bs_bs_banner
104
Congenital Anomalies 2014; 54, 104–109
doi:10.1111/cga.12042
ORIGINAL ARTICLE
Expression of transforming growth factor β and fibroblast growth factor 2 in the lens epithelium of Morioka cataract mice Tomohiro Kondo1, Naoko Ishiga-Hashimoto1, Hiroaki Nagai1, Ai Takeshita1, Masaki Mino1, Hiroshi Morioka1, Ken Takeshi Kusakabe2, and Toshiya Okada1 1 Department of Integrated Structural Biosciences, Division of Veterinary Science, Graduate School of Life and Environmental Sciences, Osaka Prefecture University, Izumi-Sano and 2Department of Veterinary Anatomy, Faculty of Common Veterinary Medicine, University of Yamaguchi, Yamaguchi, Japan
ABSTRACT
In the Morioka cataract (MCT) mice, lens opacity appears at 6 to 8 weeks of age, and swollen lens fiber is electron-microscopically observed at 3 weeks after birth. The present study was designed to characterize the expression of transforming growth factor β (TGFβ) and fibroblast growth factor 2 (FGF2) in the lens epithelium of the MCT mice. Immunohistochemical analysis showed that the expression of TGFβ in the lens epithelium of the MCT mice was stronger than that of the wild-type ddY mice at 2 and 4 weeks after birth. The expression of TGFβ receptors (TGFβRI and TGFβRII) and FGF2 in the lens epithelium of the MCT mice was stronger than that of the wild-type ddY mice at 4 weeks and weaker than that of the wild-type ddY mice at 15 weeks after birth. Using real time polymerase chain reaction (PCR), quantitative RT-PCR analysis showed that expression of TGFβ1 and TGFβ2 mRNA in the lens of 2-week-old MCT mice was significantly higher compared to age-matched wildtype ddY mice. These findings indicate that the lens epithelium of MCT mice has increased expression of TGFβ before cataract affection and that changes in the expression of FGF2 as well as TGFβ may contribute to the progression of the cataract in the mice. Key Words: fibroblast growth factor, hereditary cataract mouse model, lens epithelium, Morioka cataract mouse, transforming growth factor β
INTRODUCTION Cataracts are the most common cause of blindness in the world (O’Conner and McAvoy 2007), and approximately one-quarter to one-third of congenital cataract cases are hereditary (Bermejo and Martínez-Frías 1998). Mutations affecting the lens in mice can be identified easily by visual inspection, and a remarkable number of mutant lines have been characterized (Graw 2009). Thus, the establishment of an animal model of cataracts will help elucidate the pathology underlying human cataractogenesis (Graw 2004). In the Morioka cataract (MCT) mice the cataract is inherited by an autosomal recessive manner (Kondo et al. 2010) and swollen lens fiber is electron microscopically observed at 3 weeks after birth Correspondence: Toshiya Okada, DVM, PhD, Department of Integrated Structural Biosciences, Division of Veterinary Science, Graduate School of Life and Environmental Sciences, Osaka Prefecture University, 1-58 Rinku Ourai Kita, Izumi-Sano, Osaka 598-8531, Japan. Email: okada@ vet.osakafu-u.ac.jp Received July 25, 2013; revised and accepted November 11, 2013.
© 2013 Japanese Teratology Society
(Kondo et al. 2011), and lens opacity appears at 6 to 8 weeks of age (Kondo et al. 2010). In the latter part of the 20th century, concomitant with the growth of knowledge of growth factors in general, progress was made in identifying some of the key players in lens morphogenesis and differentiation, such as the fibroblast growth factor (FGF), Bmps, and transforming growth factor β (TGFβ) (Lovicu and McAvoy 2005). It has been reported that FGF1 and FGF2 play an important role in the development of the lens (Lovicu and McAvoy 2005) and in lens cell survival (Robinson 2006). TGFβ is also required for lens fiber maturation and/or survival (McAvoy et al. 2000) and TGFβ superfamily signaling controls various cellular processes including cell proliferation, differentiation, apoptosis, and specification of developmental fate during embryogenesis as well as in adult tissues (Omori et al. 2011). TGFβ1 has been involved in the pathogenesis of diabetes mellitus, artherosclerosis, metabolic syndrome and cardiovascular disease (Taki et al. 2012). TGFβ is a key regulator of many processes in both normal and pathological development (Nawshad et al. 2005) and TGFβ, like FGF, can also change the fate of lens epithelial cells (de Iongh et al. 2005). In contrast to its normal role in fiber differentiation, elevated levels of TGFβ are associated with lens dysfunction (McAvoy et al. 2000; Boswell et al. 2010) and TGFβ is involved in the origin of certain forms of cataract (Ueda et al. 2000). The introduction of active TGFβ into the vitreous has induced lenses to undergo cataractous changes (Hales et al. 1999). de Iongh et al. (2001) have observed that the exposure of developmental lens explants to FGF2 results in a marked increase in TGFβ receptors and suggests the importance of considering FGF and possibly other growth factors that may also be present in the ocular milieu. Zhang et al. (2012) have observed the elevated expression of TGFβ and FGF2 in the lens of experimentally-induced diabetic cataract rats. Thus, the growth factors of TGFβ and FGF2 are thought to be involved in the affection of cataract. Little information, however, is available in on intrinsic TGFβ and FGF2 in cataract animal models. Therefore, the present study was designed to clarify the immunolocalization of TGFβ, FGF2, and TGFβ receptors (TGFβRI and TGFβRII) in the lens epithelium of the MCT mice.
MATERIALS AND METHODS Animals and husbandry Morioka cataract (MCT) mice, a novel cataract strain derived from mice of the ddY strain (outbred colony), were used. Normal (wildtype) ddY mice were purchased from Japan SLC (Hamamatsu, Japan) and were used as controls. The animals were maintained under regulated room temperature (24 ± 1°C), humidity (55 ± 5%)
TGFβ and FGF in the lens of MCT mice and lighting (from 06.00 to 20.00 hours). Animals were given a commercial diet (CE-2; Clea, Osaka, Japan) and water ad libitum. All experiments in the present study were performed in accordance with the Guidelines for Animal Experimentation of Osaka Prefecture University, Japan and approved by the Animal Experiment Committee of Osaka Prefecture University.
b
a
LE LC
L R
C 500 µm
V
50 µm
Fig. 1 (a) Eye of 6-week old Morioka cataract (MCT) mice. H-E stain. C, cornea; R, retina: V, vitreous body: L, lens. (b) Enlarged image of boxed area (anterior region of the lens) of Figure 1a. LC, lens cortex; LE, lens epithelium.
