152
Biochimica et Biophysica Acta, 1131 (1992) 152-160 © 1992 Elsevier Science Publishers B.V. All rights reserved 0167-4781/92/$05.00
BBAEXP 92382
Expression of Xenopus laevis histone H5 gene in yeast P.S. Shwed a,b, J.M. Neelin b and V.L. Seligy a,b " Molecular Cell Biology, Institute of Biological Sciences, National Research Council of Canada, Ottawa (Canada) and i, Department of Biology, Carleton Unicersity, Ottawa (Canada) (Received 2 October 1991 )
Key words: GAL 10 promoter; Heterologous gene expression; Lysine-rich histone; Transcription; Upstream activation sequence; ( S. cereeisiae) As an approach to assess linker histone function, we engineered a cDNA encoding Xenopus laeL'is histone H5 (XLH5), into the yeast Saccharomyces ceret,isiae, which lacks any known proteins homologous to linker histones. XLH5 cDNA when fused to the yeast GALl() promoter and 5' untranslated region (UTR) was shown to be accurately transcribed at relatively high levels in cells harvested at mid to late log after exposure to at least 22 mM galactose. The resultant 0.95 kb XLH5 transcript reached steady state levels by approx. 2 h after galactose induction. In contrast, the product, detected by anti-XLH5 antibody, was not stably expressed until 4 h or more after induction, when no apparent growth takes place. The expression product was 27% smaller than native H5 and may have been proteolytically processed. Constitutive transcription and loss of XLH5 expression product occurred using a plasmid construct containing a 275 bp fragment of the pBR322 tet r gene inserted downstream of the GALIO promoter. This fragment carries a putative yeast cell-type-specific upstream activation sequence.
Introduction Most cells c o n t a i n histone H1 in the form of several subtypes, however, avian and some a m p h i b i a n nuclea t e d e r y t h r o c y t e s also c o n t a i n h i s t o n e H5 [1-4]. D u r i n g e r y t h r o c y t e m a t u r a t i o n , nuclei c o n t a i n i n g H5 b e c o m e c o n d e n s e d [5-7] a n d the cells b e c o m e t r a n s c r i p t i o n a l l y as well as t r a n s l a t i o n a l l y inactive [8,9]. Since H5 accum u l a t e s d u r i n g the e r y t h r o c y t e m a t u r a t i o n process, it has b e e n s u g g e s t e d as a c h r o m a t i n r e p r e s s o r (Refs. 10-13, reviewed in Refs. 14, 15). This i n t e r p r e t a t i o n is s u p p o r t e d by r e c e n t e x p e r i m e n t s in which the function of H5 has b e e n investigated by injection of chicken H5 into p r o l i f e r a t i n g rat myoblasts [16] a n d expression of
Abbreviations: ds, double stranded; GALIO, gene coding for uridine diphosphoglucose 4-epimerase; LEU2, gene coding for /3-isopropylmalate dehydrogenase; LH, linker bistone; LHE, linker histone extract: PEP4, gene coding for proteinase A precursor; PMSF, phenylmethylsulfonyl fluoride; PRBI, gene coding for proteinase B; ss, single stranded; SSC, 0.15 M NaCI, 0.015 M trisodium citrate (pH 7.6): TAE, 40 mM Tris-acetate. 2 mM EDTA (pH 8.0): TBE, 89 mM Tris-borate, 89 mM boric acid, 2 mM EDTA (pH 8.0); tetr, tetracycline resistance gene; UAS, upstream activation sequence; UTR, untranslated region, XLH5, Xenopus laeL'is histone H5. Correspondence to: V.L. Seligy, Molecular Cell Biology, Institute of Biological Sciences, National Research Council of Canada, Building M-54, Montreal Rd., Ottawa, Ontario, Canada K1A 0R6.
