Journal of General Virology(1992), 73, 925-931. Printedin Great Britain

925

Expression of the major core antigen VP7 of African horsesickness virus by a recombinant baculovirus and its use as a group-specific diagnostic reagent T. Chuma, 1 H. Le Blois, 2 J. M. Sfinchez-Vizcaino, 3 M. Diaz-Laviada 3 and P. Roy 1,2. 1University of Alabama at Birmingham, Alabama 35294, U.S.A., 2Laboratory of Molecular Biophysics, Oxford University, South Parks Road, Oxford 0](1 3QU and NERC Institute of Virology and Environmental Microbiology, Mansfield Road, Oxford OX1 3SR, U.K. and 3Departmento de Sanidad Animal, Instituto Naeional de Investigaciones Agrarias, Madrid, Spain

The major core protein, VP7, of African horsesickness virus serotype 4 (AHSV-4), the aetiological agent of a recent outbreak of the disease in southern Europe, was expressed in insect cells infected with a recombinant baculovirus containing a cloned copy of the relevant AHSV gene ($7). Analyses of its biochemical and antigenic properties confirmed the authenticity of the protein expressed. The high-level expression of VP7 under the control of the strong polyhedrin promoter of

Autographa californica nuclear polyhedrosis virus induced disc-shaped crystals in infected insect cells. This enabled us to purify the protein by a one-step ultracentrifugation procedure and to utilize it for the detection of antibodies raised in horses to various serotypes ofAHSV. A serological relationship between AHSV and two other orbiviruses, bluetongue virus and epizootic haemorrhagic disease virus, was also

Introduction

gene [RNA segment 7 ($7)] that encodes VP7. The complete sequence of the gene was obtained from clones of $7 cDNA (Roy et al., 1991). In this work we describe the construction and isolation of a recombinant baculovirus containing the cloned $7 cDNA. The strong polyhedrin promoter of Autographa californica nuclear polyhedrosis virus (AcNPV) was used to obtain high level expression of VP7. The recombinant produces AHSV-4 VP7 in infected Spodopterafrugiperda (St') cells; its antigenic properties were analysed and compared with those of BTV VP7 using a panel of anti-BTV and anti-AHSV polyclonal sera, as well as the available monoclonal antibodies (MAbs). The biologically active form of VP7 was purified, and its utility for diagnosis of AHSV infections was demonstrated using an ELISA.

African horsesickness, which is endemic in sub-Saharan Africa, is a gnat (Culicoides)-transmitted disease of horses, mules and donkeys; goats, zebras, ferrets and dogs are also susceptible. In severe cases death occurs from pulmonary oedema. The aetiological agent is an orbivirus classified in the Reoviridae family, African horsesickness virus (AHSV), of which nine serotypes are recognized. Like that of bluetongue virus (BTV), the dsRNA genome of AHSV consists of 10 segments located within an icosahedral core particle, which is composed of two major (VP3 and VP7) and three minor (VP 1, VP4 and VP6) proteins. The core is surrounded by two other proteins (VP2 and VP5), which form a loosely bound outer capsid. Unlike BTV, little is known about the molecular biology of AHSV. Recently, several outbreaks of the disease have occurred in Spain and Portugal. To develop suitable diagnostic reagents and rational strategies to control and prevent the disease induced by AHSV, we have investigated the structure-function relationships of the various genes and gene products of an AHSV-4 isolate recovered in Spain. Since VP7 has been identified as a group-specific antigen for BTV (Huismans & Erasmus, 1981 ; Gumm & Newman, 1982; Hiibschle & Jang, 1983; Oldfield et al., 1990), we initially investigated the AHSV 0001-0575 © 1992 SGM

demonstrated.

Methods Virus and cells. Sf cells were grown in suspension or monolayer culturesat 28 °C in TC100mediumsupplementedwith 10% foetalcalf serum (FCS). AcNPV and recombinantbaculoviruseswere plaquepurified and propagated as described by Brown & Faulkner(1977). DNA manipulations and recombinant transfer vector contruction. Standard DNA manipulation techniques were used to construct recombinant baculovirus transfer vectors (Maniatis et al., 1982). Restriction enzymes,T4 DNA ligase and the Klenow fragmentof DNA polymerasewere purchased from Amersham. Calf intestinal alkaline phosphatase was obtained from BoehringerMannheim.

926

T. Chuma and others

PstI

PstI

~PstI

~SalI Dephosphorylate repair BamHI KlenowBamHI

~Bal 31

BamHl! BamHI~BamHI

BamH~

BamHI BamHl_[.L...~~orylate | Partial

Polyhedrin promoter " ~ , ~ @

5' - ....