a
c
500 µm
50 µm
b
d
e
f
105
Tissue processing and immunohistochemical procedures 2-, 4- and 15-week-old MCT and wild-type ddY mice were used for the examination of the immunolocalization of TGFβ, FGF2, and TGFβ receptors (TGFβRI and TGFβRII). Under isoflurane anesthesia, the mice were infused with heparin-saline, followed by 10% neutral buffered formalin. Eyes were then removed and immersed in the same fixative for 2 days. The eyes were dehydrated through a graded series of ethanol, soaked in butyl alcohol and embedded in paraffin (Tissue Prep, Fisher Scientific, NJ, USA). Sections (4 μm) were cut in a plane perpendicular to the anteriorposterior axis of the eye. After deparaffinization with xylene, the sections were transferred to distilled water through a series of degraded ethanol and rinsed in phosphate buffered saline. Immunostaining for TGFβ was performed as follows: the sections were incubated with rabbit anti-porcine TGFβ antibody (R & D Systems, MN, USA, 1:100) at 4°C, 72 h. Then, the sections were incubated with biotinylated goat anti-rabbit IgG antibody (1:200) and an avidin-biotin-peroxidase (ABC) complex (1:200) for 30 min each. Immunostaining for FGF2 was performed as follows: the sections were incubated with rabbit anti-human FGF2 antibody (Santa Cruz Biotechnology, CA, USA, 1:300) at 4°C, overnight. Then, the sections were incubated with biotinylated goat anti-rabbit IgG antibody (1:200) and an ABC complex (1:200) for 30 min each. Finally, the sections were incubated with diaminobenzidine for 5 min. Immunostainings for TGFβRI and TGFβRII were performed similarly to FGF2, except for the primary antibodies (TGFβRI, rabbit anti-human TGFβRI antibody, Santa Cruz Biotechnology, 1:300; TGFβRII, rabbit anti-human TGFβRII antibody, Santa
g
h
Fig. 2 Anterior region of the lenses of wild-type ddY (a, c; 2 week, e; 4 week, g; 15 week) and Morioka cataract (MCT) (b, d; 2 week, f; 4 week, h; 15 week) mice stained with anti-transforming growth factor β (TGFβ) antibody. At 2 weeks after birth, the positive reaction to anti-TGFβ antibody are observed in cornea, ciliary body, lens, and retina in both wild-type ddY and MCT mice. A moderately stronger reaction of lens epithelial cells to anti-TGFβ antibody is seen in the MCT mice compared to wild-type ddY mice at 2 weeks after birth. A stronger reaction of lens epithelial cells to anti-TGFβ antibody is seen in the MCT mice compared to wildtype ddY mice at 4 weeks after birth. A weaker reaction of lens epithelial cells to anti-TGFβ antibody is seen in the MCT mice compared to wild-type ddY mice at 15 weeks after birth.
© 2013 Japanese Teratology Society
106
T. Kondo et al.
Cruz Biotechnology, 1:100). Negative controls were produced by omitting the primary antibody during the immunohistochemical procedure.
a
Real-time RT-PCR of TGFβ1, TGFβ2, and FGF2 mRNA in the lens of the mice at 2 weeks after birth Total RNA was extracted from the lens of MCT and wild-type ddY mice using ISOGEN RNA isolation protocol (NIPPON GENE, Toyama, Japan). The RNA was resuspended in 50 μL diethylpyrocarbonate-treated water. Single-stranded cDNA was synthesized using a PrimeScript 1st strand cDNA Synthesis Kit (Takara Bio, Otsu, Japan). Real-time polymerase chain reaction (PCR) was performed using a SYBR Premix Ex TaqII (Takara Bio, Otsu, Japan) with a StepOnePlus Real-Time PCR System (Applied Biosystems, CA, USA). The following primers were designed using the Primer Express Version 3.0 software (Applied Biosystems, CA, USA): TGFβ1 (forward: GCCTGAGTGGCTGTCTTTTGA, reverse: CTGTATTCCGTCTCCTTGGTTCA); TGFβ2 (forward: GCCCCTGCTGTACCTTCGT, reverse: TGCCATCAATACCTG CAAATCTC); FGF2 (forward: GCTGCTGGCTTCTAAGT GTGTTAC, reverse: ATCCGAGTTTATACTGCCCAGTTC and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (forward: TGTGTCCGTCGTGGATCTGA, reverse: TTGCTGTTGAAGTC GCAGGAG). All experiments were conducted in duplicates, and the expression levels for the target genes were calculated using the Δ-Δ-Ct method and normalized to the relative quantity of GAPDH expression in each sample.
50 µm
b
c
e
d
f
Statistics The data are expressed as the means ± standard error of the mean (SEM). The differences between the MCT and wild-type ddY mice were analyzed with the Student’s t test. A P-value less than 0.05 was identified as statistically significant.
RESULTS Immunohistochemical localization of TGFβ, FGF2, TGFβRI, and TGFβRII in the lens epithelium The eye is composed of several components (cornea, lens, retina etc.) (Fig. 1a). The present observation focused on the lens epithelium (Fig. 1b). The positive reaction to anti-TGFβ antibody was observed in cornea, ciliary body, lens, and retina in both wild-type ddY and MCT mice (Fig. 2a,b). The positive reaction of lens epithelial cells to anti-TGFβ antibody was slightly stronger in MCT mice than in age-matched wild-type ddY mice at 2 weeks after birth (Fig. 2c,d). The positive reaction of lens epithelial cells to antiTGFβ antibody in MCT mice at 4 weeks after birth (Fig. 2e,f) was stronger than in age-matched wild-type ddY mice and weaker than that in the wild-type ddY mice at 15 weeks after birth (Fig. 2g,h). No difference in the degree of the positive reaction of lens epithelial cells to anti-FGF2 antibody was observed in both wild-type ddY and MCT mice at 2weeks after birth (Fig. 3a,b). The reactions of lens epithelial cells to anti-FGF2 antibody were stronger at 4 weeks (Fig. 3c,d) and weaker at 15 weeks (Fig. 3e,f) after birth in MCT mice compared to the wild-type ddY mice. The reactions of TGFβRI were stronger at 4 weeks (Fig. 4c,d) and weaker at 15 weeks (Fig. 4e,f) after birth in MCT mice compared to the wildtype ddY mice. The reaction patterns of TGFβRII were similar to that of TGFβRI (Fig. 5). Real-time RT-PCR of TGFβ1, TGFβ2, and FGF2 mRNA in the lens 2 weeks after birth The level of expression for TGFβ1 and TGFβ2 mRNA was significantly higher in MCT than in wild-type ddY mice (Fig. 6a,b). There © 2013 Japanese Teratology Society
Fig. 3 Anterior region of the lenses of wild-type ddY (a; 2 week, c; 4 week, e; 15 week) and MCT (b; 2 week, d; 4 week, f; 15 week) mice stained with anti-FGF2 antibody. A stronger reaction of lens epithelial cells to anti-FGF2 antibody is seen in the Morioka cataract (MCT) mice compared to wild-type ddY mice at 4 weeks after birth. A weaker reaction of lens epithelial cells to anti-FGF2 antibody is seen in the MCT mice compared to wild-type ddY mice at 15 weeks after birth.
was no significant difference in the expression level of FGF2 between MCT and wild-type ddY mice (Fig. 6c).
