and native promoter replicative recipient vectors with fluorophores YFP (pYC25 and pYC55 respectively), CFP (pYC16 and pYC61) and mCherry (pYC34 and pYC42); the fluorophore sequences were cloned into pYC12 (overexpressing version) and pMJ22 (native promoters version) as BamHI/BglII fragments. YFP and CFP were subcloned from pMB74 and pMB78 (laboratory collection), respectively. mCherry sequence was amplified from pBS34 (Wach et al., 1997: 1065–75) with primers #953 and #954. To construct the overexpressing recipient vectors with epitopes, primers #405 and #406 were aligned, and cloned into pYC12 to generate FLAG recipient vector (pYC119). To generate cMyc recipient vector (pYC121), cMyc sequence was subcloned from pYC66 as a 593 bp XbaI/Klenow/BamHI fragment and cloned into pYC12 digested with SmaI/BamHI. To generate native promoter recipient vectors with epitopes cMyc (pYC66), FLAG (pYC64) and HA (pYC62), constructions were performed as follows: cMyc, FLAG and HA sequences were subcloned from pOZ18 (Supplementary information, Table S1 (Orta-Zavalza et al., 2013: 1135–48)), pGE36 and pGE33 (laboratory collection), respectively as BamHI/XbaI fragments and cloned into pMJ22 digested with BamHI/XbaI. All the primers are listed in Table 2. The integrative initial vectors were constructed as follows: BamHI, XhoI and SalI sites were mutated from NAT resistance cassette form pCRTOPO-NAT vector (Beese-Sims et al., 2012: 1512–9). The NAT modified cassette (with the BamHI, XhoI and SalI sites removed), was amplified and cloned into pRS306 with primers #1098 and #1307 as a BamHI/XhoI fragment to generate pYC40 intermediate vector. The fragment containing the FRT sequence and the 30 UTRCTA1 (that serves as a temporary 30 UTR for cloned sequences before removal of the NAT cassette), was amplified from pOZ12 (laboratory collection) and cloned into pYC40 to create

45

P. Yáñez-Carrillo et al. / Fungal Genetics and Biology 80 (2015) 43–52 Table 1 Plasmids generated in this work. Plasmid name, AddGene ID number, GenBank accession number, relevant genotype and the references are listed. Plasmid

AddGene ID

GenBank accession number

Relevant genotype

Reference

Overexpressing vectors pGRB2.1 45341 pYC12 63911 pYC16 63913 pYC25 63914 pYC34 63915 pYC119 63916 pYC121 63917

KF040395 KP238570 KP238571 KP238572 KP238573 KP238587 KP238588

CgCEN/ARS plasmid containing 30 UTRHIS3 AmpR, URA3+ Initial overexpressing vector pGRB2.1::PTEF1 AmpR, URA3+ Recipient CFP overexpressing vector pYC12::CFP AmpR, URA3+ Recipient YFP overexpressing vector pYC12::YFP AmpR, URA3+ Recipient mCherry overexpressing vector pYC12::mCherry AmpR, URA3+ Recipient FLAG overexpressing vector pYC12::FLAG AmpR, URA3+ Recipient cMyc overexpressing vector pYC12::cMyc AmpR, URA3+

Zordan et al. (2013: 1675–86) This work This work This work This work This work This work

Replicative pMJ22 pYC42 pYC55 pYC61 pYC62 pYC64 pYC66

vectors 63919 63920 63922 63925 63927 63928 63929

KP238569 KP238574 KP238581 KP238583 KP238584 KP238585 KP238586

Initial replicative vector CgCEN ARS AmpR, NATR Recipient mCherry replicative vector pMJ22::mCherry AmpR,NATR Recipient YFP replicative vector pMJ22::YFP AmpR,NATR Recipient CFP replicative vector pMJ22::CFP AmpR,NATR Recipient HA replicative vector pMJ22::HA AmpR,NATR Recipient FLAG replicative vector pMJ22::FLAG AmpR,NATR Recipient cMYC replicative vector pMJ22::cMyc AmpR, NATR

Laboratory collection This work This work This work This work This work This work

Integrative pYC44 pYC46 pYC48 pYC50 pYC52 pYC54 pYC56

vectors 63903 63904 63905 63906 63908 63909 63910

KP238575 KP238576 KP238577 KP238578 KP238579 KP238580 KP238582

Initial Integrative Vector pYC40::3UTRCTA::FRT AmpR NATR URA3+ Recipient FLAG integrative Vector pYC44:FLAG AmpR NATR URA3+ Recipient HA integrative Vector pYC44:HA AmpR NATR URA3+ Recipient cMyc integrative Vector pYC44:cMyc AmpR NATR URA3+ Recipient CFP integrative Vector pYC44:CFP AmpR NATR URA3+ Recipient YFP integrative Vector pYC44:YFP AmpR NATR URA3+ Recipient mCherry integrative Vector pYC44:mCherry AmpR NATR URA3+

This This This This This This This

work work work work work work work

Table 2 Oligonucleotides used in this work. Oligonucleotides identification number, name and sequence are listed. Oligonucleotide

Name

Sequence

#1 #2 #351 #405

pUC Fw pUC Rv CTA1@ + 290pb BglII Rv 3HA TAG BamHI/BglII

#406

3HA TAG BglII/BamHI

#465 #952 #954 #1097 #1098 #1307 #1494 #1495 #1496 #1497 #1498 #1499 #1500 #1501 #1502 #1503 #1504 #1505