BamHI

AAAAAAACCTATAAATACGGATCCGTCGAGGATGGACGCG

Polyhedrinpromoter

3'

VP7

Fig. 1. Diagrammatic representation of the construction of the transfer vector pAcYM1/AHSV4.7 (see Methods). The sequence of the 5' insertion site is shown with the initiation codon (ATG) of $7 underlined.

The construction of plasmid pAcYM1/AHSV4.7 is summarized in Fig. 1. The full-length cDNA representing AHSV-4 $7 dsRNA was released from the pBR322 cloning vector by PstI digestion, and the homopolymeric tails added in the original cloning procedure were removed by digestion with Bal 31 (Roy et al., 1991). The products were then repaired using the Klenow fragment of DNA polymerase and inserted into pUC4K, digested previously with SalI, repaired and dephosphorylated as shown in Fig. 1. The terminal sequences of candidate inserts were sequenced according to Maxam & Gilbert (1980) and a clone retaining the entire coding region as well as 7 bp upstream of the ATG start codon was selected and ligated into the BamHI site of the baculovirus transfer vector pAcYM1 (Matsuura et al., 1987). The derived recombinant transfer vectors were characterized by restriction enzyme mapping and sequence analyses. One of the recombinant vectors (pAcYM 1/AHSV4.7) was selected; this construct contained the AHSV $7 gene inserted in the correct orientation for expression directed by the AcNPV polyhedrin promoter.

Transfection and selection of recombinant baculoviruses. To obtain recombinants, cotransfections were performed by the lipofectin method using linearized AcRP6SC baculovirus DNA to increase the level of recombination, as previously described (Kitts et al., 1990). The lipofectin mixture (8 ~tl lipofectin and 4 ill water) was added dropwise to the cotransfection mixture (12 ill containing 1 lig of pAcYM1/AHSV4.7 DNA and 50 ng of linearized AcRP6SC baculovirus DNA) and incubated for 15 min at room temperature. The mixture was

inoculated onto a 35 mm tissue culture dish containing 1.5 x 106 Sfcells in 1 ml serum-free TC100 and incubated for 5 to 24 h at 28 °C. TCI00 (1 ml) containing 10% FCS was then added to the cells, and the supernatant was harvested at 48 h, when c.p.e, was detectable. Recombinants, selected by virtue of their ability to express ANSV-4 VP7 as demonstrated by Western immunoblot analyses, were subsequently plaque-purified (Matsuura et al., 1987).

PAGE and Western blot analyses of recombinant proteins. Sf cells in 35 mm tissue culture dishes were infected with virus at a multiplicity of 10 p.f.u./cell, the cells were incubated at 28 °C, and then rinsed three times with PBS and lysed in 150 Ill of RIPA buffer (1% Triton X-100, 1% sodium deoxycholate, 0.5 M-NaC1, 0"05 M-Tris-HCI pH 7.4, 0.01 MEDTA, 0.1% SDS). Aliquots of protein samples were boiled for 10 min in dissociation buffer (2.3% SDS, 10% v/v glycerol, 5% v/v 2-mercaptoethanol, 62.5 mM-Tris-HC1 pH 6.8, 0-01% bromophenol blue) and analysed by 10% PAGE in the presence of SDS (Laemmli, 1970). After electrophoresis, proteins were either stained with Kenacid blue (Overton et al., 1987) or blotted onto an Immobilon membrane using a semi-dry electroblotter. The blot was incubated for 1 h at room temperature in blocking solution (5% w/v milk powder and 0.1% NP40 in PBS), then transferred to a blocking solution containing the first antibody and incubated for 1 h at room temperature. After three washes of 10 min each in the same buffer, the blot was incubated for 1 h at room temperature in blocking buffer containing an appropriate alkaline phosphatase-conjugated IgG (Sigma). Following further washes in PBS alone, bound antibody was detected using 5-bromo-4chloro-3-indolyl phosphate and nitro blue tetrazolium chloride (Gibco) as substrates for the alkaline phosphatase. Electron micrographs of infected cells. Sf cells were infected with recombinant baculovirus at a multiplicity of 10 p.f.u./cell and incubated at 28 °C for 3 days. The cells were washed with PBS, fixed with 2% glutaraldehyde and treated with 1% osmic acid. Cell sections were observed in a JEOL electron microscope. Protein labelling and immunoprecipitation analyses. Sf cells were infected with either recombinant virus (AcAHSV-4.7 or AcBTV-10.7) or wild-type AcNPV at a multiplicity of 5 p.f.u./cell in 35 mm tissue culture dishes (1.5 x 106 cells/dish) and incubated at 28 °C. At the time of maximum protein expression (approximately 60 lig/1-5 x 106 cells), the cells were incubated for 1 h at 28 °C in methionine- and serum-free medium to reduce the intracellular pools of the precursor. The cells were then labelled overnight at 28 °C with 50 pCi [3sS]methionine (Amersham; 800 Ci/mmol) in methionine- and serum-free medium. After the labelling period, the medium was removed, the monolayers were rinsed three times with PBS and the cells were lysed in 200 til RIPA buffer. Aliquots (50 I~1) of these extracts were then incubated with 5 pl of antibody in 450 Ill RIPA buffer overnight at 4 °C. Fifty microlitres of a 30% solution of Protein A-Sepharose CL-4B beads (Sigma) was added, and the mixture was incubated overnight at 4 °C. The beads were then washed three times with ice-cold RIPA buffer and the immune complexes were removed from the beads by boiling for 5 min in dissociation buffer (see above). Aliquots of the supernatant were subjected to 10% PAGE in the presence of SDS as described by Laemmli (1970). After electrophoresis the gels were fixed in 10% (v/v) acetic acid, dried and exposed to X-ray film. Purification of A H S V VP7 expressed in S f cells. AcAHSV-4.7infected Sf cells (2 x 109) were harvested 4 days post-infection by centrifugation at 3000 r.p.m, for 15 min at 4 °C and rinsed in PBS. Cell pellets were resuspended in 24 ml of 10 mM-Tris-HC1 pH 7.5, 150 mMNaCI containing 0.5% NP40 and left on ice for 15 min. The treated cells were then recentrifuged at 1000 r.p.m, for 10 min to remove cell debris. The supernatant was loaded onto a 30% to 80% (w/v, 10 ml) continuous sucrose gradient in 10 mM-Tris-HC1 pH 7.5. The gradients were centrifuged at 26000 r.p.m, for 2 h at 4 °C in an SW41 rotor

