Appl Microbiol Biotechnol DOI 10.1007/s00253-014-5699-2
BIOTECHNOLOGICALLY RELEVANT ENZYMES AND PROTEINS
Expression, purification, and biological activity of the recombinant pramlintide precursor Hao Hu & Qi Xiang & Hui Liu & Hongyan Qu & Xin Tang & Xue Xiao & Qihao Zhang & Zhijian Su & Yadong Huang
Received: 29 January 2014 / Revised: 14 March 2014 / Accepted: 15 March 2014 # Springer-Verlag Berlin Heidelberg 2014
Abstract Pramlintide is an artificially designed protein which has the same function as amylin in human body. This protein is extremely difficult to synthesize through prokaryotic expression method because of its two essential active sites, intrachain disulfide bond and C-terminal amide group. Since α-amidating monooxygenase is widely distributed in human and animal, it is possible to use pramlintide precursor with an additional C-terminal glycine (PAG), which is the potential substrate of α-amidating monooxygenase, for in vivo applications. The recombinant PAG was expressed in Escherichia coli using the small ubiquitin-related modifier (SUMO) as the molecular chaperone, and the optimal fusion expression level reached to 36.3 % of the total supernatant protein. Under optimal conditions in a 10-L fermentor, the recombinant PAG was obtained with a purity of greater than 95 %, and the average expression level was reached to 20 mg/L. The authenticity and the intrachain disulfide bridge of PAG were confirmed by Western blotting and matrix-assisted laser desorption/ionization coupled to time-of-flight mass spectrometry (MALDI-TOF MS) as well as N-terminal H. Hu and Q. Xiang contributed equally to this study. Electronic supplementary material The online version of this article (doi:10.1007/s00253-014-5699-2) contains supplementary material, which is available to authorized users. H. Hu : H. Qu : X. Tang : Y. Huang National Engineering Research Center of Genetic Medicine, Jinan University, Guangzhou 510632, China H. Liu : X. Xiao : Q. Zhang : Y. Huang (*) Institute of Biomedicine, Jinan University, Guangzhou 510632, China e-mail: [email protected] Q. Xiang : H. Liu : X. Xiao : Q. Zhang : Z. Su (*) Guangdong Provincial Key Laboratory of Bioengineering Medicine, Jinan University, Guangzhou 510632, China e-mail: [email protected]
sequencing of protein. Based on an L6 myoblast cell model in vitro and an animal model of gastric emptying in vivo, the results of activity revealed that PAG showed a lower biological activity in vitro but has almost the same activity as the chemically synthesized pramlintide in vivo. Keywords Amylin . Pramlintide precursor . Amidation . L6 myotubes . Gastric emptying
Introduction Amylin is a 37-amino-acid peptide hormone that is secreted with insulin by pancreatic cells in response to nutrient stimuli (Moore and Cooper 1991). Pramlintide (PA), a synthetic analog of human amylin, is the first in the new class of amylinomimetic compounds. It acts through the inhibition of postprandial glucagon secretion, thereby avoiding the effects of glucagon excess in driving hepatic glucose output during the postprandial period and prolonging of gastric emptying time, thus leading to a decrease in postprandial blood glucose level (Weyer et al. 2001; Nyholm et al. 1999). In 2005, pramlintide was approved as a subcutaneous injection for the adjunctive treatment of patients with type 1 or 2 diabetes mellitus (McQueen 2005). There are two important active sites in the pramlintide molecule: an intramolecular disulfide bond and a C-terminal amide group, both of which are necessary for the full biological activity of the peptide (Roberts et al. 1989). Modification alone has been found to restore only moderate activity. However, the recombinant protein containing both active sites could dramatically increase activity to approach that of the native molecule (Leighton and Cooper 1988). So far, commercial pramlintide is produced by chemical synthesis. The traditional means of genetic engineering that use prokaryotic expression systems have been unable to meet
Appl Microbiol Biotechnol
the need for posttranslational modification, i.e., carboxyl amidation of the peptide. Eukaryotic expression systems that are capable of in vivo modification may not produce sufficient quantities of pramlintide to be cost competitive with conventional peptide synthesis. α-Amidating monooxygenase is a membrane protein expressed, including endothelial cells, lung epithelial cells, muscle cells, brain ependymal cells, and astrocytes as well as endocrine cells (Rhodes et al. 1990; Maltese and Eipper 1992). Because α-amidating monooxygenase is widely distributed in various tissues and organs, a precursor of pramlintide with an additional C-terminal glycine (PAG) was designed and expressed. This precursor contains an intramolecular disulfide bond and is capable of acting as a potential substrate of α-amidating monooxygenase. It is hypothesized that PAG could be modified by α-amidating monooxygenase after injection into the organism and further develop into the active form. This approach may provide a potential new method of production and clinical treatment of analogous protein.