the chicken H5 g e n e in rat s a r c o m a cells [17] and chicken a n d quail e m b r y o fibroblasts [18]. A s p a r t of an a s s e s s m e n t o f H5 function by p r o t e i n e n g i n e e r i n g , we have t e s t e d the use of the y e a s t Saccharomyces cereL, isiae which d o e s not have any known linker histone, by i n t r o d u c i n g into it c D N A e n c o d i n g Xenopus laet,is H5 ( X L H 5 ) [19]. To circumvent the possible d e l e t e r i o u s effect of X L H 5 , the c D N A was fused to the S. cerevisiae G A L I O p r o m o t e r and 5' U T R , which can direct t r a n s c r i p t i o n of h e t e r o l o g o u s genes only in the p r e s e n c e of galactose [20-25]. In this r e p o r t we d e s c r i b e s o m e of the X L H 5 expression results o b t a i n e d by using this system. In addition, we d e s c r i b e d a p u t a t i v e activation s e q u e n c e residing within p B R 3 2 2 s e q u e n c e s of the p a r e n t a l v e c t o r which significantly alters expression of X L H 5 a n d has g e n e r a l relevance for h e t e r o l o g o u s expression studies using yeast.
Materials and Methods Bacterial and yeast cell manipulations Escherichia coli JM103 was used as a host for chimeric clones c o n t a i n i n g X L H 5 c D N A . Y e a s t strains used in this study w e r e N R C C 5143 ( M A T a a d e l , leu2-3, l e u 2 - 1 1 2 his 3 - 1 5 ) a n d N R C C 5055 ( h o m o thallic leu2). C o m p e t e n t E. coli cells, used for transf o r m a t i o n by e l e c t r o p o r a t i o n , w e r e m a d e a c c o r d i n g to C h u n g et al. [26]. Y e a s t t r a n s f o r m a n t s were o b t a i n e d
153 with the spheroplasting method described by Beggs [27], using glusulase (Endo Laboratories). Plasmid constructs and analysis XLH5 cDNA was engineered to be under transcriptional control of the S. cerevisiae GALIO promoter in the vector YEp51 (provided by Dr. J. Broach [20]). Two constructs were recovered from the cloning experiment: YEpH5A-2 and YEpH5A-i2 (Fig. 1). The former contains 770 nt of XLH5 cDNA from p9H5A-2 (BamHI fragment) in the same orientation as the GALIO promoter of YEp51 and the latter contains the same XLH5 cDNA as in YEpH5A-2, but cloned into YEp51 BamHI. Plasmid DNA was isolated from E. coil as described by Maniatis et al. [28]. Total DNA was isolated from S. cerevisiae as described by Hoffman and Winston [29] and probed with XLH5 cDNA or YEp51 fragments radiolabelled by nick translation [20]
A
[-3,A]~
Bam H1
or random-priming [30] with [a-32p]dATP using single stranded (ss)DNA hexanucleotide primers (Boehringer-Mannheim). Sequencing of double stranded (ds) plasmid DNA was carried out by the chain termination method [31] using Sequenase [32]. X L H 5 expression analysis Total RNA from yeast cells incubated in media containing either 22 mM glucose, galactose or sucrose was isolated as described by Dowhanick et al. [33]. Yeast poly(A) + mRNA was enriched from 1 mg total RNA selected by oligo(dT) cellulose chromatography, as described in Maniatis et al. [28]. RNA was electrophoresed in 1% agarose, 0.66 M formaldehyde gels in Mops buffer [34] and transferred to nylon filters by electroblotting or capillary blotting before hybridization in 50% deionized formamide. Determination of the 5' end of yeast XLH5 transcripts was carried out by
[+4,~u]
__Pvull
Met Ala Glu Asn Ser Ala Ala Thr Pro ~la AJa Lys HSBP-f: 5"[ GATOGGTr~ C ATG GCA GAG AAC TCA GCC GCT ACT CCA 'Glct qcc aaa 3' HSPB-R 3" IGClM&TF(3TACCGTCTCTTGAGTCGGCGATGA GGTC~gacggttt 5' Hpal N\
\
/
/ /
_/
B
s
GALl00~ ~
LEU2/~
~
1
B H ~EH ~E
B
"~
. .~REP3
H5
B
~