CTA1@+1pb BamHI FRT Fw mCherry@1pbBamHI Fw mCherry@711pbBglII Rv NAT-FRT@+11 SalI Fw NAT-FRT@+287 Rv XhoI NAT-FRT@-391 Fw BamHI HIS3@-799 EcoRI Fw HIS3@1aaa XbaI Fw HIS3@607 BamHI Rv HIS3@-743 SacII Fw 30 UTR HIS3@+1 XbaI Fw 30 UTR HIS3@+1 XhoI Fw 30 UTR HIS3@+527 XbaI Rv 30 UTR HIS3@+775 XhoI/BsgI Rv TRP1@-442 EcoRI Fw TRP1@1aaa XbaI Fw TRP1@651 BamHI Rv TRP1@-1033 SacII/BsgI Fw

GGCGATTAAGTTGGGTAACGCCAGGG TATGTTGTGTGGAATTGTGAGCGGA GCGAGATCTCTATGAATTAAGACATAACATCAAGTCCC GATCTTATACCCATACGATGTTCCTGACTATGCGGGCTATCCGTATGACGTCCCGGACTATGCAGGCTCC TATCCATATGACGTTCCAGATTACGCTGCTCAGTGCTGAA GATCTTCAGCACTGAGCAGCGTAATCTGGAACGTCATATGGATAGGAGCCTGCATAGTCCGGGACGTCATA CGGATAGCCCGCATAGTCAGGAACATCGTATGGGTATAG GCGGGATCCGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCGTGCGCTTTTGAACCACGTAAAGTGC GCGGGATCCTAATGGTGAGCAAGGGCGAG CGCAGATCTCTACTTGTACAGCTCGTCCATGC CATGTCGACCAGTACTGACAATAAAAAGATTCTTGTTTTC CATCTCGAGGACGAAGTTCCTATTCTCTAGAAAGTATAG CTCGGATCCGCTTGCCTCGTCCCCG TGAGAATTCAGCCAACAATAAAGGTTATGCGTCTG AAATCTAGAAAATGGCGTTTGTTAAGAGGGTTACGC ATTAGGATCCCTGCTAGGACAGGGTTAGTGGATGG CATACCGCGGTGCAGTTCTGCCAAG CAATCTAGAACACAGCCCACAGCTACCAC CAAACTCGAGAACACAGCCCACAGCTACC TCTTCTAGACTTTGTTGCCCTTCAGGCATGG AGTCTCGAGTGCAGCTGGAACGTGCTTGCCGTC TATGAATTCTTGGCCGCTATCCACGC TGCTCTAGAAAATGTCATTTGATTCGTTACTCGACAAGAATG GTTGGATCCCTTGTTTCTTTGCATTTTGTACATATTTAATTATCTTGTCATTG GATACCGCGGTGCAGGAGAGGAGGCGTTGCG

pYC44, an integrative initial vector. To construct the integrative recipient vectors with fluorophores CFP (pYC52), YFP (pYC54) and mCherry (pYC56); each fluorophore sequence was cloned into pYC44 as BamHI/BglII fragments. To generate integrative recipient vectors with, FLAG (pYC46), HA (pYC48) and cMyc (pYC50) tags, the epitope sequences were subcloned from pOZ18 (Supplementary information, Table S1 (Orta-Zavalza et al., 2013: 1135–48), pGE36 and pGE33, respectively (laboratory collection) as BamHI/NheI fragments and cloned into pYC44.

2.3. Generation of strains with translational fusions in replicative vectors All C. glabrata strains used in this study are summarized in Table 3. Yeast transformations were made using the lithium acetate protocol with the replicative vectors as previously described (Castano et al., 2003: 905–15). To generate strains with overexpressing and with native promoter replicative vectors, cells were plated and purified on SD-Ura plates and YPD-NAT, respectively.

46

P. Yáñez-Carrillo et al. / Fungal Genetics and Biology 80 (2015) 43–52

Table 3 C. glabrata strains generated in this work. Strain

Parental

Genotype

Reference

BG2 BG14 CGM1063 CGM2020 CGM99

– BG2 BG14 CGM1063 BG14

Clinical isolate (B Strain) ura3D::Tn903 G418R his3D::NAT his3D::FRT (NatS) trp1D

Cormack and Falkow (1999: : 979–87) Cormack and Falkow (1999: 979–87) Laboratory collection This work Laboratory collection

Strains with overexpressed fusions CGM1570 CGM1576 CGM1578 CGM1623 CGM1874 CGM1898 CGM1876 CGM1872 CGM1896 CGM1883 CGM1881 CGM1878 CGM1879 CGM1863 CGM1862 CGM1861 CGM1893 CGM1871 CGM1865 CGM1867 CGM1901 CGM1869

BG14 BG14 BG14 BG14 BG14 BG14 BG14 BG14 BG14 BG14 BG14 BG14 BG14 CGM99 CGM99 CGM99 CGM99 CGM1063 CGM1063 CGM1063 CGM1063 CGM1063

BG14/pYC16 BG14/pYC12 BG14/pYC25 BG14/pYC34 BG14/pYC126 BG14/pYC122 BG14/pYC124 BG14/pYC128 BG14/pYC130 BG14/pYC134 BG14/pYC132 BG14/pYC136 BG14/pYC138 CGM99/pYC134 CGM99/pYC132 CGM99/pYC136 CGM99/pYC138 CGM1063/pYC126 CGM1063/pYC122 CGM1063/pYC124 CGM1063/pYC128 CGM1063/pYC130