DISCUSSION Through utilizing the MCT mice, the present study reveals that the expression of TGFβ is increased in lens epithelial cells prior to cataract affection and those of FGF2, TGFβRI, and TGFβRII are increased immediately after the affection. McAvoy et al. (1991; 1999) suggested that FGF molecules play a key role in determining lens polarity and growth patterns. Furthermore, acidic (FGF1) and basic FGF (FGF2) have each been shown to induce proliferation and differentiation of rat lens epithelial cells in culture at physiological concentrations (McAvoy and Chamberlain 1989), and Stolen et al. (1997) indicate that FGF2 can act as a modulator of later stages of differentiation including fiber cell survival. Over 20 years of accumulated
TGFβ and FGF in the lens of MCT mice
a
c
e
c
e
d
f
50 µm
50 µm
b
a
107
d
f
b
Fig. 4 Anterior region of the lenses of wild-type ddY (a; 2 week, c; 4 week, e; 15 week) and Morioka cataract (MCT) (b; 2 week, d; 4 week, f; 15 week) mice stained with anti-transforming growth factor β (TGFβ) RI antibody. Stronger reaction of lens epithelial cells to anti-TGFβRI antibody is seen in the MCT mice compared to wild-type ddY mice at 4 weeks after birth. Weaker reaction of lens epithelial cells to anti-TGFβRI antibody is seen in the MCT mice compared to wild-type ddY mice at 15 weeks after birth.
Fig. 5 Anterior region of the lenses of wild-type ddY (a; 2 week, c; 4 week, e; 15 week) and Morioka cataract (MCT) (b; 2 week, d; 4 week, f; 15 week) mice stained with anti-transforming growth factor β (TGFβ) RII antibody. Stronger reaction of lens epithelial cells to anti-TGFβRII antibody is seen in the MCT mice compared to wild-type ddY mice at 4 weeks after birth. Weaker reaction of lens epithelial cells to anti-TGFβRII antibody is seen in the MCT mice compared to wild-type ddY mice at 15 weeks after birth.
evidence using several different vertebrates species has suggested that FGFs and/or FGF receptors play a key role in lens development (Robinson 2006). TGFβ, like FGF, can also change the fate of lens epithelial cells (de Iongh et al. 2005) and the elevated levels of TGFβ are associated with lens dysfunction (McAvoy et al. 2000; Boswell et al. 2010). In the present study, at 2 weeks after birth, the positive reaction of lens epithelial cells to antiTGFβ in MCT mice was slightly stronger and the expression of TGFβ1 and TGFβ2 mRNA significantly higher than in agematched wild-type ddY mice. These results suggest that the elevated expression of TGFβ is involved in onset of cataractous histological changes since lens opacity appears at 6 to 8 weeks of age (Kondo et al. 2010) and the swollen lens fiber is electron microscopically observed at 3 weeks after birth in the MCT mice (Kondo et al. 2011). This notion is supported by the following reports: rats that receive a single intravitreal injection of TGFβ subsequently develop cataracts (Hales et al. 1999); TGFβ stimula-
tion induces lens epithelial cells to undergo aberrant growth and differentiation (Lovicu et al. 2002). The positive reaction of lens epithelial cells to FGF2 in 2-week-old MCT mice was similar to that in age-matched wild-type ddY mice and the expression level of FGF2 on the lens of 2-week-old MCT mice was not elevated but tended to be lowered (not significant). These results suggest that cataract affection of MCT mice is thought to start with the elevated expression of TGFβ without that of FGF2. This notion is supported by the report that TGFβ disturbs FGF-induced lens developmental processes and induces pathologic changes in the lens (Ueda et al. 2000). Despite the strong differentiating activity of FGF2 on rat lens epithelial explants, transgenic mice overexpressing FGF2 in the lens exhibit an inhibition of fiber cell differentiation (Robinson 2006). Further, Zhang et al. (2012) have observed elevated expression in FGF2 and TGFβ in the lens of experimentally-induced diabetic cataract rats. In the present study, the positive reaction of © 2013 Japanese Teratology Society
108
T. Kondo et al.
a
c
b 9
6
*
5
1.4
*
8
1.2
7 1
Fig. 6 Real-time reverse transcriptionpolymerase chain reaction (RT-PCR) analysis of the expression of transforming growth factor β1 (TGFβ1) (a), TGFβ2 (b), and FGF2 (c) mRNA in the lens at 2 weeks after birth. The expression levels for TGFβ1, TGFβ2, and FGF2 were calculated using the Δ-Δ-Ct method and normalized to the relative quantity of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) expression in each sample. Data are expressed as the means ± standard error of the mean (SEM) of three individual experiments. *Significantly different from wild-type ddY mice (P < 0.05).