Fig. 1. Construction of GALIO promoter-XLH5 cDNA fusion plasmid. (A) Restriction enzyme sites were introduced at the 5' end of XLH5A cDNA using the synthetic oligonucleotide linkers H5BP-F and H5PB-R. (B) Plasmid constructs. Resultant plasmids p9H5A-2 and p8H5A-2 (not shown) contain XLH5 cDNA cloned in the BamHI-EcoRI site of p U C l l 8 and p U C l l 9 , respectively. The modified cDNA on a 0.8 kb BamHI fragment was introduced into the 2 I-~m derived YEp51 plasmid resulting in two constructs: plasmid YEpH5A-2 containing XLH5 cDNA inserted in the Sall to BamHI site of YEp51 and plasmid YEpH5A-i2 containing the XLH5 cDNA inserted in the BamHI site of YEp51 (not shown). The SalI-BamHI ends were ligated after both ends were filled-in with dNTPs and T4 DNA pol. Symbols: GALIO, 0.5 kb S. cerevisiae GALIO promoter; Ap r, E. coli/3-1actamase gene encoding ampicillin resistance; ORI (o), S. cerecisiae 2 p,m circle origin of replication; ORI (0), E. coli ColE1 origin of replication; REP3, S. cerevisiae 2 ~ m circle REP3 locus; t, 2 # m transcription termination site; cross-hatched zone, X. laeuis H5 cDNA; arrows, nucleotide choices favourable for initiation of translation (adenine at position - 3 and guanine at +4) with respect to the translation start site; boxed sequence, linker oligonucleotide sequences; lower case letters, original XLH5 cDNA; underlined are restriction endonuclease sites; jagged line, tet r fragment of E. coli tetracycline resistance gene. Restriction sites: B, BamHI; S, Sall; H, HindIII; E, EcoRI.
154 primer extension as described by Tajbakhsh et al. [35], using 8 ng of the primer 5-D24R (5'-CAA T A T CAT G T C A G A G T A C T T A G G G T G GT-3', codons Leu-33 to Asp-24 of the XLH5 gene), 42 units of reverse transcriptase (Molecular Genetics Resources Super RT) and 40/xg of total R N A from induced cells with incubation at 37°C for 1 h. Total protein was extracted from snap frozen yeast cells by combining cells with an equal volume of glass beads and two volumes of cracking buffer (10 mM Tris-HC1 (pH 8.0), 1 mM E D T A (pH 8.0), 1 mM PMSF, 1 mM dithiothreitol) and vortexing at high speed for 2 min. Yeast cell contents were released by alternate 2 rain cycles of vortexing in cracking buffer at high speed and cooling of lysate on ice. Cell debris was removed by centrifugation (5K, 5 min) at 4°C. An equal volume of 2 × Laemmli buffer was added to the supernatant and the mixture was boiled (100°C, 5 rain). After remaining ceil debris was pelleted by centrifugation. the supernatant was stored at - 2 0 ° C . Proteins were fractionated by sodium dodecyl sulfate (SDS) polyacrylamide gel electrophoresis [36] in 13% separating and 7% stacking gels. Electrophoresed proteins were transferred to nitrocellulose (0.45 # m , Schliecher and Schuell), as outlined for analysis of lysine-rich histories by Shay et al. [37], using a mini-trans-blot electrophoretic transfer cell (Bio-Rad). The gel was incubated in half-strength Laemmli reservoir buffer (0.01% SDS (w/v), 12.5 mM Tris, 96 mM glycine). Transfer was conducted in half-strength Laemmli reservoir buffer in an electroblot apparatus at 20 V for 1.5-2 h. Amount of proteins transferred was assessed by staining of the gel with Coomassie Blue R. Anti-XLH5 antiserum prepared from guinea-pig [37], was cross-reacted either to intracellular proteins extracted from S. ceret'isiae YEp51 transformants grown to mid-log in 100 ml Y E P D medium. Cell harvest and lysis was similar to above. Yeast cells were lyscd in TBS by three successive cycles of boiling and 'snap' freezing. Cell debris was removed by high speed centrifugation. Immunodetection was carried out using anti-XLH5 antiserum (1:50 000) and Biotin-Sp-Affinipure goat anti-guinea-pig lgG(H + L) (Jackson Immunoresearch Laboratories), as described by Oberfelder [38].