This This This This This This This This This This This This This This This This This This This This This This

work work work work work work work work work work work work work work work work work work work work work work

Strains with native promoter fusions CGM1913 BG14 CGM1987 BG14 CGM2240 BG14 CGM1911 BG14 CGM2084 CGM2020 CGM2088 CGM2020 CGM2242 CGM2020 CGM2086 CGM2020

BG14/pYC153 BG14/pYC186 BG14/pYC193 BG14/pYC168 CGM2020/pYC153 CGM2020/pYC186 CGM2020/pYC193 CGM2020/pYC168

This This This This This This This This

work work work work work work work work

Strains with integrated fusion CGM2267

CGM1063/HIS3-MYC (Nat)S

This work

CGM1063

2.4. Generation of strains with translational fusions in integrative vectors The strains with fusions integrated in the chromosome were generated in CGM1063 (his3D) and CGM99 (trp1D) strains. The fragments used to transform the appropriate strain contain the 50 homology region of the target gene followed by the translational fusion with the 30 UTR of the catalase gene (30 UTRCTA1), a NAT resistance cassette for selection of the transformants and the 30 homology region of each target gene. The open reading frame (ORF) of each target gene was replaced with the corresponding fusion with a fluorophore (CFP, YFP or mCherry) or epitope (cMyc, HA or FLAG) and the NAT resistance cassette. The 30 UTRCTA1 and the NAT cassette are flanked by two FRT direct repeats. The transforming fragments were generated by digesting the plasmid constructs containing the fusions with enzymes that cut within the 50 and the 30 C. glabrata homology region of the target gene to induce homologous recombination. Selection was made on plates containing 100 lg/mL of nourseothricin. Transformants were purified twice on YPD-NAT plates. The correct integration of the translational fusions in the chromosome was confirmed by PCR. For each translational fusion, two independent transformants were obtained and stored. To generate the strains from each fusion where the NAT cassette was removed, strains were transformed with pMZ21 (Supporting Information Table S1) and transformants were selected on SD-Ura plates. pMZ21 is a replicative vector expressing ScFLP1 that encodes the Flp1 recombinase that

recognizes the FRT sites flanking the NAT marker. Flp1 catalyzes recombination between the two FRT direct repeats and the NAT marker is deleted from the chromosome so that the cognate 30 UTR is placed immediately downstream of the tagged gene leaving one copy of the FRT site (34 bp) (Fig. 2C). Transformants were purified on SD-Ura plates. Single colonies were then grown on non-selective medium (YPD agar) and screened for NATS in YPD-NAT plates (for the loss of the NAT cassette) and in SD without uracil plates (SD-Ura) for the loss of pMZ21. This protocol allows the construction of multiple mutants or multiple tagged strains using a reusable NAT resistance marker. 2.5. Complementation assay To asses if the protein fusion complements the his3D and trp1D strains, cultures of cells containing the translational fusion of these genes with one fluorophore (mCherry) or one epitope (cMyc) in the three versions of the system were grown for 48 h (stationary phase) at 30 °C in YPD broth. The cultures were adjusted to an OD600 = 1, serially diluted and spotted on SD-His or SD-Trp plates as described above. The plates were incubated at 30 °C for 72 h. 2.6. DAPI staining Nuclei of cells containing translational fusions were stained with DAPI (40 , 60 -diamidino-2-phenylindole) as previously described (Kaur et al., 2004: 1600–13). Briefly 1 mL of overnight

P. Yáñez-Carrillo et al. / Fungal Genetics and Biology 80 (2015) 43–52

cultures were washed with PBS, the cells were resuspended in 1 mL of 4% p-formaldehyde and incubated at room temperature for 2 h. Cells were washed three times with PBS and resuspended in 1 mL of PBS. 100 lL of cell suspension was incubated with 1 lL of DAPI (0.2 mg/mL) for 30 min. Cells were washed and visualized by fluorescence microscopy Zeiss Axio Vision Blue edition. 2.7. Fluorescence microscopy Cultures were grown for 48 h (stationary phase) at 30 °C in the appropriate media. Cells were visualized with Zeiss Axio Vision Blue edition and photographed. 2.8. Western blotting To immunodetect the fusions with epitopes, yeast strains were grown at 30 °C to stationary phase in the indicated medium. Cell extracts were made as previously described (Orta-Zavalza et al., 2013: 1135–48): cells were collected and resuspended in 500 lL of lysis buffer (45 mM HEPES-KOH [PromegaÒ, pH 7.5], 400 mM potassium acetate, 1 mM EDTA, 0.5% Nonidet P-40 substitute [Fluka BiochemicaÒ], 1 mM DTT, 10% glycerol, 1 mM PMSF protease inhibitor and 1 cOmplete ULTRA Tablet Mini/10 mL (EASYpack [ROCHEÒ]). 100 lL of zirconia beads (BioSpecÒ) were added and cells were lysed using the Fast Prep. The lysate was centrifuged at 15,000 rpm for 40 min at 4 °C. The supernatant of each sample was collected and the protein content determined by Bradford assay (FermentasÒ). The protein extracts were analyzed by electrophoresis on a 12% SDS–PAGE gel, blotted onto PVDF membranes (BIO-RADÒ) and incubated with either mouse anti-cMyc (MilliporeÒ) or mouse anti-FLAG (SigmaÒ). The membranes were washed and probed with a goat anti-mouse horseradish peroxidase-conjugated secondary antibody (AmershamÒ). Signal detection was achieved using the ECL chemiluminescence reagents (AmershamÒ) and X-OMAT (KodakÒ) films. 2.9. Plasmid loss assay Strains carrying replicative or overexpressing plasmids were grown overnight at 30 °C in YPD-Nat or SC –Ura respectively. Cultures were diluted 100-fold in fresh media and incubated at 30 °C with shaking for 8 h. The cultures were again diluted into fresh media every 8 h until they completed approximately 50 duplications. Cell suspensions were then diluted so that 100 lL of the appropriate dilution were plated on to YPD plates to obtain approximately 500–800 colonies per plate. After 48 h of incubation at 30 °C, the colonies were replica-printed on to YPD-NAT, SC-Ura, minimal YNB and rich YPD plates. Plasmid loss was calculated as the ratio between the number of colonies grown in selective media (YPD-NAT, SC-Ura or YNB) over the number of colonies grown without selection (YPD). 3. Results 3.1. Design and construction of expression vectors We designed a series of vectors to generate translational fusions at the 30 end of any structural gene of C. glabrata with the fluorophores YFP, CFP or mCherry or with the epitopes HA, FLAG or cMyc. The versatility of this system lies in fact that the fusions can be cloned in three different versions: (a) cloning the gene of interest with its own promoter in a replicative plasmid in C. glabrata containing either the fluorophores or the epitope tags (Fig. 1A); (b) cloning of the gene of interest under the strong constitutive promoter of the S. cerevisiae gene TEF1 in the replicative