Materials and methods Reagents Restriction endonucleases, Pyrobest DNA polymerase, a Polymerase Chain Reaction Purification Kit, a Gel Extraction Kit, and a MiniBest Plasmid Purification Kit were purchased from Takara Company (Dalian, China). Isopropyl-β-D-1-thiogalactopyranoside (IPTG) was purchased from Genebase Company (Guangzhou, China). A Glucose Colorimetric Assay Kit was purchased from Cayman Chemical Company (MI, USA). The expression vector pET-small ubiquitinrelated modifier (SUMO), pET-20b(+) (Cat 69739-3, Merck, Darmstadt, Germany), Escherichia coli (E. coli) Rosetta (DE3) strain (Cat:70953-3, Merck), and the SUMO protease were obtained from the Biopharmaceutical Research and Development Center of Jinan University (Guangzhou, China). Rat skeletal muscle cell starin L6 (Cat CRL-1458) cells were obtained from the American Type Culture Collection (ATCC, Manassas, VA, USA). The PA polyclonal antibody was customized from Shenzhen Biochemical Science and Technology Co., Ltd. (Shenzhen, China). The synthesis of DNA fragments coding SUMO-PAG and SUMO-PA Bridge polymerase chain reaction (PCR) was used to obtain the DNA segment coding SUMO-PA fusion protein. The schematic of SUMO-PA synthesis using oligomers is shown in Fig. 1. Briefly, seven oligomers containing overlap regions were synthesized by Beijing Genetic Institute (Table 1). These oligomers were spliced together through their shared overlap regions, and the product was extended to form a double-
stranded fragment by several Taq DNA polymerase reactions (Su et al. 2006). This DNA segment was then cloned into the prokaryotic expression vector pET-20b to obtain the recombinant plasmid pET-SUMO-PA. The recombinant plasmid was transformed into E. coli Rosetta (DE3) cells. The recombinant transformants were selected by ampicillin resistance, and sequencing was performed by Shanghai Sangon Biological Engineering Technology and Services Co., Ltd. (Shanghai, China). The DNA fragment coding SUMO-PAG was amplified using pET-SUMO-PA as a template and SPAG-F and SPAG-R as primers. The recombinant plasmid pET-SUMOPAG and expression strain were also constructed by the above method. Expression and analysis of recombinant proteins Recombinants were inoculated in fresh 250-mL lysogeny broth (LB) medium and incubated at 37 °C on an orbital shaker (220 rpm) overnight. The culture was then transferred into a 10-L bioreactor (Biotop, Taiwan) with an initial working volume of 6-L. Following culture to an optical density (OD600) of 0.6–0.8, expression of the foreign protein was induced with the final concentration of 1 mM IPTG. The cells of 7-L medium were harvested 4 h after induction by centrifugation at 6,000×g for 20 min at 4 °C, and the pellet was frozen at −80 °C until required. The concentrated cells were resuspended in 50 mM TrisHCl buffer (pH 7.4) at 1:10 ratio (w/v) and disrupted by sonication. Following centrifugation at 12,000×g for 30 min at 4 °C, protein fractions in both the supernatant and pellet were analyzed to determine protein solubility by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDSPAGE) analysis. Protein quantification was achieved using ImageJ software, which measures the ratio of target protein to total protein based on gel band intensity. Purification and identification of the recombinant proteins After sonication, the supernatant was applied to the Ninitrilotriacetate (Ni-NTA) Sepharose column which was preequilibrated with phosphate-buffered saline (PBS, pH 7.0). After washing with three column volumes of wash buffer (PBS containing 20 mM imidazole, pH 7.0), the 6× Histagged SUMO-PAG or SUMO-PA was eluted using elution buffer (PBS containing 300 mM imidazole, pH 7.0). The fraction containing target protein was desalted using a Sephadex S-100 column with PBS buffer containing 10 % glycerol (pH 7.0) (v/v). The purity and the concentration of fusion protein were evaluated by SDS-PAGE and bicinchoninic acid (BCA) protein assay, respectively. The purified fusion proteins were diluted to a concentration of 1 mg/mL and cleaved by SUMO protease (final concentration
Appl Microbiol Biotechnol Fig. 1 Schematic of PCR amplification of SUMO-PA
Table 1 PCR primers for amplifying the genes coding SUMO-PA and SUMO-PAG
primers (from 5' to 3') P1 (42 nta): AAATGCAACACCGCGACCTGCGCGACCCAGCGCCTGGCGAAC P2 (43 nt): CAGCGCCTGGCGAACTTTCTGGTGCATTCTTCTAACAACTTTG P3(46 nt): GAGCCCACGTTGGTCGGCGGCAGAATCGGGCCAAAGTTGTTAGAAG P4 (48 nt): TAACTCGAGTTATCAATAGGTGTTAGAGCCCACGTTGGTCGGCGGCAG P5 (43 nt): CTCATTCCATATGCATCATCATCATCATCACGGCATGTCGGAC P6 (40 nt): ACAGAGAACAGATTGGTGGTAAATGCAACACCGCGACCTG P7 (44 nt): GCATTTACCACCAATCTGTTCTCTGTGAGCCTCAATGATATCGT SPAG-F (39 nt): CTCATTCCATATGCATCATCATCATCATCACGGCATGTC SPAG-R (37 nt): CGCGGATCCTTAGCCATAGGTGTTAGAGCCCACGTTG Restriction enzyme recognition sites used for cloning were Nde I (P5 and SPAG-F), Xho I (P4) as well as BamH I (SPAG-R) indicated in boxed letters. The sequence of bold letters showed in P5 and SPAG-F was 6× His tag nt nucleotide
