Appl Biochem Biotechnol (2014) 173:239–247 DOI 10.1007/s12010-014-0837-y
Expression of the Key Genes Involved in ABA Biosynthesis in Rice Implanted by Ion Beam Q. F. Chen & H. Y. Ya & Y. R. Feng & Z. Jiao Received: 19 August 2013 / Accepted: 25 February 2014 / Published online: 16 March 2014 # Springer Science+Business Media New York 2014
Abstract The plant hormone abscisic acid (ABA) plays a central role in adaptive stress responses to abiotic environments, but little information exists about its responses to implantation with low-energy ion beams. The genes related to ABA synthesis including zeaxanthin epoxidase(ZEP), 9-cis-epoxycarotenoid dioxygenase (NCED), abscisic aldehyde oxidase (AAO), short-chain dehydrogenase/reductase-like(SDR), and cytochrome P450 in rice seedlings germinating from seeds implanted by ion beam for 72, 96, and 120 h after imbibitions (HAI) were determined by real-time PCR. Moreover, we also explored the changes of endogenous ABA content in rice seedlings after 48, 72, 96, 120, and 144 h after imbibitions using enzyme-linked immunosorbent assay (ELISA). The results showed that ion beam implantation could enhance the genes’ transcription activity which was involved in ABA biosynthesis. However, the response of each gene is not consistent with the underlying differences in ion flux. The obviously up-regulated expression of ZEP, AAO2, SDR, and P450-2 were observed underlying the behaviour at an ion flux of 1×1017 N+/cm2. However, the expression of NCED, AAO1, and SDR2 can be enhanced by 5×1017 N+/cm2. The expression of AAO3, SDR1, and P450-1 can be elevated underlying the both ion flux of 1× 1017 N+/cm2 and 5×1017 N+/cm2. The expression of SDR3 can be enhanced in every ion flux. The results of ELISA showed that endogenous ABA level in rice seedlings increased at treatment with vacuum, 1×1017 and 5×1017 N+/cm2. Collectively, ion beam irritation can enhance the expression of genes involved in ABA biosynthesis, resulting in increasing content of endogenous ABA in rice. Our findings suggest that ABA pathway was involved in the adaption to irradiation with ion beam in plants. Keywords Ion beam implantation . ABA biosynthesis . Gene expression
Introduction In the mid-1980s, Zengliang and his colleagues found that the leaves of an ion beam-implanted rice appeared yellow stripes, like carrying the “Apollo” corn. The idea that applying ion Q. F. Chen : H. Y. Ya : Y. R. Feng : Z. Jiao (*) Henan Provincial Key Laboratory of Ion Beam Bio-engineering, Zhengzhou University, Zhengzhou, Henan 450052, People’s Republic of China e-mail: [email protected] H. Y. Ya College of Life Sciences Luoyang, Normal University, Luoyang, Henan 471022, People’s Republic of China
240
Appl Biochem Biotechnol (2014) 173:239–247
implantation techniques to change the characteristic of an organism and achieve an effective genetic improvement was thus put forward. Since then, the ion beam, as a new mutagen, has received progressively more attentions. Additionally, ion implantation mutation, integrating the factors of mass, energy, and charge, can induce biological molecules damaged and induce atoms displaced, recombined, and compounded. In the past three decades, ion implantation, as a new tool for genetic modification, has been applied to breeding of crops and microbes [1–5]. As a new resource of mutagens, low-energy ion beam implantation is characterized as limited physiological damages, wide mutation spectrum, and high mutation frequency in comparison with other mutagenicity methods [6]. The mechanism of the bio-effects of ion beam implantation on cereal seeds, such as rice (Oryza sativa), wheat (Triticum aestivum), and soybean et al., has been substantiated by many studies in the past 30 years. At an appropriate amount of energy into an organism, a process including ion mass deposition, energy deposition, and charge exchange take place [7]. Most of those studies focus physical factors on the biological effect. The implanted ions can reach nuclei theoretically and cause damages in DNA molecule, thus inducing mutations when the DNA repair fails [8]. There are also some studies focused on the cellular and molecular levels on the mechanism of the bio-effects. Cytological analysis indicated that ion beams were effective in producing chromosome aberrations [8]. The implanted ions can also lead to genetic effects such as base substitutions or deletions and insertions of a single base or a small DNA fragment [7, 9]. As an important phytohormone, abscisic acid (ABA) plays a critical role in regulating numerous developmental stages, such as seed maturation and dormancy. In addition, ABA plays a central role in adaptive stress responses to abiotic environment including drought, high salinity, and low temperature in a plant [10, 11]. Thus, ABA can be considered to be a stressresistant phytohormone. Ion beam implantation is a kind of stress. The content variation of ABA in seedlings germinating from the seeds implanted by the ion beam reflects the stress resistance of a plant [12]. It remains elusive whether ABA signalling pathway is involved in the plant response to ion beam stress. In order to confirm this speculation, we studied the expression of the key genes involved in ABA biosynthesis in rice implanted by the ion beam. Furthermore, endogenous ABA levels in rice seedlings germinating from the seeds implanted by the ion beam were detected. The results of this paper will be more important for understanding the molecular mechanism of the bio-effects of ion beam radiation on cereal seeds.