47

plasmids (Fig. 1B) and (c) cloning the gene of interest with its own promoter in the integrative versions to generate strains of C. glabrata where the gene of interest has been replaced by the fusion construct (Fig. 1C). As shown in Fig. 1A, the replicative vectors used to clone the gene of interest with its own promoter are derived from pMJ22 (Table 1), which we designated ‘‘initial vector’’ and consists of a replicative vector containing CgCEN/ARS sequences for replication and segregation in C. glabrata and a nourseothricin resistance cassette (NAT-MX) for selection (Goldstein and McCusker, 1999: 1541–53). One set contains YFP, CFP or mCherry to generate translational fusions at the 30 of the gene of interest and the other set contains either cMyc, FLAG or HA epitope tags. These are called ‘‘recipient vectors’’. In these vectors, multiple cloning sites flanking the fluorophores or epitope tags are available to clone the native promoter and ORF of interest at the 50 end, as well as the 30 UTR region of the corresponding gene downstream of the fluorophores or the epitopes (recipient vectors, Fig. 1A). Fig. 1B shows the vectors used for overexpression of the fusion constructs. These vectors are derived from pGRB2.1 (Table 2), which contains a URA3 selection marker and a CgCEN/ARS sequence for segregation and replication in C. glabrata. The initial vector is pYC12 (Table 1 and Fig. 1B), which contains the strong constitutive promoter from the S. cerevisiae TEF1 gene (PTEF1) followed by several different cloning sites and the 30 UTR from the CgHIS3 gene. Using this initial vector we generated the corresponding recipient vectors (Table 1 and Fig. 1B), which contain either the three fluorophores or the three epitope tags cloned downstream from the constitutive promoter. Between the ScPTEF1 and the tag or fluorophore there are three available restriction sites to clone the gene of interest fused in frame with one of the three fluorophores or epitope tags. With these vectors overexpression of any given fusion construct can be made in only one cloning step. The set of vectors used to generate fusions that can be integrated in the corresponding site in the genome replacing the untagged wild-type version for the fusion construct are shown in Fig. 1C. These vectors are derived from plasmid pRS306 (Sikorski and Hieter, 1989: 19–27) containing the URA3 selection marker but no CEN/ARS sequences. The initial vector for the integrative plasmids is pYC44 (Table 1 and Fig. 1C), which contains a cassette that consists of the 30 UTR sequence of the CTA1 gene followed by a modified nourseothricin resistance gene driven by the Ashbya gossypii TEF1 promoter (NATR). The entire cassette is flanked by two Flp1 recombinase recognition sites (FRT), which permits excising the resistance marker and the CTA1 30 UTR sequences at a later step. The initial integrative vector (pYC44, Fig. 1C) containing only the NATR cassette flanked by the direct FRT repeats, can also be used to generate perfect knockouts of any non-essential gene in one step by cloning the 50 intergenic region on one side of the resistance cassette and 30 intergenic region on the other side of the cassette. The resulting plasmid is digested so that the entire fragment containing the cassette flanked by the 50 and 30 regions of the gene to be knocked out is excised and transformed into C. glabrata and selecting on plates containing nourseothricin. The resistance cassette can be removed by expressing Flp1 from plasmid pMZ21 (Supporting Information Table S1) (Fig. 2C). We have used pYC44 to successfully knock out the MAT locus in S. cerevisiae (Yáñez-Carrillo and Castaño, unpublished data). Each of the fluorophores or the epitope tags were cloned into pYC44 to generate the corresponding ‘‘recipient vectors’’ (Table 1 and Fig. 1C), these are then used to generate the translational fusions that will be integrated by homologous recombination in the corresponding site in the genome. Fig. 2A and B show a schematic representation of how we generated translational fusions of the CgHIS3 gene with its own promoter (Fig. 2A) or the overexpressing version (Fig. 2B). Fig. 2C