6
4
2
0.8
4
0.6
3 0.4 2
1
0.2
1 0
ddY
Mct
lens epithelium to FGF2 antibody was stronger in MCT mice than in wild-type ddY mice in addition to the changes in TGFβ at 4 weeks after birth. These results suggest that abnormal expression of FGF2, as well as that of TGFβ, induce the morphological changes in the lens of MCT mice. This notion is supported by several lines of evidence as follows: cross-talk between FGF- and TGF-β-signaling pathways could contribute to cataractogenesis (Boswell et al. 2010); FGF is identified as a factor capable of exacerbating the cataractogenic effects of TGF-β (Cerra et al. 2003); the morphological changes that resemble human posterior cataract opacification, extensive multilayering, swollen cells and extensive globule formation are observed in lens explant cultured with TGF-β and FGF (Symonds et al. 2006). Further, the positive reactions of the lens epithelium in MCT mice to anti-TGFβRI and anti-TGFβRII antibodies were stronger immediately after the affection and weaker at 15 weeks after birth compared to the wild-type ddY mice. These findings suggest that the activity of TGF-β is stimulated by abnormal expression of FGF2 in the MCT mice because the changes in the immunolocalization of TGFβRI and TGFβRII in the MCT mice paralleled that of the changes in FGF2. This notion is supported by the report that addition of FGF2 to lens epithelial explants of 9-day old rats induced increased TGFβ receptors immunoreactivity and enhanced the competency of lens epithelial cells to TGFβ (de Iongh et al. 2001). The major intracellular signaling system identified for TGFβ is through translocation of Smad proteins and the Smad2 and Smad3 are commonly associated with mediating TGFβ signals (Eldred et al. 2011). TGFβ transduces its signal by binding to TGFβ Type I and II serine/threonine kinase receptors leading to phosphorylation of Smad proteins (Bot et al. 2009). Therefore, the further investigation that examines pSmad 2/3 expressions is thought to be necessary for elucidation of the signal transduction in the cataract affection of MCT mice. Consequently, the present study indicates that the lens epithelium of MCT mice has increased expressions of TGFβ before cataract affection and that changes in the expression of FGF2 as well as TGFβ may contribute to progression of the cataract in the mice. © 2013 Japanese Teratology Society
5 3
0
ddY
Mct
0
ddY
Mct
ACKNOWLEDGMENTS This work was supported in part by a Grant-in Aid (No. 16580253) from the Ministry of Education, Science and Culture of Japan.
REFERENCES Bermejo E, Martínez-Frías ML. 1998. Congenital eye malformations: clinical-epidemiological analysis of 1,124,654 consecutive births in Spain. Am J Med Genet 75:497–504. Boswell BA, VanSlyke JK, Musil LS. 2010. Regulation of lens gap junctions by transforming growth factor beta. Mol Biol Cell 21:1686–1697. Bot PTG, Hoefer IE, Sluijter JPG et al. 2009. Increased expression of the Transforming Growth Factor-β signaling pathway, endoglin, and Early Growth Response-1 in stable plaques. Stroke 40:439–447. Cerra A, Mansfield KJ, Chamberlain CG. 2003. Exacerbation of TGF-βinduced cataract by FGF-2 in cultured rat lenses. Mol Vis 9:689–700. de Iongh RU, Gordon-Thomson C, Chamberain CG, Hales AM, McAvoy JW. 2001. TGFβ receptor expression in lens: implication for differentiation and cataractgenesis. Exp Eye Res 72:649–659. de Iongh RU, Wederell E, Lovicu FJ, McAvoy JW. 2005. Transforming growth factor-β-induced epithelial-mesenchymal transition in the lens: a model for cataract formation. Cells Tissues Organs 179:43–55. Eldred JA, Dawes LJ, Wormstone IM. 2011. The lens as a model for fibrotic disease. Phil Trans R Soc B 366:1301–1319. Graw J. 2004. Congenital hereditary cataracts. Int J Dev Biol 48:1031–1044. Graw J. 2009. Mouse models of cataract. J Genet 88:469–486. Hales AM, Chamberlain CG, Dreher B, McAvoy JW. 1999. Intravitreal injection of TGFβ induces cataract in rats. Invest Ophthalmol Vis Sci 40:3231–3236. Kondo T, Ishiga-Hashimoto N, Nagai H et al. 2011. An increase in apoptosis and reduction in αB-crystallin expression levels in the lens underlie the cataractogenesis of Morioka cataract (MCT) mice. Med Mol Morphol 44:221–227. Kondo T, Nagai H, Morioka H, Kusakabe KT, Okada T. 2010. Novel cataract mouse model using ddY strain: hereditary and histological characteristics. J Vet Med Sci 72:203–209. Lovicu FJ, McAvoy JW. 2005. Growth factor regulation of lens development. Dev Biol 280:1–14. Lovicu FJ, Schulz MW, Hales AM et al. 2002. TGFβ induces morphological and molecular changes similar to human anterior subcapsular cataract. Br J Ophthalomol 86:220–226.
TGFβ and FGF in the lens of MCT mice McAvoy JW, Chamberlain CG. 1989. Fibroblast growth factor (FGF) induces different responses in lens epithelial cells depending on its concentration. Development 107:221–228. McAvoy JW, Chamberlain CG, de Iongh RU, Hales AM, Lovicu FJ. 1999. Lens development. Eye 13:425–437. McAvoy JW, Chamberlain CG, de Iongh RU, Richardson NA, Lovicu FJ. 1991. The role of fibroblast growth factor in eye lens development. Ann NY Acad Sci 638:256–274. McAvoy JW, Chamberlain CG, de Iongh RU, Hales AM, Lovicu FJ. 2000. Peter bishop lecture: growth factors in lens development and cataract: key roles for fibroblast growth factor and TGF-β. Clin Exp Ophthalmol 28:133–139. Nawshad A, Lagamba D, Polad A, Hay ED. 2005. Transforming growth factor-beta signaling during epithelial-mesenchymal transformation: implications for embryogenesis and tumor metastasis. Cells Tissues Organs 179:11–23. O’Conner MD, McAvoy JW. 2007. In vitro generation of functional lenslike structures with relevance to age-related nuclear cataract. Invest Ophthalmol Vis Sci 48:1245–1252. Omori A, Harada M, Ohta S et al. 2011. Epithelial Bmp (Bone morphogenetic protein) signaling for bulbourethral gland development: a mouse model for congenital cystic dilation. Congenit Anom 51:102–109.
109
Robinson ML. 2006. An essential role for FGF receptor signaling in lens development. Semin Cell Dev Bol 17:726–740. Stolen CM, Jackson MW, Griep AE. 1997. Overexpression of FGF-2 modulates fiber cell differentiation and survival in the mouse lens. Development 124:4009–4017. Symonds JG, Lovicu FJ, Chamberlain CG. 2006. Posterior capsule opacification-like changes in rat lens explants cultured with TGF-β and FGF: effects of cell coverage and regional differences. Exp Eye Res 82:693–699. Taki A, Abe M, Komaki M et al. 2012. Expression of angiogenesis-related factors and inflammatory cytokines in placenta and umbilical vessels in pregnancies with preeclampsia and chorioamnionitis/funisitis. Congenit Anom 52:97–103. Ueda Y, Chamberlain CG, Satoh K, McAvoy JW. 2000. Inhibition of FGF-induced αA-crystallin promoter activity in lens epithelial explants by TGFβ. Invest Ophthalmol Vis Sci 41:1833–1839. Zhang P, Xing K, Randazzo J, Blessing K, Lou MF, Kador PF. 2012. Osmic stress, not aldose reductase activity, directly induces growth factors and MAPK signaling changes during sugar cataract formation. Exp Eye Res 101:36–43.