Recombinant VP7 of AHSV-4 (Beckman), and 1 ml fractions were collected. Samples containing AHSV VP7 were pooled and dialysed overnight at 4 °C in 10 mM-TrisHC1 pH 7.5. Insoluble material was removed by low-speed centrifugation, and the supernatant medium was freeze-dried and stored at - 20 °C.

ELISA usingpurified VP7. Each well of a 96-well PVC microtitre plate (Flow Laboratories) was coated overnight at 4 °C with 50 lal VP7 (i.e. approximately 100 ng/well) in 0-1 M-sodium bicarbonate pH 9-5. After adsorption of the antigen, the plates were saturated in blocking buffer [5% skimmed milk powder in TBS (144 mM-NaCI in 25 mMTris-HCl pH 7.6)] for 30 rain at room temperature. Following three washes in blocking buffer, the plates were incubated with 200 p.l/wellof serial dilutions of reference anti-AHSV-4 horse serum or anti-BTV-10 rabbit serum diluted in blocking buffer, for 1 h at room temperature. After three washes in the same buffer, the plates were incubated with 200 lal/wellof 1 : 1000 dilution of anti-horse or anti-rabbit IgG-alkaline phosphatase conjugate (Sigma) for 1 h at room temperature. Following three washes in TBS alone, the enzyme-linked secondary antibodies were detected using p-nitrophenyl phosphate disodium substrate (Sigma) in 1 M-Tris-HCI pH 8.0. The absorbance at 405 nm was measured using a multichannel spectrophotometer.

1

2

3

4

5

6

7

8

9

927 10

180K-116K--

84K-58K-48.5K-36.5K-26-5K-

Fig. 2. Expression of VP7 in Sf cells by a recombinant baculovirus, AcAHSV-4.7. Protein samples were resolved on a 10% SDSpolyacrylamide gel and stained with Kenacid blue. Lanes: 1, Mr markers (sizes are indicated); 2, mock-infected Sf cell lysate; 3 to 6, AcNPV- and 7 to 10, AcAHSV-4.7-infected Sf cell lysates 24, 48, 72 and 96 h post-infection, respectively. The positions of the AcNPV polyhedrin protein (P) and AHSV VP7 are indicated.