Appl Microbiol Biotechnol
Fig. 4 The SDS-PAGE analyses of SUMO-PAG during the process of fermentation. M protein molecular weight markers; lane 1 preinduction as a control; lanes 2–5 expression of SUMO-PAG in a 10-L fermentor, induced for 1, 2, 3, and 4 h, respectively; lane 6 the supernatant fraction of the sonicated cells; and lane 7 the expression of SUMO-PAG from the sediment fraction of the sonicated cells. The expression band pointed by the arrow was the recombinant fusion protein Fig. 2 The analyses of PCR fragments coding SUMO-PA and SUMOPAG. M DNA molecular weight marker, lane 1 PCR fragment coding SUMO-PAG, and lane 2 PCR fragment coding SUMO-PA
10 IU/mL) at 30 °C for 1 h. The cleaved samples were reloaded on the Ni-NTA resin, and the contaminants were removed. The recombinant PA (rPA) and PAG were pooled by PBS containing 10 % glycerol (v/v). The schematic diagram of rPA, PAG, and the artificial synthesized PA (sPA) is shown in Fig. S1. The apparent molecular weight and the purity of these recombinant proteins were detected by SDSPAGE and Western blotting. The analysis of accurate molecular weight and N-terminal sequencing of recombinant proteins were performed by matrix-assisted laser desorption/ ionization-time-of-flight mass spectrometry (MALDI-TOF MS) and Edman degradation reaction, respectively.
Fig. 3 The SDS-PAGE analyses of SUMO-PAG expression. M protein molecular weight markers, lane 1 preinduced Rosetta (DE3)/pET-SUMO-PAG, and lane 2 Rosetta (DE3)/pET-SUMO-PAG induced by 1 mM IPTG at 37 °C for 4 h. The expression band pointed by the arrow was the recombinant fusion protein
Determination of glucose uptake by cultured L6 myotubes L6 myoblast cells were subcultured into Corning 24-well plates at 5×104 cells/well and grown for 11 days in 0.4-mL Dulbecco's Modified Eagle Medium (DMEM) plus 2 % fetal bovine serum (v/v) to allow the formation of myotubes. The medium was renewed every 2 days. The 11-day-old myotubes were incubated in filter-sterilized Krebs–Henseleit HEPES (KHH) buffer (141 mg/L Mg2SO4, 160 mg/L KH2PO4, 350 mg/L KCl, 6,900 mg/L NaCl, 373 mg/L CaCl2 ·2H2O, 2,100 mg/L NaHCO3, pH 7.4) containing 0.1 % bovine serum albumin (v/v), 10 mM HEPES, and 2 mM sodium pyruvate for 2 h. Subsequently, the myotubes were cultured for 16 h in KHH buffer containing 11 mM glucose with a final concentration of 10−6-mol/L rPA, PAG, and sPA. A culture supernatant of 100 μL was collected and centrifuged at 12,000×g for 10 min at 4 °C. The concentration of glucose in the
Fig. 5 The variation of parameters in 10-L scale fermentation production of SUMO-PAG. Under the optimal fermentation conditions, the expression level of SUMO-PAG gradually increased over time and achieved maximum at 4 h after induction. The changes in parameters including wet cell weight and expression level in the process of 10-L fermentation were recorded by time course
Appl Microbiol Biotechnol
Fig. 6 The cleavage and purification of SUMO-PAG detected by Trisglycine SDS-PAGE. M Ultra-low molecular weight protein marker, lane 1 SUMO-PAG digested by SUMO protease for 1 h, lane 2 purified PAG, and lane 3 purified rPA
supernatant was determined by the Cayman Glucose Colorimetric Assay Kit (MI, USA).
Fig. 7 The Western blotting of recombinant proteins using PA polyclone antibody. Lane 1 the purified SUMO-PAG fusion protein, lane 2 purified PAG, lane 3 purified rPA, and lane 4 sPA
The following formula was used to calculate the percentage of gastric content remaining. Percent gastric content remaining= (absorbance at 20 min)/(absorbance at 0 min)×100.
Measurement of gastric emptying—phenol red method Results Adult male Harlan Sprague Dawley (HSD) rats (average weight approximated 235±10 g) obtained from Guangdong Medical Experimental Animal Center were housed at 23±1 °C in a 12:12 h light–dark cycle and fed and watered ad libitum. Experiments were performed during the light cycle on animals deprived of food for 18 h but allowed free access to water. Gastric emptying assay was performed based on the method described previously (Young et al. 1995). The rPA, PAG, and sPA dissolved in 0.15-mol/L saline were administered as a 0.5-mL subcutaneous bolus in doses of 150 μg/rat. The corresponding volume of saline solution was injected in the control group. After 5 min of injection, rats were administered 1.5 mL acaloric gel containing 1.5 % methyl cellulose and 0.05 % phenol red indicator by gavage. Twenty minutes later, rats were anesthetized using 5 % halothane, and the stomach was exposed and clamped at the pyloric and lower esophageal sphincters using artery forceps, removed and opened into an alkaline solution which was made up to a fixed volume. Stomach content was derived from the intensity of the phenol red in the alkaline solution, measured by absorbance at a wavelength of 560 nm.