© 2013 Japanese Teratology Society
104
Congenital Anomalies 2014; 54, 104–109
doi:10.1111/cga.12042
ORIGINAL ARTICLE
Expression of transforming growth factor β and fibroblast growth factor 2 in the lens epithelium of Morioka cataract mice Tomohiro Kondo1, Naoko Ishiga-Hashimoto1, Hiroaki Nagai1, Ai Takeshita1, Masaki Mino1, Hiroshi Morioka1, Ken Takeshi Kusakabe2, and Toshiya Okada1 1 Department of Integrated Structural Biosciences, Division of Veterinary Science, Graduate School of Life and Environmental Sciences, Osaka Prefecture University, Izumi-Sano and 2Department of Veterinary Anatomy, Faculty of Common Veterinary Medicine, University of Yamaguchi, Yamaguchi, Japan
ABSTRACT
In the Morioka cataract (MCT) mice, lens opacity appears at 6 to 8 weeks of age, and swollen lens fiber is electron-microscopically observed at 3 weeks after birth. The present study was designed to characterize the expression of transforming growth factor β (TGFβ) and fibroblast growth factor 2 (FGF2) in the lens epithelium of the MCT mice. Immunohistochemical analysis showed that the expression of TGFβ in the lens epithelium of the MCT mice was stronger than that of the wild-type ddY mice at 2 and 4 weeks after birth. The expression of TGFβ receptors (TGFβRI and TGFβRII) and FGF2 in the lens epithelium of the MCT mice was stronger than that of the wild-type ddY mice at 4 weeks and weaker than that of the wild-type ddY mice at 15 weeks after birth. Using real time polymerase chain reaction (PCR), quantitative RT-PCR analysis showed that expression of TGFβ1 and TGFβ2 mRNA in the lens of 2-week-old MCT mice was significantly higher compared to age-matched wildtype ddY mice. These findings indicate that the lens epithelium of MCT mice has increased expression of TGFβ before cataract affection and that changes in the expression of FGF2 as well as TGFβ may contribute to the progression of the cataract in the mice. Key Words: fibroblast growth factor, hereditary cataract mouse model, lens epithelium, Morioka cataract mouse, transforming growth factor β
INTRODUCTION Cataracts are the most common cause of blindness in the world (O’Conner and McAvoy 2007), and approximately one-quarter to one-third of congenital cataract cases are hereditary (Bermejo and Martínez-Frías 1998). Mutations affecting the lens in mice can be identified easily by visual inspection, and a remarkable number of mutant lines have been characterized (Graw 2009). Thus, the establishment of an animal model of cataracts will help elucidate the pathology underlying human cataractogenesis (Graw 2004). In the Morioka cataract (MCT) mice the cataract is inherited by an autosomal recessive manner (Kondo et al. 2010) and swollen lens fiber is electron microscopically observed at 3 weeks after birth Correspondence: Toshiya Okada, DVM, PhD, Department of Integrated Structural Biosciences, Division of Veterinary Science, Graduate School of Life and Environmental Sciences, Osaka Prefecture University, 1-58 Rinku Ourai Kita, Izumi-Sano, Osaka 598-8531, Japan. Email: okada@ vet.osakafu-u.ac.jp Received July 25, 2013; revised and accepted November 11, 2013.
© 2013 Japanese Teratology Society
(Kondo et al. 2011), and lens opacity appears at 6 to 8 weeks of age (Kondo et al. 2010). In the latter part of the 20th century, concomitant with the growth of knowledge of growth factors in general, progress was made in identifying some of the key players in lens morphogenesis and differentiation, such as the fibroblast growth factor (FGF), Bmps, and transforming growth factor β (TGFβ) (Lovicu and McAvoy 2005). It has been reported that FGF1 and FGF2 play an important role in the development of the lens (Lovicu and McAvoy 2005) and in lens cell survival (Robinson 2006). TGFβ is also required for lens fiber maturation and/or survival (McAvoy et al. 2000) and TGFβ superfamily signaling controls various cellular processes including cell proliferation, differentiation, apoptosis, and specification of developmental fate during embryogenesis as well as in adult tissues (Omori et al. 2011). TGFβ1 has been involved in the pathogenesis of diabetes mellitus, artherosclerosis, metabolic syndrome and cardiovascular disease (Taki et al. 2012). TGFβ is a key regulator of many processes in both normal and pathological development (Nawshad et al. 2005) and TGFβ, like FGF, can also change the fate of lens epithelial cells (de Iongh et al. 2005). In contrast to its normal role in fiber differentiation, elevated levels of TGFβ are associated with lens dysfunction (McAvoy et al. 2000; Boswell et al. 2010) and TGFβ is involved in the origin of certain forms of cataract (Ueda et al. 2000). The introduction of active TGFβ into the vitreous has induced lenses to undergo cataractous changes (Hales et al. 1999). de Iongh et al. (2001) have observed that the exposure of developmental lens explants to FGF2 results in a marked increase in TGFβ receptors and suggests the importance of considering FGF and possibly other growth factors that may also be present in the ocular milieu. Zhang et al. (2012) have observed the elevated expression of TGFβ and FGF2 in the lens of experimentally-induced diabetic cataract rats. Thus, the growth factors of TGFβ and FGF2 are thought to be involved in the affection of cataract. Little information, however, is available in on intrinsic TGFβ and FGF2 in cataract animal models. Therefore, the present study was designed to clarify the immunolocalization of TGFβ, FGF2, and TGFβ receptors (TGFβRI and TGFβRII) in the lens epithelium of the MCT mice.
MATERIALS AND METHODS Animals and husbandry Morioka cataract (MCT) mice, a novel cataract strain derived from mice of the ddY strain (outbred colony), were used. Normal (wildtype) ddY mice were purchased from Japan SLC (Hamamatsu, Japan) and were used as controls. The animals were maintained under regulated room temperature (24 ± 1°C), humidity (55 ± 5%)
TGFβ and FGF in the lens of MCT mice and lighting (from 06.00 to 20.00 hours). Animals were given a commercial diet (CE-2; Clea, Osaka, Japan) and water ad libitum. All experiments in the present study were performed in accordance with the Guidelines for Animal Experimentation of Osaka Prefecture University, Japan and approved by the Animal Experiment Committee of Osaka Prefecture University.
b
a
LE LC
L R
C 500 µm
V
50 µm
Fig. 1 (a) Eye of 6-week old Morioka cataract (MCT) mice. H-E stain. C, cornea; R, retina: V, vitreous body: L, lens. (b) Enlarged image of boxed area (anterior region of the lens) of Figure 1a. LC, lens cortex; LE, lens epithelium.
