In Vitro Cell.Dev.Biol.—Animal DOI 10.1007/s11626-014-9757-y

Expression of Transthyretin during bovine myogenic satellite cell differentiation Smritee Pokharel & Majid Rasool Kamli & Bilal Ahmad Mir & Adeel Malik & Eun Ju Lee & Inho Choi

Received: 14 January 2014 / Accepted: 7 April 2014 / Editor: T. Okamoto # The Society for In Vitro Biology 2014

Abstract Adult myogenesis responsible for the maintenance and repair of muscle tissue is mainly under the control of myogenic regulatory factors (MRFs) and a few other genes. Transthyretin gene (TTR), codes for a carrier protein for thyroxin (T4) and retinol binding protein bound with retinol in blood plasma, plays a critical role during the early stages of myogenesis. Herein, we investigated the relationship of TTR with other muscle-specific genes and report their expression in muscle satellite cells (MSCs), and increased messenger RNA (mRNA) and protein expression of TTR during MSCs differentiation. Silencing of TTR resulted in decreased myotube formation and decreased expression of myosin light chain (MYL2), myosin heavy chain 3 (MYH3), matrix gla protein (MGP), and voltage-dependent L type calcium channel (Cav1.1) genes. Increased mRNA expression observed in TTR and other myogenic genes with the addition of T4 decreased significantly following TTR knockdown, indicating the critical role of TTR in T4 transportation. Similarly, decreased expression of MGP and Cav1.1 following TTR knockdown signifies the dual role of TTR in controlling muscle myogenesis via regulation of T4 and calcium channel. Our computational and experimental evidences indicate that TTR has a relationship with MRFs and may act on calcium channel and related genes.

Smritee Pokharel and Majid Rasool Kamli contributed equally to this work Electronic supplementary material The online version of this article (doi:10.1007/s11626-014-9757-y) contains supplementary material, which is available to authorized users. S. Pokharel : M. R. Kamli : B. A. Mir : A. Malik : E. J. Lee (*) : I. Choi (*) School of Biotechnology, Yeungnam University, Gyeongsan 712-749, Republic of Korea e-mail: [email protected] e-mail: [email protected]

Keywords Muscle satellite cells . Transthyretin . Myogenesis

Introduction Skeletal muscle is a unique tissue of contractile property that consists of cylindrical multinucleated myofibers and resident stem cells, which are known as muscle satellite cells (MSCs) (Zammit 2008). Once formed, postnatal tissue growth and its maintenance following injuries (internal and external) and trauma (exercise induced) involve muscle regeneration from those muscle progenitor cells (Asakura 2003). MSCs are characterized by small mononuclear cells with increased nuclear to cytoplasmic ratio and reduced organelle contents, and are the major resident stem cells. The potential to activate, proliferate, and differentiate into multilineage cells in addition to muscle formation makes these MSCs a unique source of stem cells (Péault et al. 2007). Adult muscle cell myogenesis takes place in different consecutive steps, namely cell proliferation, contact inhibition, recognition and migration, multiple rounds of fusion, and finally maturation (Chargé and Rudnicki 2004). In addition, the prerequisites of MSC differentiation such as expression of myogenic regulatory factors (MRFs), growth factors, cytoskeletal proteins, and calcium availability (Florini et al. 1991; Przybylski et al. 1994; Sabourin and Rudnicki 2000; Guerin and Kramer 2009) play a critical role in the formation of mature myotubes. Calcium ions enter cells via storeoperated calcium entry (SOCE) and voltage-dependent calcium channels (VDCC), and are considered an important factor for contraction and differentiation of skeletal muscle (Lipscombe et al. 2004; Bidaud et al. 2006; Shin and Muallem 2008). Calcium influx through L-type VDCC promotes local depolarization of cell membranes to initiate the satellite cell activation cascade (Hara et al. 2012). Once activated, the satellite cells follow a cascade of events including

POKHAREL ET AL.