tion products recovered after transformation of JM103, such as YEpH5A-2, were initially identified on the basis of restriction site mapping. A second clone recovered from the ligation, designated YEpH5A-i2, contained XLH5 c D N A cloned in the BamHI site of YEp51 with the consequence that a 275 bp portion of the t e t ' gene of pBR322 (position 650-375), which should have been excised with SaII, remained. The YEpH5A-i2 clone, with its GALIO promoter separated from the normal transcription phasing of the expression cassette, was used as a control for expression studies in yeast.
Yeast transformation and screening Both haploid (5143) and diploid (5055) strains were transformed with YEp51, YEpH5A-2 and YEpH5A-i2. Colony hybridization was used to initially screen for yeast transformants containing XLH5 c D N A (data not shown). Proof of transformation was obtained by positive hybridization of XLH5 c D N A (BamHI fragment) to uncut and HindII1 digested total D N A from select colonies that were able to grow without leucine. Similar analyses using untransformed 5143 and 5055 strains 0.8
0.6 E
cO
c) ~o i.u z
0.4
.< nn rt"
~i~¸
Cloning partial XLH5 cDNA XLH5 e D N A containing codons 11-196 and 200 nt of 3' U T R was fused with a BamHI-Pt'uII linker, as illustrated in Fig. 1. This permitted excision of the XLH5 c D N A as a BamHI fragment from p9H5A-2 and ligation of one end to YEp51 cleaved with SalI and BamHI. The 3' recessed free ends of the two fragments were 'filled-in' and blunt end ligated. Liga-
ii!!i
nn
Biochimica et Biophysica Acta, 1131 (1992) 152-160 © 1992 Elsevier Science Publishers B.V. All rights reserved 0167-4781/92/$05.00
BBAEXP 92382
Expression of Xenopus laevis histone H5 gene in yeast P.S. Shwed a,b, J.M. Neelin b and V.L. Seligy a,b " Molecular Cell Biology, Institute of Biological Sciences, National Research Council of Canada, Ottawa (Canada) and i, Department of Biology, Carleton Unicersity, Ottawa (Canada) (Received 2 October 1991 )
Key words: GAL 10 promoter; Heterologous gene expression; Lysine-rich histone; Transcription; Upstream activation sequence; ( S. cereeisiae) As an approach to assess linker histone function, we engineered a cDNA encoding Xenopus laeL'is histone H5 (XLH5), into the yeast Saccharomyces ceret,isiae, which lacks any known proteins homologous to linker histones. XLH5 cDNA when fused to the yeast GALl() promoter and 5' untranslated region (UTR) was shown to be accurately transcribed at relatively high levels in cells harvested at mid to late log after exposure to at least 22 mM galactose. The resultant 0.95 kb XLH5 transcript reached steady state levels by approx. 2 h after galactose induction. In contrast, the product, detected by anti-XLH5 antibody, was not stably expressed until 4 h or more after induction, when no apparent growth takes place. The expression product was 27% smaller than native H5 and may have been proteolytically processed. Constitutive transcription and loss of XLH5 expression product occurred using a plasmid construct containing a 275 bp fragment of the pBR322 tet r gene inserted downstream of the GALIO promoter. This fragment carries a putative yeast cell-type-specific upstream activation sequence.