a
c
500 µm
50 µm
b
d
e
f
105
Tissue processing and immunohistochemical procedures 2-, 4- and 15-week-old MCT and wild-type ddY mice were used for the examination of the immunolocalization of TGFβ, FGF2, and TGFβ receptors (TGFβRI and TGFβRII). Under isoflurane anesthesia, the mice were infused with heparin-saline, followed by 10% neutral buffered formalin. Eyes were then removed and immersed in the same fixative for 2 days. The eyes were dehydrated through a graded series of ethanol, soaked in butyl alcohol and embedded in paraffin (Tissue Prep, Fisher Scientific, NJ, USA). Sections (4 μm) were cut in a plane perpendicular to the anteriorposterior axis of the eye. After deparaffinization with xylene, the sections were transferred to distilled water through a series of degraded ethanol and rinsed in phosphate buffered saline. Immunostaining for TGFβ was performed as follows: the sections were incubated with rabbit anti-porcine TGFβ antibody (R & D Systems, MN, USA, 1:100) at 4°C, 72 h. Then, the sections were incubated with biotinylated goat anti-rabbit IgG antibody (1:200) and an avidin-biotin-peroxidase (ABC) complex (1:200) for 30 min each. Immunostaining for FGF2 was performed as follows: the sections were incubated with rabbit anti-human FGF2 antibody (Santa Cruz Biotechnology, CA, USA, 1:300) at 4°C, overnight. Then, the sections were incubated with biotinylated goat anti-rabbit IgG antibody (1:200) and an ABC complex (1:200) for 30 min each. Finally, the sections were incubated with diaminobenzidine for 5 min. Immunostainings for TGFβRI and TGFβRII were performed similarly to FGF2, except for the primary antibodies (TGFβRI, rabbit anti-human TGFβRI antibody, Santa Cruz Biotechnology, 1:300; TGFβRII, rabbit anti-human TGFβRII antibody, Santa
g
h
Fig. 2 Anterior region of the lenses of wild-type ddY (a, c; 2 week, e; 4 week, g; 15 week) and Morioka cataract (MCT) (b, d; 2 week, f; 4 week, h; 15 week) mice stained with anti-transforming growth factor β (TGFβ) antibody. At 2 weeks after birth, the positive reaction to anti-TGFβ antibody are observed in cornea, ciliary body, lens, and retina in both wild-type ddY and MCT mice. A moderately stronger reaction of lens epithelial cells to anti-TGFβ antibody is seen in the MCT mice compared to wild-type ddY mice at 2 weeks after birth. A stronger reaction of lens epithelial cells to anti-TGFβ antibody is seen in the MCT mice compared to wildtype ddY mice at 4 weeks after birth. A weaker reaction of lens epithelial cells to anti-TGFβ antibody is seen in the MCT mice compared to wild-type ddY mice at 15 weeks after birth.
© 2013 Japanese Teratology Society
106
T. Kondo et al.
Cruz Biotechnology, 1:100). Negative controls were produced by omitting the primary antibody during the immunohistochemical procedure.
a
Real-time RT-PCR of TGFβ1, TGFβ2, and FGF2 mRNA in the lens of the mice at 2 weeks after birth Total RNA was extracted from the lens of MCT and wild-type ddY mice using ISOGEN RNA isolation protocol (NIPPON GENE, Toyama, Japan). The RNA was resuspended in 50 μL diethylpyrocarbonate-treated water. Single-stranded cDNA was synthesized using a PrimeScript 1st strand cDNA Synthesis Kit (Takara Bio, Otsu, Japan). Real-time polymerase chain reaction (PCR) was performed using a SYBR Premix Ex TaqII (Takara Bio, Otsu, Japan) with a StepOnePlus Real-Time PCR System (Applied Biosystems, CA, USA). The following primers were designed using the Primer Express Version 3.0 software (Applied Biosystems, CA, USA): TGFβ1 (forward: GCCTGAGTGGCTGTCTTTTGA, reverse: CTGTATTCCGTCTCCTTGGTTCA); TGFβ2 (forward: GCCCCTGCTGTACCTTCGT, reverse: TGCCATCAATACCTG CAAATCTC); FGF2 (forward: GCTGCTGGCTTCTAAGT GTGTTAC, reverse: ATCCGAGTTTATACTGCCCAGTTC and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (forward: TGTGTCCGTCGTGGATCTGA, reverse: TTGCTGTTGAAGTC GCAGGAG). All experiments were conducted in duplicates, and the expression levels for the target genes were calculated using the Δ-Δ-Ct method and normalized to the relative quantity of GAPDH expression in each sample.
50 µm
b
c
e
d
f
Statistics The data are expressed as the means ± standard error of the mean (SEM). The differences between the MCT and wild-type ddY mice were analyzed with the Student’s t test. A P-value less than 0.05 was identified as statistically significant.
RESULTS Immunohistochemical localization of TGFβ, FGF2, TGFβRI, and TGFβRII in the lens epithelium The eye is composed of several components (cornea, lens, retina etc.) (Fig. 1a). The present observation focused on the lens epithelium (Fig. 1b). The positive reaction to anti-TGFβ antibody was observed in cornea, ciliary body, lens, and retina in both wild-type ddY and MCT mice (Fig. 2a,b). The positive reaction of lens epithelial cells to anti-TGFβ antibody was slightly stronger in MCT mice than in age-matched wild-type ddY mice at 2 weeks after birth (Fig. 2c,d). The positive reaction of lens epithelial cells to antiTGFβ antibody in MCT mice at 4 weeks after birth (Fig. 2e,f) was stronger than in age-matched wild-type ddY mice and weaker than that in the wild-type ddY mice at 15 weeks after birth (Fig. 2g,h). No difference in the degree of the positive reaction of lens epithelial cells to anti-FGF2 antibody was observed in both wild-type ddY and MCT mice at 2weeks after birth (Fig. 3a,b). The reactions of lens epithelial cells to anti-FGF2 antibody were stronger at 4 weeks (Fig. 3c,d) and weaker at 15 weeks (Fig. 3e,f) after birth in MCT mice compared to the wild-type ddY mice. The reactions of TGFβRI were stronger at 4 weeks (Fig. 4c,d) and weaker at 15 weeks (Fig. 4e,f) after birth in MCT mice compared to the wildtype ddY mice. The reaction patterns of TGFβRII were similar to that of TGFβRI (Fig. 5). Real-time RT-PCR of TGFβ1, TGFβ2, and FGF2 mRNA in the lens 2 weeks after birth The level of expression for TGFβ1 and TGFβ2 mRNA was significantly higher in MCT than in wild-type ddY mice (Fig. 6a,b). There © 2013 Japanese Teratology Society
Fig. 3 Anterior region of the lenses of wild-type ddY (a; 2 week, c; 4 week, e; 15 week) and MCT (b; 2 week, d; 4 week, f; 15 week) mice stained with anti-FGF2 antibody. A stronger reaction of lens epithelial cells to anti-FGF2 antibody is seen in the Morioka cataract (MCT) mice compared to wild-type ddY mice at 4 weeks after birth. A weaker reaction of lens epithelial cells to anti-FGF2 antibody is seen in the MCT mice compared to wild-type ddY mice at 15 weeks after birth.
was no significant difference in the expression level of FGF2 between MCT and wild-type ddY mice (Fig. 6c).