Results (a)

Construction of a recombinant transfer vector and selection of recombinant baculoviruses A recombinant baculovirus transfer vector containing the A H S V - 4 $7 sequence was c o n s t r u c t e d as d e s c r i b e d in M e t h o d s (Fig. 1). T o facilitate the cloning o f c D N A r e p r e s e n t i n g A H S V - 4 $7 R N A into p B R 3 2 2 , h o m o p o l y m e r i c tails h a d b e e n a d d e d ( R o y et al., 1991). T h e s e sequences were r e m o v e d by d i g e s t i o n w i t h exonuclease Bal 31 to r e d u c e the l e n g t h o f the 5' n o n - c o d i n g sequence b e c a u s e this c a n cause s u b o p t i m a l e x p r e s s i o n by a r e c o m b i n a n t b a c u l o v i r u s ( M a t s u u r a et al., 1987). T h e D N A p r o d u c t was t h e n t r a n s f e r r e d to a p U C 4 K v e c t o r to a d d a BamHI site at e a c h e x t r e m i t y , r e c o v e r e d a n d inserted into the p A c Y M 1 b a c u l o v i r u s t r a n s f e r v e c t o r u n d e r the c o n t r o l o f the A c N P V p o l y h e d r i n p r o m o t e r ( M a t s u u r a et al., 1987). T h e correct o r i e n t a t i o n o f the insert in p A c Y M 1 / A H S V 4 . 7 a n d the s e q u e n c e b e t w e e n the A T G o f the $7 gene a n d the p o l y h e d r i n t r a n s c r i p t i o n i n i t i a t i o n site were d e t e r m i n e d by d i d e o x y n u c l e o t i d e sequence analyses (Fig. 1). A s shown, the o p e n r e a d i n g f r a m e o f the $7 gene was f l a n k e d at its 5' e x t r e m i t y b y seven nucleotides f r o m the c D N A in a d d i t i o n to the ref o r m e d BamHI site. R e c o m b i n a n t b a c u l o v i r u s e s were o b t a i n e d by transfecting Sf cells w i t h a m i x t u r e o f p l a s m i d D N A a n d l i n e a r i z e d A c R P 6 S C D N A in the p r e s e n c e o f l i p o f e c t i n ( K i t t s et al., 1990). P l a q u e s p r o d u c e d b y the p r o g e n y viruses f r o m t h e t r a n s f e c t i o n were s c r e e n e d by W e s t e r n i m m u n o b l o t analysis using a n t i - A H S V - 4 p o l y c l o n a l s e r u m a n d r e c o m b i n a n t s e x p r e s s i n g V P 7 were selected ( f r e q u e n c y a p p r o x i m a t e l y 20%). A f t e r t h r e e f u r t h e r

(b) 1

2

3

1

2

3

~---VP7

Fig. 3. Western blot analysis of AHSV-4 and BTV-10 VP7 samples using (a) anti-AHSV-4 horse polyclonal serum or (b) anti-BTV-10 rabbit polyclonal serum. Lanes: l, AcNPV-infected Sf cell lysate; 2, AcAHSV-4.7-infected Sf cell lysate; 3, AcBTV-10.7-infected Sf cell lysate. The VP7s of the respective recombinants are indicated.

p l a q u e purification steps, t h r e e p u t a t i v e r e c o m b i n a n t s were o b t a i n e d . N o difference in the p h e n o t y p e s o f the t h r e e viruses was d e t e c t e d in t e r m s o f the size o r a m o u n t o f v i r u s - i n d u c e d p r o t e i n synthesized. O n e o f the r e c o m b i n a n t s ( A c A H S V - 4 . 7 ) was c h o s e n for further analyses.

High-level expression of AHSV-4 VP7 causes crystal formation in Sf cells C o n f l u e n t m o n o l a y e r s o f S f cells were m o c k - i n f e c t e d or i n f e c t e d at a m u l t i p l i c i t y o f 5 p.f.u./ceU w i t h e i t h e r A c N P V or A c A H S V - 4 . 7 . F o r c o m p a r i s o n , cells were

928

T. Chuma and others

Fig. 4. (a) AcAHSV-4.7-infectedSf cells. (b) AcNPV-infected Sf cells. Bar markers represent 250 ~tm. (c) Electron micrograph of a sectioned Sf cell infected with AcAHSV-4.7. Bar marker represents 1 I.tm.P, AcNPV P10 aggregates in cytoplasmand nucleus; D, novel disc-shaped crystals consisting of AHSV VP7 also in the cytoplasm and nucleus.

also infected with the recombinant baculovirus AcBTV10.7, expressing BTV-10 VP7 (Oldfield et al., 1990). The proteins were resolved by S D S - P A G E and stained with Kenacid blue (Fig. 2), or analysed by Western immunoblotting (Fig. 3a and b). As shown in Fig. 2, by comparison with mock-infected and AcNPV-infected Sf cell controls, cells infected with

AcAHSV-4.7 synthesized a major 38K protein, i.e. similar to the predicted AHSV-4 $7 gene product (Roy et al., 1991) and equivalent to the recombinant BTV-10 VP7 (Oldfield et al., 1991 ; Fig. 3). Maximum expression of VP7 was obtained 4 days post-infection. The level of expression of AHSV-4 VP7 was estimated to be approximately 60 mg/2 × 109 infected Sf cells.