The construction of recombinant plasmids The DNA fragments coding fusion proteins SUMO-PA and SUMO-PAG, which had a predicted size of approximately 430 bps (Fig. 2), were inserted into the pET-20b expression vector, resulting in the recombinant plasmids pET-SUMO-PA and pET-SUMO-PAG. The digestive (Fig. S2) and sequencing results of recombinant plasmids were found to be identical to the predicted sequences (data not shown). The expression and fermentation of SUMO-PAG The constructed expression vector, pET-SUMO-PAG, was transformed into E. coli Rosetta (DE3). The expression of an ~21-kDa protein corresponding to the predicted size was induced in the presence of IPTG. The optimal expression level reached to 36.3 % of the total supernatant protein in the shake flask fermentation (Fig. 3). In order to optimize the expression of SUMOPAG in 10-L scale of fermentation, a final concentration of 1 mM
Table 2 Summary of the purification of recombinant protein Purification steps
Total protein (mg)
Targeted protein (form) (mg)
Recovery (%)
Purity (%)
Yield (mg/L)
Ni-NTA Sepharose Sephadex S-100 Ni-NTA Sepharose
2601.62±106.3 815.35±32.9 497.33±35.14
SUMO-PAG SUMO-PAG PAG
90 75 25
80 87 95
117.1±4.1 85.81±2.4 20±1.9
887.67±64.1 639.68±16.8 119.94±13.2
The values (mean±SEM) shown are the averages of three independent measurements
Appl Microbiol Biotechnol
IPTG was added to induce expression at the beginning of the logarithmic growth phase of the cells (OD600 =0.6–0.8) at 37 °C. The cell density and expression level of SUMO-PAG continued to increase during the process of induction. At the end of fermentation, the biomass yielded 35±5.5-g/L wet cell weight, and the average expression level of SUMO-PAG reached 32±3.1 % in soluble form detected by SDS-PAGE (Figs. 4 and 5).
Fig. 8 MALDI-TOF MS analyses of rPA and PAG. a The unreduced rPA. b The reduced rPA. c The unreduced PAG
The purification and identification of the recombinant PAG Ni-NTA Sepharose and Sephadex S-100 column chromatography were employed to purify the fusion protein SUMOPAG. The purity of this fusion protein was over 80 %. After cleaving with SUMO protease, the mixtures, including PAG, SUMO protease, SUMO tag, and SUMO-PAG, were applied
Appl Microbiol Biotechnol
to the Ni-NTA Sepharose column to further purify the target protein (Fig. 6). The procedures of purification are summarized in Table 2. The final yield of PAG with over 95 % purity was 20±1.9 mg/L. The cleavage and purification process of rPA were the same as PAG as described above. Moreover, the authenticity of rPA and PAG was confirmed by Western blotting, MALDI-TOF MS, and N-terminal sequencing analysis. The Western blotting result showed that the PA antibody could react with purified rPA, PAG, and sPA as well as fusion protein SUMO-PAG (Fig. 7). The data of the MALDI-TOF MS showed that the molecular weight of rPA in reduced status was 3,947.94 Da, closed to theoretical mass weight 3,947.93 Da (Fig. 8a). On the other hand, the molecular weight of unreduced status rPA was 3,949.96 Da (Fig. 8b). Combined with the amino acid sequence of sPA (Fig. S1), these results demonstrated that the rPA possessed an intrachain disulfide bridge. Similarly, the theoretical mass weight of reduced form PAG is 4,008.48 Da while the molecular weight of unreduced PAG was 4,005.92 Da. This result suggested that PAG also contained an intrachain disulfide bridge (Fig. 8c). Moreover, 15 amino acids of N-terminal of PAG were the same as that of the sPA sequence (Fig. S3). PAG stimulates glucose uptake in cultured L6 myotubes To assess the differences in activity among PAG, rPA, and sPA in vitro, the effect of these proteins on glucose uptake under high glucose (11 mM) conditions was determined by mimicking the hyperglycemic conditions in diabetes. The results showed that the average glucose concentration of the supernatant treated by PAG was 91.06 mg/dL, less significantly than that of sPA-treated group (127.08 mg/dL). On the other hand, compared with rPA, the PAG was able to promote L6 cells to absorb glucose significantly (Fig. 9).