Introduction Most cells c o n t a i n histone H1 in the form of several subtypes, however, avian and some a m p h i b i a n nuclea t e d e r y t h r o c y t e s also c o n t a i n h i s t o n e H5 [1-4]. D u r i n g e r y t h r o c y t e m a t u r a t i o n , nuclei c o n t a i n i n g H5 b e c o m e c o n d e n s e d [5-7] a n d the cells b e c o m e t r a n s c r i p t i o n a l l y as well as t r a n s l a t i o n a l l y inactive [8,9]. Since H5 accum u l a t e s d u r i n g the e r y t h r o c y t e m a t u r a t i o n process, it has b e e n s u g g e s t e d as a c h r o m a t i n r e p r e s s o r (Refs. 10-13, reviewed in Refs. 14, 15). This i n t e r p r e t a t i o n is s u p p o r t e d by r e c e n t e x p e r i m e n t s in which the function of H5 has b e e n investigated by injection of chicken H5 into p r o l i f e r a t i n g rat myoblasts [16] a n d expression of
Abbreviations: ds, double stranded; GALIO, gene coding for uridine diphosphoglucose 4-epimerase; LEU2, gene coding for /3-isopropylmalate dehydrogenase; LH, linker bistone; LHE, linker histone extract: PEP4, gene coding for proteinase A precursor; PMSF, phenylmethylsulfonyl fluoride; PRBI, gene coding for proteinase B; ss, single stranded; SSC, 0.15 M NaCI, 0.015 M trisodium citrate (pH 7.6): TAE, 40 mM Tris-acetate. 2 mM EDTA (pH 8.0): TBE, 89 mM Tris-borate, 89 mM boric acid, 2 mM EDTA (pH 8.0); tetr, tetracycline resistance gene; UAS, upstream activation sequence; UTR, untranslated region, XLH5, Xenopus laeL'is histone H5. Correspondence to: V.L. Seligy, Molecular Cell Biology, Institute of Biological Sciences, National Research Council of Canada, Building M-54, Montreal Rd., Ottawa, Ontario, Canada K1A 0R6.
the chicken H5 g e n e in rat s a r c o m a cells [17] and chicken a n d quail e m b r y o fibroblasts [18]. A s p a r t of an a s s e s s m e n t o f H5 function by p r o t e i n e n g i n e e r i n g , we have t e s t e d the use of the y e a s t Saccharomyces cereL, isiae which d o e s not have any known linker histone, by i n t r o d u c i n g into it c D N A e n c o d i n g Xenopus laet,is H5 ( X L H 5 ) [19]. To circumvent the possible d e l e t e r i o u s effect of X L H 5 , the c D N A was fused to the S. cerevisiae G A L I O p r o m o t e r and 5' U T R , which can direct t r a n s c r i p t i o n of h e t e r o l o g o u s genes only in the p r e s e n c e of galactose [20-25]. In this r e p o r t we d e s c r i b e s o m e of the X L H 5 expression results o b t a i n e d by using this system. In addition, we d e s c r i b e d a p u t a t i v e activation s e q u e n c e residing within p B R 3 2 2 s e q u e n c e s of the p a r e n t a l v e c t o r which significantly alters expression of X L H 5 a n d has g e n e r a l relevance for h e t e r o l o g o u s expression studies using yeast.