Recombinant VP7 of A H S V - 4

Confirmation that the expressed 38K protein represented authentic AHSV polypeptide was provided by Western blot analyses using a polyclonal anti-AHSV4 horse antiserum (Fig. 3a). This antiserum reacted strongly with VP7 in AcAHSV-4.7-infected Sf cells, whereas no reaction was detected with proteins from AcNPV-infected Sf cells. To determine whether AHSV and BTV VP7 crossreact, the AHSV-4 VP7 and BTV-10 VP7 samples expressed from the respective recombinant baculoviruses were resolved by SDS-PAGE and subjected to Western immunoblot analyses using either the polyclonal anti-AHSV-4horse antiserum (Fig. 3a) or a polyclonal anti-BTV-10 rabbit antiserum (Fig. 3b). As shown in Fig. 3 (a), only a faint reaction (if any) was obtained between the anti-AHSV-4 antiserum and BTVI 0 VP7, and none was detected between the anti-BTV-10 antiserum and AHSV-4 VP7 (see below). Since the level of AHSV VP7 expression was very high as judged by the levels of stained protein (Fig. 2), it was of interest to determine whether the recombinant virusinfected cells showed any visible structures, as previously observed in AHSV virus-infected BHK21 cells (Oellermann, 1970; P. Mertens, personal communication). As shown in Fig. 4 (a) (arrows), when examined under a light microscope infected cells exhibited distinct disc-shaped crystals; mock-infected cells, AcNPV-infected cells (Fig. 4b, arrow highlights viral polyhedra), and cells infected with other types of recombinant baculoviruses (see Matsuura et al., 1987) lacked such structures. The AHSV VP7 structures exhibited variations in both size and number per cell, usually containing between one and three crystals (Fig. 4a). Electron micrographs of AcAHSV-4.7-infected cells (Fig. 4c) confirmed the presence of disc-shaped crystals in the nucleus and cytoplasm of infected cells. These morphological structures were subsequently purified on a linear sucrose gradient as described in Methods, and the authenticity of the expressed protein was confirmed by Western blot analysis (data not shown).

Recombinant VP7 is a group-specific immunogenic antigen and shares common antigenic determinants with other orbiviruses

Recently we have demonstrated that BTV VP7 is not only recognized by all anti-BTV antisera, but also by anti-AHSV antisera (Oldfield et al., 1990). Therefore it was of interest to determine whether AHSV VP7 exhibited similar cross-reactive capabilities with all antiAHSV antisera as well as with antisera to BTV and the related epizootic haemorrhagic disease virus (EHDV).

929

Table 1. Reactivities of recombinant VP7 in ELISA Antiserum Antigen

AHSV-4

BTV- 10

EHDV- 1

AHSV-4 BTV-10 Control

1:1280 1:100 1 : 10

1:160 1:640 1 : 10

1:80 1:320 1 : 10

* Antibody titres are the reciprocal of the dilution giving 5 0 ~ of the m a x i m u m absorbance (at 450 nm).

To determine whether the AHSV VP7 expressed could react with antibodies representing the nine AHSV serotypes, purified VP7 was coated onto microwell plates (100ng/well) and tested by ELISA using polyclonal antisera to the nine AHSV serotypes. The recombinant AHSV-4 VP7 was recognized by all the anti-AHSV antisera tested (data not shown). Similarly, sera from infected animals or from animals vaccinated with either monovalent or polyvalent AHSV vaccines reacted equally well. Subsequently a comparative EL1SA was performed using AHSV and BTV-10 VP7, and homologous and heterologous polyclonal antisera. As shown in Table 1, the cross-rectivity of anti-BTV and anti-EHDV antisera with recombinant AHSV VP7 was dectectable but significantly lower than that with homologous antiserum. Similarly, low cross-reactivity was observed between recombinant BTV-10 VP7 and anti-AHSV-4 antiserum (Table 1). However, BTV- 10 VP7 reacted well with anti-EHDV-1 antisera, as expected. The data indicate the existence of few common antigenic determinants in the two viruses. The antigenic relationships were analysed further by Western blot analysis and by immunoprecipitation studies. For these experiments, polyclonal sera against AHSV, BTV and EHDV, as well as a panel of antiAHSV and anti-BTV VP7 MAbs were used. The results are presented in Fig. 5 and are summarized in Table 2. The data obtained with the polyclonal sera clearly indicated that AHSV and BTV VP7 cross-react in immunoprecipitation analyses (Fig. 5). The cross-reactivities of the antisera were not, or were only faintly detectable by Western immunoblot analyses (Table 2). This suggests the existence of one major, perhaps conformational and immunodominant, determinant on each VP7. The results were confirmed by the reactivities observed using the four different MAbs (Fig. 5 and Table 2). In immunoprecipitation analyses, the anti-BTV MAb reacted strongly with BTV VP7 and to a lesser extent with AHSV VP7 (Fig. 50. However, since it did not show similar positive signals in Western blot assays with either BTV VP7 or AHSV VP7, it can be inferred that the shared epitope is conformational rather than linear.