DISCUSSION Through utilizing the MCT mice, the present study reveals that the expression of TGFβ is increased in lens epithelial cells prior to cataract affection and those of FGF2, TGFβRI, and TGFβRII are increased immediately after the affection. McAvoy et al. (1991; 1999) suggested that FGF molecules play a key role in determining lens polarity and growth patterns. Furthermore, acidic (FGF1) and basic FGF (FGF2) have each been shown to induce proliferation and differentiation of rat lens epithelial cells in culture at physiological concentrations (McAvoy and Chamberlain 1989), and Stolen et al. (1997) indicate that FGF2 can act as a modulator of later stages of differentiation including fiber cell survival. Over 20 years of accumulated
TGFβ and FGF in the lens of MCT mice
a
c
e
c
e
d
f
50 µm
50 µm
b
a
107
d
f
b
Fig. 4 Anterior region of the lenses of wild-type ddY (a; 2 week, c; 4 week, e; 15 week) and Morioka cataract (MCT) (b; 2 week, d; 4 week, f; 15 week) mice stained with anti-transforming growth factor β (TGFβ) RI antibody. Stronger reaction of lens epithelial cells to anti-TGFβRI antibody is seen in the MCT mice compared to wild-type ddY mice at 4 weeks after birth. Weaker reaction of lens epithelial cells to anti-TGFβRI antibody is seen in the MCT mice compared to wild-type ddY mice at 15 weeks after birth.
Fig. 5 Anterior region of the lenses of wild-type ddY (a; 2 week, c; 4 week, e; 15 week) and Morioka cataract (MCT) (b; 2 week, d; 4 week, f; 15 week) mice stained with anti-transforming growth factor β (TGFβ) RII antibody. Stronger reaction of lens epithelial cells to anti-TGFβRII antibody is seen in the MCT mice compared to wild-type ddY mice at 4 weeks after birth. Weaker reaction of lens epithelial cells to anti-TGFβRII antibody is seen in the MCT mice compared to wild-type ddY mice at 15 weeks after birth.
evidence using several different vertebrates species has suggested that FGFs and/or FGF receptors play a key role in lens development (Robinson 2006). TGFβ, like FGF, can also change the fate of lens epithelial cells (de Iongh et al. 2005) and the elevated levels of TGFβ are associated with lens dysfunction (McAvoy et al. 2000; Boswell et al. 2010). In the present study, at 2 weeks after birth, the positive reaction of lens epithelial cells to antiTGFβ in MCT mice was slightly stronger and the expression of TGFβ1 and TGFβ2 mRNA significantly higher than in agematched wild-type ddY mice. These results suggest that the elevated expression of TGFβ is involved in onset of cataractous histological changes since lens opacity appears at 6 to 8 weeks of age (Kondo et al. 2010) and the swollen lens fiber is electron microscopically observed at 3 weeks after birth in the MCT mice (Kondo et al. 2011). This notion is supported by the following reports: rats that receive a single intravitreal injection of TGFβ subsequently develop cataracts (Hales et al. 1999); TGFβ stimula-
tion induces lens epithelial cells to undergo aberrant growth and differentiation (Lovicu et al. 2002). The positive reaction of lens epithelial cells to FGF2 in 2-week-old MCT mice was similar to that in age-matched wild-type ddY mice and the expression level of FGF2 on the lens of 2-week-old MCT mice was not elevated but tended to be lowered (not significant). These results suggest that cataract affection of MCT mice is thought to start with the elevated expression of TGFβ without that of FGF2. This notion is supported by the report that TGFβ disturbs FGF-induced lens developmental processes and induces pathologic changes in the lens (Ueda et al. 2000). Despite the strong differentiating activity of FGF2 on rat lens epithelial explants, transgenic mice overexpressing FGF2 in the lens exhibit an inhibition of fiber cell differentiation (Robinson 2006). Further, Zhang et al. (2012) have observed elevated expression in FGF2 and TGFβ in the lens of experimentally-induced diabetic cataract rats. In the present study, the positive reaction of © 2013 Japanese Teratology Society
108
T. Kondo et al.
a
c
b 9
6
*
5
1.4
*
8
1.2
7 1
Fig. 6 Real-time reverse transcriptionpolymerase chain reaction (RT-PCR) analysis of the expression of transforming growth factor β1 (TGFβ1) (a), TGFβ2 (b), and FGF2 (c) mRNA in the lens at 2 weeks after birth. The expression levels for TGFβ1, TGFβ2, and FGF2 were calculated using the Δ-Δ-Ct method and normalized to the relative quantity of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) expression in each sample. Data are expressed as the means ± standard error of the mean (SEM) of three individual experiments. *Significantly different from wild-type ddY mice (P < 0.05).