Fig. 9 The concentration of glucose uptake treated with either rPA, PAG, or sPA. The differentiated L6 cells were treated with either rPA, PAG, or sPA (1×10−6 mol/L) for 16 h. The glucose uptake concentrations were detected (n=4). Each column represents the mean±SEM (*P
BIOTECHNOLOGICALLY RELEVANT ENZYMES AND PROTEINS
Expression, purification, and biological activity of the recombinant pramlintide precursor Hao Hu & Qi Xiang & Hui Liu & Hongyan Qu & Xin Tang & Xue Xiao & Qihao Zhang & Zhijian Su & Yadong Huang
Received: 29 January 2014 / Revised: 14 March 2014 / Accepted: 15 March 2014 # Springer-Verlag Berlin Heidelberg 2014
Abstract Pramlintide is an artificially designed protein which has the same function as amylin in human body. This protein is extremely difficult to synthesize through prokaryotic expression method because of its two essential active sites, intrachain disulfide bond and C-terminal amide group. Since α-amidating monooxygenase is widely distributed in human and animal, it is possible to use pramlintide precursor with an additional C-terminal glycine (PAG), which is the potential substrate of α-amidating monooxygenase, for in vivo applications. The recombinant PAG was expressed in Escherichia coli using the small ubiquitin-related modifier (SUMO) as the molecular chaperone, and the optimal fusion expression level reached to 36.3 % of the total supernatant protein. Under optimal conditions in a 10-L fermentor, the recombinant PAG was obtained with a purity of greater than 95 %, and the average expression level was reached to 20 mg/L. The authenticity and the intrachain disulfide bridge of PAG were confirmed by Western blotting and matrix-assisted laser desorption/ionization coupled to time-of-flight mass spectrometry (MALDI-TOF MS) as well as N-terminal H. Hu and Q. Xiang contributed equally to this study. Electronic supplementary material The online version of this article (doi:10.1007/s00253-014-5699-2) contains supplementary material, which is available to authorized users. H. Hu : H. Qu : X. Tang : Y. Huang National Engineering Research Center of Genetic Medicine, Jinan University, Guangzhou 510632, China H. Liu : X. Xiao : Q. Zhang : Y. Huang (*) Institute of Biomedicine, Jinan University, Guangzhou 510632, China e-mail: [email protected] Q. Xiang : H. Liu : X. Xiao : Q. Zhang : Z. Su (*) Guangdong Provincial Key Laboratory of Bioengineering Medicine, Jinan University, Guangzhou 510632, China e-mail: [email protected]
sequencing of protein. Based on an L6 myoblast cell model in vitro and an animal model of gastric emptying in vivo, the results of activity revealed that PAG showed a lower biological activity in vitro but has almost the same activity as the chemically synthesized pramlintide in vivo. Keywords Amylin . Pramlintide precursor . Amidation . L6 myotubes . Gastric emptying
Introduction Amylin is a 37-amino-acid peptide hormone that is secreted with insulin by pancreatic cells in response to nutrient stimuli (Moore and Cooper 1991). Pramlintide (PA), a synthetic analog of human amylin, is the first in the new class of amylinomimetic compounds. It acts through the inhibition of postprandial glucagon secretion, thereby avoiding the effects of glucagon excess in driving hepatic glucose output during the postprandial period and prolonging of gastric emptying time, thus leading to a decrease in postprandial blood glucose level (Weyer et al. 2001; Nyholm et al. 1999). In 2005, pramlintide was approved as a subcutaneous injection for the adjunctive treatment of patients with type 1 or 2 diabetes mellitus (McQueen 2005). There are two important active sites in the pramlintide molecule: an intramolecular disulfide bond and a C-terminal amide group, both of which are necessary for the full biological activity of the peptide (Roberts et al. 1989). Modification alone has been found to restore only moderate activity. However, the recombinant protein containing both active sites could dramatically increase activity to approach that of the native molecule (Leighton and Cooper 1988). So far, commercial pramlintide is produced by chemical synthesis. The traditional means of genetic engineering that use prokaryotic expression systems have been unable to meet
Appl Microbiol Biotechnol
the need for posttranslational modification, i.e., carboxyl amidation of the peptide. Eukaryotic expression systems that are capable of in vivo modification may not produce sufficient quantities of pramlintide to be cost competitive with conventional peptide synthesis. α-Amidating monooxygenase is a membrane protein expressed, including endothelial cells, lung epithelial cells, muscle cells, brain ependymal cells, and astrocytes as well as endocrine cells (Rhodes et al. 1990; Maltese and Eipper 1992). Because α-amidating monooxygenase is widely distributed in various tissues and organs, a precursor of pramlintide with an additional C-terminal glycine (PAG) was designed and expressed. This precursor contains an intramolecular disulfide bond and is capable of acting as a potential substrate of α-amidating monooxygenase. It is hypothesized that PAG could be modified by α-amidating monooxygenase after injection into the organism and further develop into the active form. This approach may provide a potential new method of production and clinical treatment of analogous protein.