calcium-calmodulin complex formation, nitric oxide (NO) radical production, matrix metalloproteinase activation, release of hepatocyte growth factor (HGF), and coexpression of Pax7 and MYOD (Anderson 2000; Miller et al. 2000; Olguin et al. 2007; Hauser et al. 2008; Chen and Li 2009;). Eventually, heterodimer formation between the members of the MYOD family of basic helix-loop-helix (bHLH) transcription factors and Eprotein enables myogenesis (Heidt et al. 2007). Transthyretin (TTR) is a serum protein that is mainly synthesized in the liver, choroid plexus, retinal pigment epithelium, and pancreas (Herbert et al. 1986; Mizuno et al. 1992; Palha et al. 2000; Refai et al. 2005; Westermark and Westermark 2008). The tetrameric structure of TTR protein, its misfolding and aggregation have been extensively investigated in amyloidogenesis (Ruberg and Berk 2012; Myung et al. 2013). TTR secreted in plasma binds directly with thyroxin (T4) and indirectly with retinol via retinol-binding protein, thus transporting and maintaining their normal level in the cells (Episkopou et al. 1993; Monaco 2000). Thyroid hormone in skeletal muscle is not only involved in coordination of the expression of contractile proteins and metabolic enzymes, but also in direct regulation of satellite cell proliferation, myonuclei accumulation, and myofiber maturation during muscle development (Beermann et al. 1983; Merkulova et al. 2000). We previously identified TTR as one of the genes highly expressed during bovine myogenesis by DNA microarray (Lee et al. 2012a) and elucidated its functional role in myoblast cells via calcium channels (Lee et al. 2013a). In this study, we confirmed the expression of TTR in bovine MSCs and showed its transiently increased expression during myotube formation. Additionally, by using computational network analysis, we also tried to elucidate the relationship of TTR with other muscle (myogenin (MYOG), myosin light chain 2 (MYL2), and myosin heavy chain 3 (MYH3)) and calcium (matix gla protein (MGP) and Cav 1.1) related genes identified previously from our microarray analysis.

Materials and Methods Network construction. The GeneMANIA prediction server (http://www.genemania.org/) was used to identify the functional interactions between query genes and other genes involved in skeletal muscle development. The input to the GeneMANIA included eight query genes, TTR, MGP, CACNa1g Cav3.1, Cav1.1, MYL2, MYOG, MYOD, and MYH3. For this small network, “assigned based on query genes,” network weighting method was used. The method automatically selects the weights by using linear regression to ensure the query genes interact to a feasible extent with each other and as less as possible with genes not in the list. In the results generated by the GeneMANIA, 20 additional related genes were allowed using mouse as a source organism. Given

a list of genes, GeneMANIA extends the input list with genes that are functionally similar or have common properties with the input gene list and shows an interactive functional association network, illustrating the relationships among genes (Warde-Farley et al. 2010). The output of the GeneMANIA was analyzed in Cytoscape (Shannon et al. 2003). MSCs isolation and cell culture. Korean native cattle aged 22–24 m (n=3) with an average body weight of 550–600 kg was used for this experiment. MSCs were isolated and cultured in DMEM (Dulbecco's Modified Eagle's Medium, HyClone Laboratories, Logan, UT) media supplemented with 10% fetal bovine serum (FBS; HyClone Laboratories) and 1% penicillin/streptomycin until day 18 as described by Lee et al. (2012b). On day 10, T4 (5 ug/ml) was added to the MSCs along with growth media, after which the samples were cultured for another 6 d. All experimental protocols for the care and use of laboratory animals were approved by the Animal Care and Concern Committee of the National Institute of Animal Science, Korea. RNA isolation and RT-qPCR. Skeletal muscle tissues were collected from different muscle depots; namely, the beef shank (BS), longissimus dorsi (LD), deep pectoral (DP), and semitendinosus (SE) regions. Total RNA extraction and purification were conducted according to Lee et al. (2012a). Briefly, cells cultured from three different bovine individuals were harvested in Trizol (Invitrogen, California) at day 10 for MSCs and day 12, 14, 16, and 18 for myotube formed cells (MFCs). Complementary DNA (cDNA) was synthesized from 1 μg of total RNA using reverse transcriptase (Invitrogen, Carlsbad, CA), after which PCR was conducted using 2 μl of cDNA product, 10 pmol of each gene-specific primer, and Power SYBR® Green PCR Master Mix (Applied Biosystems, Warrington, UK) using a 7500 real-time PCR system (Applied Biosystems, Foster City, Caliornia). Genes were analyzed and fold difference was calculated using GAPDH as a reference gene. Detailed information on primer sequence is provided in Supplementary Table (1). TTR short hairpin (shRNA) construct and its knockdown. Bovine TTR short hairpin (shRNA) was designed using NCBI nucleotide information (NM_173967.3) and cloned with pRNAT-U6.2/Lenti vector (GeneScript, New Jersey). Constructed TTR shRNA (TTRkd) or nonspecific sequences (scrambled vector; TTR wd ) were transfected to make viral particles in 293 FT cells. After 2 d of transfection, viral particles in media were collected, transduced with lentiviral particles expressing shRNAs against bovine TTR or scrambled vector in MSCs (Day 8), and selected with 50 μg/ml of G418 (Calbiochem, California). The oligonucleotide insert used to generate TTR