Materials and Methods Bacterial and yeast cell manipulations Escherichia coli JM103 was used as a host for chimeric clones c o n t a i n i n g X L H 5 c D N A . Y e a s t strains used in this study w e r e N R C C 5143 ( M A T a a d e l , leu2-3, l e u 2 - 1 1 2 his 3 - 1 5 ) a n d N R C C 5055 ( h o m o thallic leu2). C o m p e t e n t E. coli cells, used for transf o r m a t i o n by e l e c t r o p o r a t i o n , w e r e m a d e a c c o r d i n g to C h u n g et al. [26]. Y e a s t t r a n s f o r m a n t s were o b t a i n e d
153 with the spheroplasting method described by Beggs [27], using glusulase (Endo Laboratories). Plasmid constructs and analysis XLH5 cDNA was engineered to be under transcriptional control of the S. cerevisiae GALIO promoter in the vector YEp51 (provided by Dr. J. Broach [20]). Two constructs were recovered from the cloning experiment: YEpH5A-2 and YEpH5A-i2 (Fig. 1). The former contains 770 nt of XLH5 cDNA from p9H5A-2 (BamHI fragment) in the same orientation as the GALIO promoter of YEp51 and the latter contains the same XLH5 cDNA as in YEpH5A-2, but cloned into YEp51 BamHI. Plasmid DNA was isolated from E. coil as described by Maniatis et al. [28]. Total DNA was isolated from S. cerevisiae as described by Hoffman and Winston [29] and probed with XLH5 cDNA or YEp51 fragments radiolabelled by nick translation [20]
A
[-3,A]~
Bam H1
or random-priming [30] with [a-32p]dATP using single stranded (ss)DNA hexanucleotide primers (Boehringer-Mannheim). Sequencing of double stranded (ds) plasmid DNA was carried out by the chain termination method [31] using Sequenase [32]. X L H 5 expression analysis Total RNA from yeast cells incubated in media containing either 22 mM glucose, galactose or sucrose was isolated as described by Dowhanick et al. [33]. Yeast poly(A) + mRNA was enriched from 1 mg total RNA selected by oligo(dT) cellulose chromatography, as described in Maniatis et al. [28]. RNA was electrophoresed in 1% agarose, 0.66 M formaldehyde gels in Mops buffer [34] and transferred to nylon filters by electroblotting or capillary blotting before hybridization in 50% deionized formamide. Determination of the 5' end of yeast XLH5 transcripts was carried out by
[+4,~u]
__Pvull
Met Ala Glu Asn Ser Ala Ala Thr Pro ~la AJa Lys HSBP-f: 5"[ GATOGGTr~ C ATG GCA GAG AAC TCA GCC GCT ACT CCA 'Glct qcc aaa 3' HSPB-R 3" IGClM&TF(3TACCGTCTCTTGAGTCGGCGATGA GGTC~gacggttt 5' Hpal N\
\
/
/ /
_/
B
s
GALl00~ ~
LEU2/~
~
1
B H ~EH ~E
B
"~
. .~REP3
H5
B
~
Fig. 1. Construction of GALIO promoter-XLH5 cDNA fusion plasmid. (A) Restriction enzyme sites were introduced at the 5' end of XLH5A cDNA using the synthetic oligonucleotide linkers H5BP-F and H5PB-R. (B) Plasmid constructs. Resultant plasmids p9H5A-2 and p8H5A-2 (not shown) contain XLH5 cDNA cloned in the BamHI-EcoRI site of p U C l l 8 and p U C l l 9 , respectively. The modified cDNA on a 0.8 kb BamHI fragment was introduced into the 2 I-~m derived YEp51 plasmid resulting in two constructs: plasmid YEpH5A-2 containing XLH5 cDNA inserted in the Sall to BamHI site of YEp51 and plasmid YEpH5A-i2 containing the XLH5 cDNA inserted in the BamHI site of YEp51 (not shown). The SalI-BamHI ends were ligated after both ends were filled-in with dNTPs and T4 DNA pol. Symbols: GALIO, 0.5 kb S. cerevisiae GALIO promoter; Ap r, E. coli/3-1actamase gene encoding ampicillin resistance; ORI (o), S. cerecisiae 2 p,m circle origin of replication; ORI (0), E. coli ColE1 origin of replication; REP3, S. cerevisiae 2 ~ m circle REP3 locus; t, 2 # m transcription termination site; cross-hatched zone, X. laeuis H5 cDNA; arrows, nucleotide choices favourable for initiation of translation (adenine at position - 3 and guanine at +4) with respect to the translation start site; boxed sequence, linker oligonucleotide sequences; lower case letters, original XLH5 cDNA; underlined are restriction endonuclease sites; jagged line, tet r fragment of E. coli tetracycline resistance gene. Restriction sites: B, BamHI; S, Sall; H, HindIII; E, EcoRI.