930

T. Chuma and others

(a) 1

(b) 2

3

1

(e) 2

3

(d)

!

2

3

1

(e) 2

3

1

(f) 2

3

1

(g) 2

3

1

(h) 2

3

1

(i) 2

3

1

2

Fig. 5. Antigenic cross-reactivities between AHSV and BTV VP7 determined by immunoprecipitation. The labelled Sf cell lysates (1-5 x 106 cells) infected with either (lanes 1) A c N P V , (lanes 2) A c A H S V - 4 . 7 or (lanes 3) 3 AcBTV-10.7 were immunoprecipitated and resolved by S D S - P A G E as described in Methods using various antisera. (c) Anti-AHSV-4 horse polyclonal serum (1:400, 1 : 1000); (b) anti-BTV-10 rabbit polyclonal serum (1:400, 1 : 1000), (c) anti-BTV-10 vaccinated sheep serum (1:200); (d) anti-EHDV-1 vaccinated sheep serum (1 : 200); (e) anti-EHDV-2 vaccinated sheep serum (1 : 200); (/to h) anti-AHSV-4 VP7 M A b s 5G5, 3D2 and 4AH9; (i) antiBTV-10 VP7 M A b 169 (each 1:400).

Table 2. Reaction of AHSV-4 and BTV-IO VP7 with various antibodies AHSV-4 VP7 Antibody AHSV-4 Polyclonal M A b 5Gs MAb3D 2 M A b 4A49 BTV-10 Polyclonal (U.S.A.) M A b 169 EHDV-1 Polyclonal 1 Polyclonal 2

BTV-10 VP7

WB*

IP*

WB

IP

+ + + t + + + ++++ +

+ + + + + + +++ + +

-J; + -

+ + + + + +

+ + + -

+ + + +

-

+ + + + + + + +

-

+ + +

-

+ + + +

*IP, Immunoprecipitation; WB, Western blotting. t + , Positive reaction ( + + + + , strongest to + , weakest). :~ - , Negative reaction.

By contrast, three anti-AHSV MAbs (MAbs 5G5, 3D2 and 4AH9) recognized one linear epitope on AHSV-4 VP7 (Table 2) which is apparently shared by BTV VP7. The reactivity of these three MAbs with BTV VP7 was very low, suggesting that a related but not identical sequence is involved. The anti-EHDV antibodies did not react with the AHSV or BTV antigens in Western blot assays (Table 2). Whether the negative result was due to relatively low titres is not clear. However, they did exhibit low but definite reactivities in the immunoprecipitation tests (Fig. 5 d, e).

Discussion The complete sequence of AHSV-4 $7, encoding VP7, one of the major core proteins of the virus, has been published recently and shown to be closely related to that of BTV $7 (Roy et al., 1991). To study the structurefunction relationships of BTV and AHSV VP7, AHSV-4

$7 cDNA was expressed using baculovirus vectors. AHSV VP7 was synthesized at high level in Sf cells and reached a maximum by 4 days post-infection, estimated (based on stained gels) to be 60 mg AHSV VP7/I, which contains 2 x 109 AcAHSV-4.7-infected Sf cells. This phenotype differed from that of the BTV VP7 recombinant constructed using the same baculovirus vector, in which BTV VP7 reached a maximum by 2 days postinfection. Interestingly, AHSV VP7 synthesized in Sf cells selfassembled to form disc-shaped crystal structures visible by 2 days post-infection. In general, up to three structures per cell were identified, with a maximum diameter of 25 gm and length of 250 ktm. This is in agreement with the observations made on AHSV-infected BHK ceils (Oellerman, 1970; P. Mertens, personal communication). Such large structures represent a feature unique to AHSV among the orbiviruses investigated. In this context it is noteworthy that the rotavirus nucleocapsid protein, VP6, which forms hexameric ring-like units on the surface of the inner capsid, can be purified from single-shelled rotavirus particles and assembles in vitro into hexamers, hexagonal lattices, and tubular and spherical particles depending on the pH (Ready & Sabara, 1987). Similarly, small hexagonal lattices of BTV VP7 can be observed in preparations of partially disrupted BTV core particles or core-like particles synthesized by co-expression of BTV VP3 and VP7 using a dual recombinant baculovirus (French & Roy, 1990; unpublished data). Further experiments on AHSV VP7 are required to elucidate the nature of the interactions controlling the mode of its polymerization and assembly into crystalline stuctures, as well as into single-shelled and double-shelled virus particles during AHSV morphogenesis. The ability of AHSV VP7 to form morphological structures was utilized to purify the protein by onestep sucrose gradient centrifugation; VP7 was present in one major fraction and essentially homogeneous. The availability of large amounts of homogeneous VP7 protein will facilitate crystallographic analyses.