48

P. Yáñez-Carrillo et al. / Fungal Genetics and Biology 80 (2015) 43–52

Fig. 1. General diagram of the initial and recipient vectors designed for C. glabrata. The system consists of three types of vectors. The initial vectors from which the recipient plasmids are derived are shown to the left of each panel. Each version of the recipient plasmids contains a choice of 3 fluorophores (mCherry, YFP and CFP) or 3 epitopes (cMyc, FLAG or HA). (A) Replicative vectors to construct translational or transcriptional fusions of the gene of interest with its own promoter. These vectors are derived from the initial vector pMJ22, which contains a C. glabrata CEN/ARS sequence, a nourseothricin resistance cassette from NAT-MX, and the bla gene for selection in Escherichia coli. Each of the three fluorophores or the three epitope tags were cloned into pMJ22 to generate the corresponding recipient vectors. In this version, the gene of interest is cloned with its own promoter and with its own 30 UTR region flanking the fluorophores or the epitope tags. B) Overexpressing (replicative) vectors to overexpress the gene of interest or translational fusions derived from it. These vectors are derived from the initial vector pYC12, which contains the URA3 gene for selection in yeast and a CgCEN/ARS sequence. Each of the three fluorophores or the three epitope tags were cloned into pYC12 to generate the corresponding recipient vectors. In these vectors the gene of interest is transcribed from the constitutive promoter from S. cerevisiae TEF1 promoter and followed by the 30 UTR from the C. glabrata HIS3 gene. C) Integrative vectors to generate strains of C. glabrata where a gene of interest is replaced by its translational fusion in its native location in the genome. These vectors are derived from the initial vector pYC44. pYC44 contains contain a NatR cassette modified from pPCR-NAT, flanked by Flp1 recombinase recognition sites and a URA3 selection marker for an optional two-step gene replacement protocol. Each of the three fluorophores or the three epitope tags were cloned into pYC44 to generate the corresponding recipient vectors. In this version, the gene of interest is cloned with its own promoter upstream of the NATR cassette and the cognate 30 UTR downstream of the cassette. The resistance cassette can be recombined out by expressing FLP1 gene from a plasmid at a later step. The recipient vector pYC44 can also be used to generate perfect deletions of non-essential genes in the genome. Unique restriction sites in the vectors are shown. The site surrounded by a black box in the recipient vectors derived from pMJ22 is not present in the fluorophore versions of the replicative vectors. The underlined restriction site is absent in the epitope tagged versions of the replicative vectors. CEN = Centromeric sequence of C. glabrata. NAT = nourseothricin resistance cassette. Tag/fluorophore = mCherry, CFP, YFP, HA, FLAG or cMyc PTEF = S. cerevisiae TEF1 promoter (PScTEF1) TCTA = CgCTA1 terminator sequence FRT = Flp1 recombinase recognition sequence.

shows how the integrative vectors are designed to generate a complete replacement of the wild-type gene by the fusion construct in the corresponding site in the genome in one step by homologous recombination and selection for NATR. The relevant fragments are cloned so that the gene of interest (or a C-terminal fragment) is fused in frame with the fluorophore or epitope tags upstream of the NATR cassette, and the 30 UTR of the gene of interest is cloned at the other end of the resistance cassette. Both fragments cloned must have unique restriction sites within the C. glabrata sequences, to excise the entire fragment containing the gene fusion, the resistance cassette and the cognate 30 UTR. This linearized fragment is transformed in C. glabrata and recombinants are selected on plates containing nourseothricin. The 30 UTR of the CTA1 gene contained in the resistance cassette serves as a temporary 30 UTR for the translational fusion of the initial transformants. In a later step, the transformants where the recombination occurred at the cognate locus in the genome, are transformed with pMZ21 (Supporting Information Table S1), a plasmid expressing the Flp1 recombinase to induce recombination between the direct FRT repeats flanking the resistance cassette. After NATS colonies have been identified, the resulting recombinant strain contains the

wild-type gene replaced by the fusion driven by its own promoter and followed by its own 30 UTR region and no resistance marker. Only a small scar of 34 pb corresponding to one FRT site is left immediately after the fusion construct. We have verified that excision of the NAT cassette indeed leaves only a small scar corresponding to one FRT site following the translational fusion of HIS3-MYC and immediately downstream the 30 UTR of HIS3. To do this we PCR-amplified the fusion from the chromosome of the integrant with oligos that anneal outside of the construct. The PCR product was sequenced and the analysis confirmed the correct structure (data not shown). We also confirmed that transformation with the fragment containing the fusion and the resistance cassette, results in only one integration event (by homologous recombination) at the correct chromosomal locus in our strain background. This was verified by transforming the strain containing the HIS3::MYC fusion where the resistance cassette had already been excised (strain CGM2267, Table 3), with a fragment containing a knock-out allele his3D::NATR. All the resulting NATR transformants analyzed were histidine auxotrophs and had lost the MYC tag as judged by PCR, indicating that only one copy of the transforming fragment with the translational fusion had been