154 primer extension as described by Tajbakhsh et al. [35], using 8 ng of the primer 5-D24R (5'-CAA T A T CAT G T C A G A G T A C T T A G G G T G GT-3', codons Leu-33 to Asp-24 of the XLH5 gene), 42 units of reverse transcriptase (Molecular Genetics Resources Super RT) and 40/xg of total R N A from induced cells with incubation at 37°C for 1 h. Total protein was extracted from snap frozen yeast cells by combining cells with an equal volume of glass beads and two volumes of cracking buffer (10 mM Tris-HC1 (pH 8.0), 1 mM E D T A (pH 8.0), 1 mM PMSF, 1 mM dithiothreitol) and vortexing at high speed for 2 min. Yeast cell contents were released by alternate 2 rain cycles of vortexing in cracking buffer at high speed and cooling of lysate on ice. Cell debris was removed by centrifugation (5K, 5 min) at 4°C. An equal volume of 2 × Laemmli buffer was added to the supernatant and the mixture was boiled (100°C, 5 rain). After remaining ceil debris was pelleted by centrifugation. the supernatant was stored at - 2 0 ° C . Proteins were fractionated by sodium dodecyl sulfate (SDS) polyacrylamide gel electrophoresis [36] in 13% separating and 7% stacking gels. Electrophoresed proteins were transferred to nitrocellulose (0.45 # m , Schliecher and Schuell), as outlined for analysis of lysine-rich histories by Shay et al. [37], using a mini-trans-blot electrophoretic transfer cell (Bio-Rad). The gel was incubated in half-strength Laemmli reservoir buffer (0.01% SDS (w/v), 12.5 mM Tris, 96 mM glycine). Transfer was conducted in half-strength Laemmli reservoir buffer in an electroblot apparatus at 20 V for 1.5-2 h. Amount of proteins transferred was assessed by staining of the gel with Coomassie Blue R. Anti-XLH5 antiserum prepared from guinea-pig [37], was cross-reacted either to intracellular proteins extracted from S. ceret'isiae YEp51 transformants grown to mid-log in 100 ml Y E P D medium. Cell harvest and lysis was similar to above. Yeast cells were lyscd in TBS by three successive cycles of boiling and 'snap' freezing. Cell debris was removed by high speed centrifugation. Immunodetection was carried out using anti-XLH5 antiserum (1:50 000) and Biotin-Sp-Affinipure goat anti-guinea-pig lgG(H + L) (Jackson Immunoresearch Laboratories), as described by Oberfelder [38].
tion products recovered after transformation of JM103, such as YEpH5A-2, were initially identified on the basis of restriction site mapping. A second clone recovered from the ligation, designated YEpH5A-i2, contained XLH5 c D N A cloned in the BamHI site of YEp51 with the consequence that a 275 bp portion of the t e t ' gene of pBR322 (position 650-375), which should have been excised with SaII, remained. The YEpH5A-i2 clone, with its GALIO promoter separated from the normal transcription phasing of the expression cassette, was used as a control for expression studies in yeast.
Yeast transformation and screening Both haploid (5143) and diploid (5055) strains were transformed with YEp51, YEpH5A-2 and YEpH5A-i2. Colony hybridization was used to initially screen for yeast transformants containing XLH5 c D N A (data not shown). Proof of transformation was obtained by positive hybridization of XLH5 c D N A (BamHI fragment) to uncut and HindII1 digested total D N A from select colonies that were able to grow without leucine. Similar analyses using untransformed 5143 and 5055 strains 0.8
0.6 E
cO
c) ~o i.u z
0.4
.< nn rt"
~i~¸
Cloning partial XLH5 cDNA XLH5 e D N A containing codons 11-196 and 200 nt of 3' U T R was fused with a BamHI-Pt'uII linker, as illustrated in Fig. 1. This permitted excision of the XLH5 c D N A as a BamHI fragment from p9H5A-2 and ligation of one end to YEp51 cleaved with SalI and BamHI. The 3' recessed free ends of the two fragments were 'filled-in' and blunt end ligated. Liga-
ii!!i
nn