Materials and methods Reagents Restriction endonucleases, Pyrobest DNA polymerase, a Polymerase Chain Reaction Purification Kit, a Gel Extraction Kit, and a MiniBest Plasmid Purification Kit were purchased from Takara Company (Dalian, China). Isopropyl-β-D-1-thiogalactopyranoside (IPTG) was purchased from Genebase Company (Guangzhou, China). A Glucose Colorimetric Assay Kit was purchased from Cayman Chemical Company (MI, USA). The expression vector pET-small ubiquitinrelated modifier (SUMO), pET-20b(+) (Cat 69739-3, Merck, Darmstadt, Germany), Escherichia coli (E. coli) Rosetta (DE3) strain (Cat:70953-3, Merck), and the SUMO protease were obtained from the Biopharmaceutical Research and Development Center of Jinan University (Guangzhou, China). Rat skeletal muscle cell starin L6 (Cat CRL-1458) cells were obtained from the American Type Culture Collection (ATCC, Manassas, VA, USA). The PA polyclonal antibody was customized from Shenzhen Biochemical Science and Technology Co., Ltd. (Shenzhen, China). The synthesis of DNA fragments coding SUMO-PAG and SUMO-PA Bridge polymerase chain reaction (PCR) was used to obtain the DNA segment coding SUMO-PA fusion protein. The schematic of SUMO-PA synthesis using oligomers is shown in Fig. 1. Briefly, seven oligomers containing overlap regions were synthesized by Beijing Genetic Institute (Table 1). These oligomers were spliced together through their shared overlap regions, and the product was extended to form a double-
stranded fragment by several Taq DNA polymerase reactions (Su et al. 2006). This DNA segment was then cloned into the prokaryotic expression vector pET-20b to obtain the recombinant plasmid pET-SUMO-PA. The recombinant plasmid was transformed into E. coli Rosetta (DE3) cells. The recombinant transformants were selected by ampicillin resistance, and sequencing was performed by Shanghai Sangon Biological Engineering Technology and Services Co., Ltd. (Shanghai, China). The DNA fragment coding SUMO-PAG was amplified using pET-SUMO-PA as a template and SPAG-F and SPAG-R as primers. The recombinant plasmid pET-SUMOPAG and expression strain were also constructed by the above method. Expression and analysis of recombinant proteins Recombinants were inoculated in fresh 250-mL lysogeny broth (LB) medium and incubated at 37 °C on an orbital shaker (220 rpm) overnight. The culture was then transferred into a 10-L bioreactor (Biotop, Taiwan) with an initial working volume of 6-L. Following culture to an optical density (OD600) of 0.6–0.8, expression of the foreign protein was induced with the final concentration of 1 mM IPTG. The cells of 7-L medium were harvested 4 h after induction by centrifugation at 6,000×g for 20 min at 4 °C, and the pellet was frozen at −80 °C until required. The concentrated cells were resuspended in 50 mM TrisHCl buffer (pH 7.4) at 1:10 ratio (w/v) and disrupted by sonication. Following centrifugation at 12,000×g for 30 min at 4 °C, protein fractions in both the supernatant and pellet were analyzed to determine protein solubility by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDSPAGE) analysis. Protein quantification was achieved using ImageJ software, which measures the ratio of target protein to total protein based on gel band intensity. Purification and identification of the recombinant proteins After sonication, the supernatant was applied to the Ninitrilotriacetate (Ni-NTA) Sepharose column which was preequilibrated with phosphate-buffered saline (PBS, pH 7.0). After washing with three column volumes of wash buffer (PBS containing 20 mM imidazole, pH 7.0), the 6× Histagged SUMO-PAG or SUMO-PA was eluted using elution buffer (PBS containing 300 mM imidazole, pH 7.0). The fraction containing target protein was desalted using a Sephadex S-100 column with PBS buffer containing 10 % glycerol (pH 7.0) (v/v). The purity and the concentration of fusion protein were evaluated by SDS-PAGE and bicinchoninic acid (BCA) protein assay, respectively. The purified fusion proteins were diluted to a concentration of 1 mg/mL and cleaved by SUMO protease (final concentration
Appl Microbiol Biotechnol Fig. 1 Schematic of PCR amplification of SUMO-PA
Table 1 PCR primers for amplifying the genes coding SUMO-PA and SUMO-PAG
primers (from 5' to 3') P1 (42 nta): AAATGCAACACCGCGACCTGCGCGACCCAGCGCCTGGCGAAC P2 (43 nt): CAGCGCCTGGCGAACTTTCTGGTGCATTCTTCTAACAACTTTG P3(46 nt): GAGCCCACGTTGGTCGGCGGCAGAATCGGGCCAAAGTTGTTAGAAG P4 (48 nt): TAACTCGAGTTATCAATAGGTGTTAGAGCCCACGTTGGTCGGCGGCAG P5 (43 nt): CTCATTCCATATGCATCATCATCATCATCACGGCATGTCGGAC P6 (40 nt): ACAGAGAACAGATTGGTGGTAAATGCAACACCGCGACCTG P7 (44 nt): GCATTTACCACCAATCTGTTCTCTGTGAGCCTCAATGATATCGT SPAG-F (39 nt): CTCATTCCATATGCATCATCATCATCATCACGGCATGTC SPAG-R (37 nt): CGCGGATCCTTAGCCATAGGTGTTAGAGCCCACGTTG Restriction enzyme recognition sites used for cloning were Nde I (P5 and SPAG-F), Xho I (P4) as well as BamH I (SPAG-R) indicated in boxed letters. The sequence of bold letters showed in P5 and SPAG-F was 6× His tag nt nucleotide