Recombinant V P 7 o f A H S I I - 4 T h e a n t i g e n i c p r o p e r t i e s o f the purified r e c o m b i n a n t VP7 were s t u d i e d in an E L I S A using p o l y c l o n a l horse sera r e p r e s e n t i n g nine A H S V serotypes. T h e results d e m o n s t r a t e conclusively t h a t VP7 is i n d e e d a g r o u p specific a n t i g e n (Oldfield, 1990). T h e p o t e n t i a l o f this E L I S A for A H S V d i a g n o s i s was d e m o n s t r a t e d further using a p a n e l o f sera f r o m horses i m m u n i z e d w i t h a m o n o v a l e n t v a c c i n e ( a n t i - A H S V - 4 ) or a p o l y v a l e n t vaccine, as well as w i t h sera f r o m i n f e c t e d a n i m a l s ( u n p u b l i s h e d results). Since r e c o m b i n a n t VP7 c a n be o b t a i n e d in large quantities, it is c u r r e n t l y b e i n g tested in a n e p i d e m i o l o g i c a l study o f field s a m p l e s f r o m horses in Spain. The antigenic cross-reactivity between AHSV and B T V VP7 has b e e n d e m o n s t r a t e d p r e v i o u s l y in a n E L I S A using purified r e c o m b i n a n t B T V VP7 (Oldfield et HI., 1990). S i m i l a r low level c r o s s - r e a c t i v i t y is o b s e r v e d using r e c o m b i n a n t A H S V VPT. T h e r e a c t i o n s a r e easily d e t e c t a b l e by r a d i o i m m u n o p r e c i p i t a t i o n or E L I S A , b u t n o t b y W e s t e r n blot analysis. F o u r M A b s were used b o t h in W e s t e r n blot a n d r a d i o i m m u n o p r e c i p i t a t i o n analyses to study the n a t u r e o f the a n t i g e n i c d e t e r m i n a n t s s h a r e d by A H S V a n d B T V VP7. T h e results reveal the existence o f one c o n f o r m a t i o n a l a n d at least one l i n e a r a n t i g e n i c d e t e r m i n a n t c o n s e r v e d in B T V a n d A H S V . C o m p e t i t i o n studies w i t h the t h r e e a n t i - A H S V M A b s will be r e q u i r e d to d e t e r m i n e w h e t h e r t h e y are d i r e c t e d to the s a m e or different a n t i g e n i c sites. A t least t h r e e a n t i g e n i c sites h a v e so far b e e n m a p p e d on B T V VP7, o f w h i c h two a p p e a r to be l i n e a r d e t e r m i n a n t s a n d one a c o n f o r m a t i o n a l d e t e r m i n a n t (Li & Y a n g , 1990; E a t o n et al., 1991). O n e l i n e a r d e t e r m i n a n t is l o c a t e d at the C t e r m i n u s ( a m i n o a c i d residues 339 to 349), t h e o t h e r b e t w e e n residues 122 a n d 139, w h e r e a s the c o n f o r m a t i o n a l d e t e r m i n a n t is l o c a t e d n e a r the N t e r m i n u s . R e c e n t d a t a f r o m A H S V - 4 a n d B T V VP7 s e q u e n c e c o m p a r i s o n s h a v e r e v e a l e d t h a t the h i g h e s t d e g r e e o f s i m i l a r i t y lies in the N - a n d C - t e r m i n a l regions ( R o y et al., 1991). Recently, we h a v e r e p o r t e d the synthesis o f c h i m e r i c p a r t i c l e s c o n t a i n i n g E H D V - 1 VP3 a n d BTV-10 VP7 (Le Blois et HI., 1991). It will be o f interest to d e t e r m i n e w h e t h e r s i m i l a r c a p a b i l i t i e s are e x h i b i t e d b y c o m b i n a tions o f B T V a n d A H S V , a n d E H D V a n d A H S V core proteins. Such i n v e s t i g a t i o n s are in progress, specifically to localize the sites at w h i c h the p r o t e i n - p r o t e i n i n t e r a c t i o n s o c c u r w i t h i n these core c o m p o n e n t s . The advice of Professor D. H. L. Bishop is appreciated. We thank Ingenasa for the 4AH9 MAb, Dr T. Booth for the electron micrographs, Miss S. Clarke for typing the manuscript and Mr C. D. Hatton for the photography work. This work was supported partly by NIH Grant A126879 and MRC Grant G9026032CA.