P. Yáñez-Carrillo et al. / Fungal Genetics and Biology 80 (2015) 43–52

49

Fig. 2. General diagram to generate the translational fusions of the HIS3 gene in the three versions of the system and recombination of the fusion in the genome. (A) Replicative vector. (B) Overexpressing vector and (C) Integrative vector. Restriction sites to clone these particular fragments are shown. Once the integrative vector is constructed (with both fragments cloned flanking the NATR cassette in the recipient vector), the final plasmid is digested with an enzyme (or two enzymes) that has unique restriction sites within each of the 50 and the 30 C. glabrata homology regions flanking the resistance cassette. The linear fragment is used to transform C. glabrata to induce homologous recombination and replacement of the wild-type gene for the translational fusion in the native site in the genome. Selection is made for NATR colonies. In a subsequent step expression of the Flp1 recombinase induces recombination between the flanking FRT sites leading to excision of the resistance cassette, and leaving the translational fusion followed by a single FRT site and the cognate 30 UTR region. (D) Complementation of histidine auxotrophy of the his3D strain by the translational fusions of the HIS3 gene with mCherry or cMyc using the three versions: replicative with its own promoter (REP), replicative overexpressing (OE) and integrative (INT). Serial dilutions of the indicated strain containing the translational fusions were spotted onto plates containing minimal media without histidine. Plates were incubated at 30 °C for 48 h and photographed. The growth of the his3D strain complemented with the translational fusions is comparable to the growth of the wild-type strain (not shown).

integrated in the correct site of the genome of the recipient strain (data not shown). The design of the vectors of this work allows for construction of strains containing more than one fusion protein in a single strain to study protein–protein or protein-DNA interactions. The set of recipient integrative vectors can also be integrated by the two step gene replacement method since it contains the URA3 selection marker; so that by linearizing the fusion plasmid at a site within either the 50 side of the fusion or the 30 UTR, homologous recombination will be induced after transformation in C. glabrata and selection for Ura+. The integrants are then resolved and screened for correct recombination event leading to replacement of the wild type gene by the fusion construct. We have used integrative vectors pYC46 and pYC50 (Table 1) to generate translational fusions of the ABF1 and RAP1 genes (Castanedo and Castaño, unpublished data). The recipient replicative vectors with the fluorophores are also useful to determine promoter activity (transcriptional fusions) by cloning the promoter of any gene upstream the fluorophore of interest. In our lab we have generated a derivative of pYC55 that

contains the HIS3 30 UTR cloned at the 30 end of YFP (pYC177). Using this plasmid we have successfully generated transcriptional fusions in one step using this vector and we have determined promoter activity by measuring fluorescence intensity by flow cytometry (Yáñez-Carrillo and Castaño, unpublished data). 3.2. Translational fusions of fluorophores or epitopes with the HIS3 gene complement histidine auxotrophy of the his3D strain To test that our translational fusions result in functional proteins, we generated fusions of the HIS3 and TRP1gene with the fluorophores (YFP, CFP and mCherry) and with the three epitopes (FLAG, cMyc and HA) in the three versions available (replicative with its own promoter, replicative with a strong constitutive promoter and integrative). In Fig. 2, we show some of the constructs made using the three plasmid versions with the HIS3 gene fused to either one fluorophore (mCherry) or one epitope (c-Myc). It is clear that all of the fusions complement the his3D strain for growth in the absence of histidine, indicating that the fusions constructed are functional.

50

P. Yáñez-Carrillo et al. / Fungal Genetics and Biology 80 (2015) 43–52

Fig. 3. Fluorescence emission of the HIS3 translational fusions with the fluorophore mCherry in all three versions of the system. The his3D strain was transformed with the translational fusions in the three versions. (A) Photograph under the fluorescence microscope of the his3D strain. (B) Translational fusion HIS3-mCherry in the replicative version under its own promoter. (C) Translational fusion HIS3-mCherry in overexpressing replicative version. (D) Translational fusion mCherry-HIS3 integrated in the HIS3 locus in the genome.

3.4. Epitope tagged fusions can be immunodetected The HIS3-cMyc fusion vectors and the strain containing the fusion integrated in the HIS3 locus could be detected by Western Blot using anti-cMyc commercial antibodies. Fig. 4 shows that the strain carrying the overexpressing vector shows a stronger signal than the strains carrying either the vector expressing the fusion from the native promoter or the fusion integrated in its chromosomal site. We have also detected by western blot the HIS3-FLAG fusions in overexpressing version (Supporting Information Fig. S2). Fig. 4. Immunodetection of the HIS3::cMyc in the three versions of the system: replicative with its own promoter (REP), replicative overexpressing (OE) and integrative (INT). Strains containing the indicated constructs were grown in the appropriate media to logarithmic phase and collected. Protein extracts from each strain were separated on an SDS gel and cMyc tagged proteins were detected by Western blot using commercial antibodies specific for the cMyc epitope. The untagged wild type parental strain BG14 was used as negative control, and a strain carrying a previously tagged HST1::cMyc strain (Orta-Zavalza et al., 2013: 1135–48) was used as positive control.

3.3. Translational fusions of the HIS3 gene with the three flourophores can be detected by fluorescence microscopy We observed under the fluorescence microscope cultures carrying the translational fusions of HIS3 with each of the fluorophores in all three versions. Results obtained with the fusions with mCherry are shown in Fig. 3. As can be seen, the amount of fluorescent signal is proportional to the promoter under which the expression is achieved. For example, there is no fluorescence in the parental strain (Fig. 3A), and the strain carrying the replicative vector with the HIS3 promoter (Fig. 3B) shows similar expression levels as the strain that carries the fusion in the HIS3 locus in the chromosome but clearly less fluorescence than when the fusion is overexpressed form the TEF1 promoter (compare Fig. 3B and D with Fig. 3C). We have also made several fusions of different fluorophores with the TRP1 gene and obtained similar results (Supporting Information Fig. S1).