Appl Microbiol Biotechnol
Fig. 4 The SDS-PAGE analyses of SUMO-PAG during the process of fermentation. M protein molecular weight markers; lane 1 preinduction as a control; lanes 2–5 expression of SUMO-PAG in a 10-L fermentor, induced for 1, 2, 3, and 4 h, respectively; lane 6 the supernatant fraction of the sonicated cells; and lane 7 the expression of SUMO-PAG from the sediment fraction of the sonicated cells. The expression band pointed by the arrow was the recombinant fusion protein Fig. 2 The analyses of PCR fragments coding SUMO-PA and SUMOPAG. M DNA molecular weight marker, lane 1 PCR fragment coding SUMO-PAG, and lane 2 PCR fragment coding SUMO-PA
10 IU/mL) at 30 °C for 1 h. The cleaved samples were reloaded on the Ni-NTA resin, and the contaminants were removed. The recombinant PA (rPA) and PAG were pooled by PBS containing 10 % glycerol (v/v). The schematic diagram of rPA, PAG, and the artificial synthesized PA (sPA) is shown in Fig. S1. The apparent molecular weight and the purity of these recombinant proteins were detected by SDSPAGE and Western blotting. The analysis of accurate molecular weight and N-terminal sequencing of recombinant proteins were performed by matrix-assisted laser desorption/ ionization-time-of-flight mass spectrometry (MALDI-TOF MS) and Edman degradation reaction, respectively.
Fig. 3 The SDS-PAGE analyses of SUMO-PAG expression. M protein molecular weight markers, lane 1 preinduced Rosetta (DE3)/pET-SUMO-PAG, and lane 2 Rosetta (DE3)/pET-SUMO-PAG induced by 1 mM IPTG at 37 °C for 4 h. The expression band pointed by the arrow was the recombinant fusion protein
Determination of glucose uptake by cultured L6 myotubes L6 myoblast cells were subcultured into Corning 24-well plates at 5×104 cells/well and grown for 11 days in 0.4-mL Dulbecco's Modified Eagle Medium (DMEM) plus 2 % fetal bovine serum (v/v) to allow the formation of myotubes. The medium was renewed every 2 days. The 11-day-old myotubes were incubated in filter-sterilized Krebs–Henseleit HEPES (KHH) buffer (141 mg/L Mg2SO4, 160 mg/L KH2PO4, 350 mg/L KCl, 6,900 mg/L NaCl, 373 mg/L CaCl2 ·2H2O, 2,100 mg/L NaHCO3, pH 7.4) containing 0.1 % bovine serum albumin (v/v), 10 mM HEPES, and 2 mM sodium pyruvate for 2 h. Subsequently, the myotubes were cultured for 16 h in KHH buffer containing 11 mM glucose with a final concentration of 10−6-mol/L rPA, PAG, and sPA. A culture supernatant of 100 μL was collected and centrifuged at 12,000×g for 10 min at 4 °C. The concentration of glucose in the
Fig. 5 The variation of parameters in 10-L scale fermentation production of SUMO-PAG. Under the optimal fermentation conditions, the expression level of SUMO-PAG gradually increased over time and achieved maximum at 4 h after induction. The changes in parameters including wet cell weight and expression level in the process of 10-L fermentation were recorded by time course
Appl Microbiol Biotechnol
Fig. 6 The cleavage and purification of SUMO-PAG detected by Trisglycine SDS-PAGE. M Ultra-low molecular weight protein marker, lane 1 SUMO-PAG digested by SUMO protease for 1 h, lane 2 purified PAG, and lane 3 purified rPA
supernatant was determined by the Cayman Glucose Colorimetric Assay Kit (MI, USA).
Fig. 7 The Western blotting of recombinant proteins using PA polyclone antibody. Lane 1 the purified SUMO-PAG fusion protein, lane 2 purified PAG, lane 3 purified rPA, and lane 4 sPA
The following formula was used to calculate the percentage of gastric content remaining. Percent gastric content remaining= (absorbance at 20 min)/(absorbance at 0 min)×100.
Measurement of gastric emptying—phenol red method Results Adult male Harlan Sprague Dawley (HSD) rats (average weight approximated 235±10 g) obtained from Guangdong Medical Experimental Animal Center were housed at 23±1 °C in a 12:12 h light–dark cycle and fed and watered ad libitum. Experiments were performed during the light cycle on animals deprived of food for 18 h but allowed free access to water. Gastric emptying assay was performed based on the method described previously (Young et al. 1995). The rPA, PAG, and sPA dissolved in 0.15-mol/L saline were administered as a 0.5-mL subcutaneous bolus in doses of 150 μg/rat. The corresponding volume of saline solution was injected in the control group. After 5 min of injection, rats were administered 1.5 mL acaloric gel containing 1.5 % methyl cellulose and 0.05 % phenol red indicator by gavage. Twenty minutes later, rats were anesthetized using 5 % halothane, and the stomach was exposed and clamped at the pyloric and lower esophageal sphincters using artery forceps, removed and opened into an alkaline solution which was made up to a fixed volume. Stomach content was derived from the intensity of the phenol red in the alkaline solution, measured by absorbance at a wavelength of 560 nm.