931

References BROWN, M. & FAULKNER, P. (1977). A plaque assay for nuclear polyhedrosis viruses using a solid overlay. JournalofGeneral Virology 36, 361-364. EATON, B. T., GOULD, A. R., HYATT, A. D., COUPAR, B. E. H., MARTYN, J. C. & WHITE, J. R. (1991). A bluetongue serogroupreactive epitope in the amino terminal half of the major core protein VP7 is accessible on the surface of bluetongue virus particles. Virology 180, 687-696. FRENCH,T. J. & ROY, P. (1990). Synthesis of bluetongue virus (BTV) corelike particles by a recombinant baculovirus expressing the two major structural core proteins of BTV. Journal of Virology 64, 15301536. GUMM, I. D. & NEWMAN,J. F. E. (1982). The preparation of purified bluetongue virus group antigen for use as a diagnostic reagent. Archives of Virology 72, 83-93. H~aSCHLE, O. J. B. & JANG, C. (1983). Purification of the groupspecific antigen of bluetongue virus by chromatofocusing. Journal of Virological Methods 6, 171-178. HUISMANS,H. & ERASMUS,B. J. (1981). Identification of the serotypespecific and group-specific antigens of bluetongue virus. Onderstepoort Journal of Veterinary Research 48, 51-58. KH'rS, P. A., AYRES,M. D. & POSSEE,R. D. (1990). Linearization of baculovirus DNA enhances the recovery of recombinant virus expression vectors, Nucleic Acids Research 15, 5667-5672. LAEMMLI,U, K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature, London 227, 680685. LE BLOIS,H., FAYARD,B., URAKAWA,T. & ROY, P. (1991). Synthesis and characterization of chimeric particles between epizootic hemorrhagic disease virus and bluetongue virus: functional domains are conserved on the VP3 proteins. Journal of Virology 65 (in press). LI, J. K. K. & YANG,Y. Y. (1990). Mapping of two immunodominant antigenic epitopes conserved among the major inner capsid protein, VP7, of five bluetongue viruses. Virology 178, 552-559. MANIATIS, T., FRITSCH, E. F. & SAMBROOK, J. (1982). Molecular Cloning: A Laboratory Manual. New York: Cold Spring Harbor Laboratory MATSUURA,Y., POSSEE,R. D., OVERTON, H. A. & BISHOP, D. H. L. (1987). Baculovirus expression vectors: the requirements for high level expression of proteins, including glycoproteins. Journal of General Virology 68, 1233-1250. MAXAM,A. M. & GILBERT,W. (1980). Sequencing end-labeled DNA with base-specific chemical cleavages. Methods in Enzymology 65, 499-560. OELLERMANN,R. A., ELS,H. J. & ERASMUS,B. J. (1970). Characterization of african horsesickness virus. Archiv f~r die gesamte Virusforschung 29, 163-174. OLDFIELD, S., ADACHI,A., URAKAWA,T., HIRASAWA,T. & ROY, P. (1990). Purification and characterization of the major group-specific core antigen VP7 of bluetongue virus synthesized by a recombinant baculovirus. Journal of General Virology 71, 2649-2656. OVERTON,H. A., IHARA,T. & BISHOP,D. H. L. (1987). Identification of the N and NSs proteins coded by the ambisense sRNA of Punta Toro phlebovirus using monospecific antisera raised to baculovirus expressed N and NSs proteins. Virology 157, 338-350. READY, K. F. M. & SABARA,M. (1987). In vitro assembly of bovine rotavirus nucleocapsid protein. Virology 157, 189-198. RoY, P., HIRASAWA,T., FERNANDEZ,i . , BLINOV,V. M. & SANCHEZVIXCAINRODRIQUE, J. M. (1991). The complete sequence of the group-specific antigen, VP7, of African horsesickness disease virus serotype 4 reveals a close relationship to bluetongue virus. Journal of General Virology 72, 1237-1241. (Received 28 August 1991; Accepted 9 December 1991)