3.5. Plasmids are stably maintained under selective conditions To determine whether the replicative or overexpressing plasmids carrying the translational fusions with HIS3 are stably maintained in the cells that carry them, we grew cultures of C. glabrata strains carrying either the replicative or the overexpressing versions for 50 duplications continuously, or to stationary phase. We found that when cells were grown continuously in selective media (YPD-NAT for the replicative plasmids and SC –Ura for the overexpressing vectors), there was approximately 19% of plasmid loss. Growth to stationary phase for 4 days without subculturing, and with no selection (YPD), resulted in only about 9% of plasmid loss. However, when cells were grown continuously for 50 duplications without selection, the vast majority of the cells (±90%), lost the plasmid. The results were very similar for both, replicative with the native promoter and the overexpressing plasmids (data not shown). 4. Discussion We have generated a set of expression vectors that allows tagging at the 30 end of any gene in C. glabrata with a choice of three fluorophores (CFP, YFP or mCherry) or three epitope tags (HA, FLAG or cMyc). This expression system is available in three versions: two of them are in replicative plasmids: an overexpressing vector or a

P. Yáñez-Carrillo et al. / Fungal Genetics and Biology 80 (2015) 43–52

vector where the fusion is expressed under the gene’s own promoter; the third version is the integrative vector in which the fusion construct is transformed into C. glabrata and the wild type gene is replaced by the fusion by homologous recombination. All three versions result in functional fusion proteins where the fusions with fluorophores are detected when visualized by fluorescence microscopy or by flow cytometry, and the epitope tags can be detected by Western blot. The recipient replicative vectors containing the fluorophores can also be used to construct transcriptional fusions with any promoter of interest to assay promoter activity under many different growth conditions by flow cytometry or fluorescence microscopy. The experiments using the replicative or overexpressing vectors should be performed using selective media to avoid plasmid loss. The initial integrative vector containing the NAT cassette (pYC44) can also be used to generate knock out strains of any non-essential gene in C. glabrata and S. cerevisiae. In this case, the 50 and 30 intergenic regions of the gene of interest are cloned on either side of the resistance cassette and after digestion with enzymes that cut within the 50 and 30 regions, the DNA is used to transform yeast cells to induce homologous recombination and replacement of the wild type gene by the resistance cassette. Because the cassette is flanked by direct repeats of the FRT site, it can be easily excised leaving a complete deletion of the gene of interest and no resistance marker. This system therefore allows to perform multiple rounds of mutagenesis. These series of vectors are easy to use since resistance to nourseothricin is a good selection marker in C. glabrata. Strains that do not contain the cassette are completely sensitive to this antifungal with no observable background on the selection plates. In contrast hygromicin, which is another frequently used antifungal, allows background growth in our parental strain (BG14) and in several other clinical isolates of C. glabrata, even in the absence of the hph resistance gene. This work provides a new set of tools that permits expression of any gene in C. glabrata under the native promoter or from a strong constitutive promoter (PTEF1) and fused to a choice of three fluorophores or three epitope tags. These will allow to determine the expression of the gene as well as the protein’s intracellular localization and colocalization with other proteins fused to a different fluorophore. The proteins fused to the epitopes will be useful to purify proteins of interest, determine protein–protein interactions between proteins with different epitopes and protein-DNA interactions. This system allows to study several genes simultaneously (up to three different fluorophores or three epitope tags). Because C. glabrata is a medically important organism, molecular tools are needed to study different aspects of its virulence. (Zordan et al., 2013: 1675–86) have recently developed a group of replicative vectors that allow evaluating genes of interest under constitutive or inducible promoters. However, expression vectors that allow fluorescent and epitope tagging in a systematic way such as those described here are still needed. This work provides a useful set of molecular tools to study the expression and interaction of proteins in this opportunistic pathogen. Conflict of interest The authors declare that they have no conflict of interest. Acknowledgments This work was supported by Consejo Nacional de Ciencia y Tecnología (CONACyT) grant CB-2010 No. 151517 to ICN, and grant CB-2010 No. 153929 to APN. P.Y.C. was supported by a (CONACyT) fellowship No. 223335 and E.O.Z. by CONACyT fellowship No. 233455.