Materials and Methods Plant Materials Seeds of rice variety Xindao-10 (Oryza sativa L. ssp. Japonica), as the wild type for the nitrogen ion beam implantation, were offered by the XinXiang Academy of Agricultural Sciences. The implanted seeds were planted in a greenhouse at 25 °C after ion implantation. After the seeds had been incubated for 48 h, the seedlings were collected every 24 h and divided into two groups, namely one group was used in the investigation of the ABA level, and the other group was used for the RNA isolation. Ion Implantation The nitrogen ion implantation was performed on TITAN ion machine (UIL.0.512, TNV. Russia). Dry seeds were irradiated by a nitrogen ion beam with three influxes: 1×1017, 3× 1017, and 5×1017 N+/cm2. Energy was 30 KeV. Three replications were done under each ion
Appl Biochem Biotechnol (2014) 173:239–247
241
flux, two hundred seeds were implanted in each replicates, while two hundred of vacuum treated seeds and no-implanted seeds served as control. RNA Extraction Total RNA was purified from uniform seedlings in each replicate using Trizol reagent (Invitrogen) and treated with RNase-free DNase I (Promega). The DNase-digested RNA samples were stored at −70 °C and used for reverse transcription by M-MLV reverse transcriptase (Promega) according to the supplier’s instruction. Quantitative Reverse Transcription PCR for Genes Real-time quantitative reverse transcription polymerase chain reaction assay (qRT-PCR) was conducted using the cDNA samples derived from rice seedlings. The expression analysis of genes was performed with SYBR Premix ExTaq (TaKaRa Biotechnology Co. Ltd, Product Code: DRR041A), and experiments were performed according to the manufacturer’s instructions. The primers used in the assay are shown in Table 1, which were designed based on the corresponding genes’ coding sequences in this work. Three replications were performed in order to determine the mean and standard deviation of the expression level. The relative qualification 2−ΔΔCT method [13] was used to calculate genes’ expression levels. The amplification of rice tubulin transcripts was used as an internal standard control for the quantitative RT-PCR assay. ABA Level Assay ABA was extracted and purified according to Wu et al. [14]. The endogenous ABA level of rice seedlings was measured by enzyme-linked immunosorbent assay (ELISA) kits (AGDIA Biotechnology Co Ltd.). The percentage of binding was calculated according to the formula % Binding ¼ ðStandard or Sample O:D:−NSB O:D:Þ 100=ðBo O:D:−NSB O:D:Þ: The Logit was calculated according to the formula Logit ðB=Bo Þ ¼ Ln ½% Binding=ð100 −ð% BindingÞÞ ABA content was calculated according to the formula ½Sample Concentration ¼ e Logit −ððy −intercept
ð=slopeÞ
Results Expression Profile of Genes Related to ABA Biosyntheses Pathway in Rice Seedlings The induced transcription raise of genes related to ABA syntheses, including NCED, ZEP, AAO, SDR, P450, etc. in rice seedlings from the seeds implanted by N+ beam, was observed by qRT-PCR assay (Fig. 1). Especially, the transcription raise of NCED as a key enzyme in ABA biosynthesis could increase the ABA content in rice seedling, sequentially strengthening the radiation tolerance of rice seedlings. The transcript level of NCED was highest at a dose of
242
Appl Biochem Biotechnol (2014) 173:239–247
Table 1 Primers used in real-time PCR experiments Gene symbol LOC_Os07g18154
Primers
Sequence(5’-3’)
Target
AAO1 F
TTCGCCATTTGTTCGTAA
AAO1
AAO1 R
CAGAGGAGGTTGCTCAAG
AAO1
LOC_Os07g18158
AAO2 F
CCCTTGACGCCAACACTG
AAO2
LOC_Os07g07050
AAO2 R AAO3 F
CCGCTTTCGCCACTTATT CGCCTGGTAAAGTGTCTA
AAO2 AAO3
AAO3 R
AATTGCTCCTTGAGTGGT
AAO3
NCED F
CACTCCCTTCTCATTCCC
NCED
NCED R
AGCCCTTGTTCAGGTTAA
NCED
SDR1 F
TGACAGCCAGGGACGAGA
SDR1
SDR1 R
TCAGCCAACCGAGAAACG
SDR1
LOC_Os04g45000
SDR2 F
CGCCCAAGGAGTAGATAACA
SDR2
LOC_Os07g48640
SDR2 R SDR3 F
GACAGCAGCAGAGGCAGTAA TAGCCATCTTCGCCACC
SDR2 SDR3
LOC_Os12g24800 LOC_Os04g4492
SDR3 R