The construction of recombinant plasmids The DNA fragments coding fusion proteins SUMO-PA and SUMO-PAG, which had a predicted size of approximately 430 bps (Fig. 2), were inserted into the pET-20b expression vector, resulting in the recombinant plasmids pET-SUMO-PA and pET-SUMO-PAG. The digestive (Fig. S2) and sequencing results of recombinant plasmids were found to be identical to the predicted sequences (data not shown). The expression and fermentation of SUMO-PAG The constructed expression vector, pET-SUMO-PAG, was transformed into E. coli Rosetta (DE3). The expression of an ~21-kDa protein corresponding to the predicted size was induced in the presence of IPTG. The optimal expression level reached to 36.3 % of the total supernatant protein in the shake flask fermentation (Fig. 3). In order to optimize the expression of SUMOPAG in 10-L scale of fermentation, a final concentration of 1 mM
Table 2 Summary of the purification of recombinant protein Purification steps
Total protein (mg)
Targeted protein (form) (mg)
Recovery (%)
Purity (%)
Yield (mg/L)
Ni-NTA Sepharose Sephadex S-100 Ni-NTA Sepharose
2601.62±106.3 815.35±32.9 497.33±35.14
SUMO-PAG SUMO-PAG PAG
90 75 25
80 87 95
117.1±4.1 85.81±2.4 20±1.9
887.67±64.1 639.68±16.8 119.94±13.2
The values (mean±SEM) shown are the averages of three independent measurements
Appl Microbiol Biotechnol
IPTG was added to induce expression at the beginning of the logarithmic growth phase of the cells (OD600 =0.6–0.8) at 37 °C. The cell density and expression level of SUMO-PAG continued to increase during the process of induction. At the end of fermentation, the biomass yielded 35±5.5-g/L wet cell weight, and the average expression level of SUMO-PAG reached 32±3.1 % in soluble form detected by SDS-PAGE (Figs. 4 and 5).
Fig. 8 MALDI-TOF MS analyses of rPA and PAG. a The unreduced rPA. b The reduced rPA. c The unreduced PAG
The purification and identification of the recombinant PAG Ni-NTA Sepharose and Sephadex S-100 column chromatography were employed to purify the fusion protein SUMOPAG. The purity of this fusion protein was over 80 %. After cleaving with SUMO protease, the mixtures, including PAG, SUMO protease, SUMO tag, and SUMO-PAG, were applied
Appl Microbiol Biotechnol
to the Ni-NTA Sepharose column to further purify the target protein (Fig. 6). The procedures of purification are summarized in Table 2. The final yield of PAG with over 95 % purity was 20±1.9 mg/L. The cleavage and purification process of rPA were the same as PAG as described above. Moreover, the authenticity of rPA and PAG was confirmed by Western blotting, MALDI-TOF MS, and N-terminal sequencing analysis. The Western blotting result showed that the PA antibody could react with purified rPA, PAG, and sPA as well as fusion protein SUMO-PAG (Fig. 7). The data of the MALDI-TOF MS showed that the molecular weight of rPA in reduced status was 3,947.94 Da, closed to theoretical mass weight 3,947.93 Da (Fig. 8a). On the other hand, the molecular weight of unreduced status rPA was 3,949.96 Da (Fig. 8b). Combined with the amino acid sequence of sPA (Fig. S1), these results demonstrated that the rPA possessed an intrachain disulfide bridge. Similarly, the theoretical mass weight of reduced form PAG is 4,008.48 Da while the molecular weight of unreduced PAG was 4,005.92 Da. This result suggested that PAG also contained an intrachain disulfide bridge (Fig. 8c). Moreover, 15 amino acids of N-terminal of PAG were the same as that of the sPA sequence (Fig. S3). PAG stimulates glucose uptake in cultured L6 myotubes To assess the differences in activity among PAG, rPA, and sPA in vitro, the effect of these proteins on glucose uptake under high glucose (11 mM) conditions was determined by mimicking the hyperglycemic conditions in diabetes. The results showed that the average glucose concentration of the supernatant treated by PAG was 91.06 mg/dL, less significantly than that of sPA-treated group (127.08 mg/dL). On the other hand, compared with rPA, the PAG was able to promote L6 cells to absorb glucose significantly (Fig. 9).
Fig. 9 The concentration of glucose uptake treated with either rPA, PAG, or sPA. The differentiated L6 cells were treated with either rPA, PAG, or sPA (1×10−6 mol/L) for 16 h. The glucose uptake concentrations were detected (n=4). Each column represents the mean±SEM (*P