51

Appendix A. Supplementary material Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.fgb.2015.04.020. References Beese-Sims, S.E., Pan, S.J., Lee, J., et al., 2012. Mutants in the Candida glabrata glycerol channels are sensitized to cell wall stress. Eukaryot. Cell 11, 1512– 1519. Castano, I., Kaur, R., Pan, S., et al., 2003. Tn7-based genome-wide random insertional mutagenesis of Candida glabrata. Genome Res. 13, 905–915. Castano, I., Pan, S.J., Zupancic, M., et al., 2005. Telomere length control and transcriptional regulation of subtelomeric adhesins in Candida glabrata. Mol. Microbiol. 55, 1246–1258. Cormack, B.P., Falkow, S., 1999. Efficient homologous and illegitimate recombination in the opportunistic yeast pathogen Candida glabrata. Genetics 151, 979–987. Cormack, B.P., Ghori, N., Falkow, S., 1999. An adhesin of the yeast pathogen Candida glabrata mediating adherence to human epithelial cells. Science 285, 578–582. Corzo-Leon, D.E., Alvarado-Matute, T., Colombo, A.L., et al., 2014. Surveillance of Candida spp. bloodstream infections: epidemiological trends and risk factors of death in two Mexican tertiary care hospitals. PLoS ONE 9, e97325. Cuellar-Cruz, M., Briones-Martin-del-Campo, M., Canas-Villamar, I., et al., 2008. High resistance to oxidative stress in the fungal pathogen Candida glabrata is mediated by a single catalase, Cta1p, and is controlled by the transcription factors Yap1p, Skn7p, Msn2p, and Msn4p. Eukaryot. Cell 7, 814–825. De Las Penas, A., Pan, S.J., Castano, I., et al., 2003. Virulence-related surface glycoproteins in the yeast pathogen Candida glabrata are encoded in subtelomeric clusters and subject to RAP1- and SIR-dependent transcriptional silencing. Genes Dev. 17, 2245–2258. Dower, W.J., Miller, J.F., Ragsdale, C.W., 1988. High efficiency transformation of E. coli by high voltage electroporation. Nucleic Acids Res. 16, 6127–6145. Frieman, M.B., McCaffery, J.M., Cormack, B.P., 2002. Modular domain structure in the Candida glabrata adhesin Epa1p, a beta1,6 glucan-cross-linked cell wall protein. Mol. Microbiol. 46, 479–492. Goldstein, A.L., McCusker, J.H., 1999. Three new dominant drug resistance cassettes for gene disruption in Saccharomyces cerevisiae. Yeast 15, 1541–1553. Gudlaugsson, O., Gillespie, S., Lee, K., et al., 2003. Attributable mortality of nosocomial candidemia, revisited. Clin. Infect. Dis. 37, 1172–1177. Horn, D.L., Neofytos, D., Anaissie, E.J., et al., 2009. Epidemiology and outcomes of candidemia in 2019 patients: data from the prospective antifungal therapy alliance registry. Clin. Infect. Dis. 48, 1695–1703. Iraqui, I., Garcia-Sanchez, S., Aubert, S., et al., 2005. The Yak1p kinase controls expression of adhesins and biofilm formation in Candida glabrata in a Sir4pdependent pathway. Mol. Microbiol. 55, 1259–1271. Kaur, R., Castano, I., Cormack, B.P., 2004. Functional genomic analysis of fluconazole susceptibility in the pathogenic yeast Candida glabrata: roles of calcium signaling and mitochondria. Antimicrob. Agents Chemother. 48, 1600–1613. Kaur, R., Domergue, R., Zupancic, M.L., et al., 2005. A yeast by any other name: Candida glabrata and its interaction with the host. Curr. Opin. Microbiol. 8, 378– 384. Lass-Florl, C., 2009. The changing face of epidemiology of invasive fungal disease in Europe. Mycoses 52, 197–205. Martinez-Jimenez, V., Ramirez-Zavaleta, C.Y., Orta-Zavalza, E., et al., 2013. Sir3 Polymorphisms in Candida glabrata clinical isolates. Mycopathologia 175, 207– 219. Nucci, M., Queiroz-Telles, F., Alvarado-Matute, T., et al., 2013. Epidemiology of candidemia in Latin America: a laboratory-based survey. PLoS ONE 8, e59373. Orta-Zavalza, E., Guerrero-Serrano, G., Gutierrez-Escobedo, G., et al., 2013. Local silencing controls the oxidative stress response and the multidrug resistance in Candida glabrata. Mol. Microbiol. 88, 1135–1148. Pappas, P.G., Rex, J.H., Lee, J., et al., 2003. A prospective observational study of candidemia: epidemiology, therapy, and influences on mortality in hospitalized adult and pediatric patients. Clin. Infect. Dis. 37, 634–643. Pfaller, M.A., Diekema, D.J., 2007. Epidemiology of invasive candidiasis: a persistent public health problem. Clin. Microbiol. Rev. 20, 133–163. Pfaller, M.A., Diekema, D.J., 2010. Epidemiology of invasive mycoses in North America. Crit. Rev. Microbiol. 36, 1–53. Pfaller, M., Neofytos, D., Diekema, D., et al., 2012. Epidemiology and outcomes of candidemia in 3648 patients: data from the Prospective Antifungal Therapy (PATH Alliance(R)) registry, 2004–2008. Diagn. Microbiol. Infect. Dis. 74, 323– 331. Richardson, M., Lass-Florl, C., 2008. Changing epidemiology of systemic fungal infections. Clin. Microbiol. Infect. 14, 5–24. Sikorski, R.S., Hieter, P., 1989. A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics 122, 19–27. Tortorano, A.M., Prigitano, A., Lazzarini, C., et al., 2013. A 1-year prospective survey of candidemia in Italy and changing epidemiology over one decade. Infection 41, 655–662. Wach, A., Brachat, A., Alberti-Segui, C., et al., 1997. Heterologous HIS3 marker and GFP reporter modules for PCR-targeting in Saccharomyces cerevisiae. Yeast 13, 1065–1075.

52

P. Yáñez-Carrillo et al. / Fungal Genetics and Biology 80 (2015) 43–52

Wisplinghoff, H., Bischoff, T., Tallent, S.M., et al., 2004. Nosocomial bloodstream infections in US hospitals: analysis of 24,179 cases from a prospective nationwide surveillance study. Clin. Infect. Dis. 39, 309–317. Yapar, N., 2014. Epidemiology and risk factors for invasive candidiasis. Ther. Clin. Risk Manag. 10, 95–105.

Zilberberg, M.D., Shorr, A.F., Kollef, M.H., 2008. Secular trends in candidemia-related hospitalization in the United States, 2000–2005. Infect. Control Hosp. Epidemiol. 29, 978–980. Zordan, R.E., Ren, Y., Pan, S.J., et al., 2013. Expression plasmids for use in Candida glabrata G3 (3), 1675–1686.