6
4
2
0.8
4
0.6
3 0.4 2
1
0.2
1 0
ddY
Mct
lens epithelium to FGF2 antibody was stronger in MCT mice than in wild-type ddY mice in addition to the changes in TGFβ at 4 weeks after birth. These results suggest that abnormal expression of FGF2, as well as that of TGFβ, induce the morphological changes in the lens of MCT mice. This notion is supported by several lines of evidence as follows: cross-talk between FGF- and TGF-β-signaling pathways could contribute to cataractogenesis (Boswell et al. 2010); FGF is identified as a factor capable of exacerbating the cataractogenic effects of TGF-β (Cerra et al. 2003); the morphological changes that resemble human posterior cataract opacification, extensive multilayering, swollen cells and extensive globule formation are observed in lens explant cultured with TGF-β and FGF (Symonds et al. 2006). Further, the positive reactions of the lens epithelium in MCT mice to anti-TGFβRI and anti-TGFβRII antibodies were stronger immediately after the affection and weaker at 15 weeks after birth compared to the wild-type ddY mice. These findings suggest that the activity of TGF-β is stimulated by abnormal expression of FGF2 in the MCT mice because the changes in the immunolocalization of TGFβRI and TGFβRII in the MCT mice paralleled that of the changes in FGF2. This notion is supported by the report that addition of FGF2 to lens epithelial explants of 9-day old rats induced increased TGFβ receptors immunoreactivity and enhanced the competency of lens epithelial cells to TGFβ (de Iongh et al. 2001). The major intracellular signaling system identified for TGFβ is through translocation of Smad proteins and the Smad2 and Smad3 are commonly associated with mediating TGFβ signals (Eldred et al. 2011). TGFβ transduces its signal by binding to TGFβ Type I and II serine/threonine kinase receptors leading to phosphorylation of Smad proteins (Bot et al. 2009). Therefore, the further investigation that examines pSmad 2/3 expressions is thought to be necessary for elucidation of the signal transduction in the cataract affection of MCT mice. Consequently, the present study indicates that the lens epithelium of MCT mice has increased expressions of TGFβ before cataract affection and that changes in the expression of FGF2 as well as TGFβ may contribute to progression of the cataract in the mice. © 2013 Japanese Teratology Society
5 3
0
ddY
Mct
0
ddY
Mct
ACKNOWLEDGMENTS This work was supported in part by a Grant-in Aid (No. 16580253) from the Ministry of Education, Science and Culture of Japan.
REFERENCES Bermejo E, Martínez-Frías ML. 1998. Congenital eye malformations: clinical-epidemiological analysis of 1,124,654 consecutive births in Spain. Am J Med Genet 75:497–504. Boswell BA, VanSlyke JK, Musil LS. 2010. Regulation of lens gap junctions by transforming growth factor beta. Mol Biol Cell 21:1686–1697. Bot PTG, Hoefer IE, Sluijter JPG et al. 2009. Increased expression of the Transforming Growth Factor-β signaling pathway, endoglin, and Early Growth Response-1 in stable plaques. Stroke 40:439–447. Cerra A, Mansfield KJ, Chamberlain CG. 2003. Exacerbation of TGF-βinduced cataract by FGF-2 in cultured rat lenses. Mol Vis 9:689–700. de Iongh RU, Gordon-Thomson C, Chamberain CG, Hales AM, McAvoy JW. 2001. TGFβ receptor expression in lens: implication for differentiation and cataractgenesis. Exp Eye Res 72:649–659. de Iongh RU, Wederell E, Lovicu FJ, McAvoy JW. 2005. Transforming growth factor-β-induced epithelial-mesenchymal transition in the lens: a model for cataract formation. Cells Tissues Organs 179:43–55. Eldred JA, Dawes LJ, Wormstone IM. 2011. The lens as a model for fibrotic disease. Phil Trans R Soc B 366:1301–1319. Graw J. 2004. Congenital hereditary cataracts. Int J Dev Biol 48:1031–1044. Graw J. 2009. Mouse models of cataract. J Genet 88:469–486. Hales AM, Chamberlain CG, Dreher B, McAvoy JW. 1999. Intravitreal injection of TGFβ induces cataract in rats. Invest Ophthalmol Vis Sci 40:3231–3236. Kondo T, Ishiga-Hashimoto N, Nagai H et al. 2011. An increase in apoptosis and reduction in αB-crystallin expression levels in the lens underlie the cataractogenesis of Morioka cataract (MCT) mice. Med Mol Morphol 44:221–227. Kondo T, Nagai H, Morioka H, Kusakabe KT, Okada T. 2010. Novel cataract mouse model using ddY strain: hereditary and histological characteristics. J Vet Med Sci 72:203–209. Lovicu FJ, McAvoy JW. 2005. Growth factor regulation of lens development. Dev Biol 280:1–14. Lovicu FJ, Schulz MW, Hales AM et al. 2002. TGFβ induces morphological and molecular changes similar to human anterior subcapsular cataract. Br J Ophthalomol 86:220–226.
TGFβ and FGF in the lens of MCT mice McAvoy JW, Chamberlain CG. 1989. Fibroblast growth factor (FGF) induces different responses in lens epithelial cells depending on its concentration. Development 107:221–228. McAvoy JW, Chamberlain CG, de Iongh RU, Hales AM, Lovicu FJ. 1999. Lens development. Eye 13:425–437. McAvoy JW, Chamberlain CG, de Iongh RU, Richardson NA, Lovicu FJ. 1991. The role of fibroblast growth factor in eye lens development. Ann NY Acad Sci 638:256–274. McAvoy JW, Chamberlain CG, de Iongh RU, Hales AM, Lovicu FJ. 2000. Peter bishop lecture: growth factors in lens development and cataract: key roles for fibroblast growth factor and TGF-β. Clin Exp Ophthalmol 28:133–139. Nawshad A, Lagamba D, Polad A, Hay ED. 2005. Transforming growth factor-beta signaling during epithelial-mesenchymal transformation: implications for embryogenesis and tumor metastasis. Cells Tissues Organs 179:11–23. O’Conner MD, McAvoy JW. 2007. In vitro generation of functional lenslike structures with relevance to age-related nuclear cataract. Invest Ophthalmol Vis Sci 48:1245–1252. Omori A, Harada M, Ohta S et al. 2011. Epithelial Bmp (Bone morphogenetic protein) signaling for bulbourethral gland development: a mouse model for congenital cystic dilation. Congenit Anom 51:102–109.
109
Robinson ML. 2006. An essential role for FGF receptor signaling in lens development. Semin Cell Dev Bol 17:726–740. Stolen CM, Jackson MW, Griep AE. 1997. Overexpression of FGF-2 modulates fiber cell differentiation and survival in the mouse lens. Development 124:4009–4017. Symonds JG, Lovicu FJ, Chamberlain CG. 2006. Posterior capsule opacification-like changes in rat lens explants cultured with TGF-β and FGF: effects of cell coverage and regional differences. Exp Eye Res 82:693–699. Taki A, Abe M, Komaki M et al. 2012. Expression of angiogenesis-related factors and inflammatory cytokines in placenta and umbilical vessels in pregnancies with preeclampsia and chorioamnionitis/funisitis. Congenit Anom 52:97–103. Ueda Y, Chamberlain CG, Satoh K, McAvoy JW. 2000. Inhibition of FGF-induced αA-crystallin promoter activity in lens epithelial explants by TGFβ. Invest Ophthalmol Vis Sci 41:1833–1839. Zhang P, Xing K, Randazzo J, Blessing K, Lou MF, Kador PF. 2012. Osmic stress, not aldose reductase activity, directly induces growth factors and MAPK signaling changes during sugar cataract formation. Exp Eye Res 101:36–43.
© 2013 Japanese Teratology Society