EXPRESSION OF TRANSTHYRETIN DURING BOVINE MYOGENIC SATELLITE CELL

shRNA was 5′-GGATCCCGTGTCCTCTGATGGTCAAG TTCAAGAGACTTGACCATCAGAGGACACTTTT TTCCAACTCGAG-3′. Immunocytochemistry. Bovine primary MSCs were allowed to attach to a covered glass-bottom dish and were cultured for 10 d for MSCs and 16 d for MFCs in culture media for immunofluorescence staining. Briefly, cells were rinsed with PBS (phosphate buffer saline), fixed with 4% formaldehyde, and then permeabilized with 0.2% Triton X-100 (Sigma Aldrich). Cells were subsequently incubated with primary antibody rabbit polyclonal IgG TTR (1:50) (Santa Cruz Biotechnology, Santa Cruz, California) at 4°C in a humid environment overnight. Rinsed cells were then treated with secondary antibody (1:100; Alexa Fluor 488 goat anti-rabbit SFX kit; Invitrogen, Eugene, Oregon) for 1 h at room temperature followed by nuclei staining with 4’, 6-diamino-2-phenylindole (DAPI; Sigma-Aldrich). Pictures were taken using a fluorescent microscope equipped with a digital camera (Nikon, Tokyo, Japan). Western blot analysis. Cells harvested in ice-cold PBS were lysed with RIPA buffer containing protease inhibitor cocktail (Thermo Scientific, New Hampshire, USA). Total protein was determined by the Bradford method (Bradford 1976). A total of 40 μg protein was reduced by heating at 90°C for 3 min in the presence of ß-mercaptoethanol (Sigma-Aldrich), electrophoresed in 10% SDS-polyacrylamide gel, and then transferred to PVDF membrane (Millipore, Missouri). Next, the membranes were blocked in 5% BSA and incubated overnight at 4°C with either rabbit polyclonal TTR antibody (1:500) or mouse monoclonal ß-actin antibody (1:2000) (Santa Cruz Biotechnology). The membranes were then washed and incubated with horseradish peroxidase conjugated secondary antibody (goat anti rabbit or mouse IgG HRP, Santa Cruz Biotechnology) for 1 h at room temperature, after which they w e r e v i s u a l i z e d u s i n g S u p e r S i g n a l We s t P i c o Chemiluminescent Substrate (Thermo Scientific). Immunohistochemistry. Paraffin embedded blocks were made from different muscle depots of bovine for protein expression study as described by (Lee et al. 2013a). Briefly, 5-μm-thin paraffin-embedded tissue sections were deparaffinized, hydrated, and quenched for endogenous peroxidase activity in 3% H2O2 for 15 min. The sections were blocked with 1% goat serum and incubated with TTR antibody (2 μg/ml, Santa Cruz Biotechnology) overnight at 4°C. Sections washed in PBS were further incubated with goat anti-rabbit IgG HRP (Santa Cruz Biotechnology) for 1 h at RT, washed again, and positive signals were visualized by adding diaminobenzidine and hydrogen peroxide as substrates. Finally, the stained sections were counterstained with hematoxyline, washed in running tap water, dehydrated, mounted, and examined using a light microscope (Nikon).

Statistical analysis. The normalized expression mean was compared using Turkey’s Studentized Range (HSD) to identify significant differences in gene expression. A nominal p value of