GCAAAGGGACTCAACAGC
SDR3
LOC_Os04g37619
ZEP F
ATAGATGATGGCAACAAGGTAA ATAGAT GATGGCAACAAGGTAA
ZEP
LOC_Os01g50520
ZEP R P450-1 F
TCAATGTCAGGAGGCACAA ACTTGTACGAGCCATACTGGA
ZEP P450-1
P450-1 R
TGAGGGCATACTTCGGTTA
P450-1
P450-2 F
GTGGGTTTCCTGGTGGTAG
P450-2
P450-2 R
GTGAGGGCATACTTCGGTTA
P450-2
LOC_Os09g26950
Fig. 1 The transcript level of NCED was elevated by ion beam implantation. The transcript level of NCED in the ion flux of 5×1017 N+/cm2 was 21 times greater than the control, intermediate in an ion flux of 3×1017 N+/cm2, and relatively low in an ion flux of 3×1017 N+/cm2. The analysis by qRT-PCR revealed that the transcript level of NCED was elevated more dramatically by a higher ion flux beam implantation. z, vacuum treatment; 1, 1× 1017 N+/cm2 treatment; 3, 3×1017 N+/cm2 treatment; 5, 5×1017 N+/cm2 treatment
Appl Biochem Biotechnol (2014) 173:239–247
243
5×1017 N+/cm2 and was 21 times greater than the control (Fig. 1). Analysis by qRT-PCR revealed that the transcript level of NCED was elevated more dramatically by a higher dose ion beam implantation. For ZEP, its transcripts decreased significantly from 72 HAI to 96 HAI, then increased with increasing imbibition time (Fig. 2) in different ion beam-treated seeds’ seedlings. ZEP transcripts reached their highest levels in seedlings from seeds treated at 1×1017 N+/cm2 at 120 HAI, which was 10.7 times greater than the control. However, ZEP transcripts remained at a lower level than control at 96 HAI. The expression profiles of AAO1 under different ion beam treatments differed (Fig. 3a). The highest transcript occurred at a dose of 5×1017 N+/cm2 at 72 HAI. But for AAO2, a dose of 1× 1017 N+/cm2 could significantly enhance the AAO2 transcript level at 96 HAI (Fig. 3b). The highest transcript of AAO3 appeared at a dose of 1×1017 N+/cm2 at 96 HAI and 5×1017 N+/ cm2 at 72 HAI (Fig. 3c). The highest transcript levels of SDR1 appeared at 72 HAI at a dose of 5×1017 N+/cm2 (Fig. 4a) and higher at a dose of 1×1017 N+/cm2 at 96 HAI. For SDR2, only 5×1017 N+/cm2 could significantly enhance the transcription (Fig. 4b). The expression profiles of SDR3 under different ion beam treatments similarly increased at 72 HAI then decreased at 96 HAI then increased at 120 HAI (Fig. 4c). The transcript levels of P450 at a dose of 1×1017 N+/cm2 at 96 HAI and at 5×1017 N+/cm2 at 72 HAI were higher than the control (Fig. 5). Altered ABA Content in Rice Seedlings We quantified the ABA content in rice seedlings that might be affected by ion beam implantation. Consistent with our expectations, ABA contents vary widely among the different treatments in this work. ABA contents were substantially increased in vacuum seedlings compared with control, which was 12.6 times greater than the control at 6 days (Fig. 6). An ion flux of 5×1017 N+/cm2 could increase ABA content rapidly (Fig. 6), and there were two processes involved therein. In the lower ion flux of 1×1017 N+/cm2, the ABA content subsequently increased to reach its highest level at 120 HAI (Fig. 6). The ABA content
Fig. 2 ZEP transcripts reached highest levels in the seedlings from seeds treated by an ion flux of 1×1017 N+/ cm2 at 120 HAI, which was 10.7 times greater than the control. Z, vacuum treatment; 1, 1×1017 N+/cm2 treatment; 3, 3×1017 N+/cm2 treatment; 5, 5×1017 N+/cm2 treatment
244
Appl Biochem Biotechnol (2014) 173:239–247
Fig. 3 AAO1 transcripts decreased from 72 HAI to 96 HAI then increased at 120 HAI in every ion flux ion beam implantation The highest transcript was in an ion flux of 5×1017 N+/cm2 at 72 HAI. An ion flux of 3×1017 N+/ cm2 could significantly enhance the AAO2 transcript level at 96 HAI. There were slight increases in the AAO3 transcript level from 72 HAI to 96 HAI then decreases at 120 HAI under vacuum treatment. Furthermore, the transcript level of AAO3 increased significantly at 1×1017 and 5×1017 N+/cm2 at 96 HAI and 72 HAI, respectively. Z, vacuum treatment; 1, 1×1017 N+/cm2 treatment; 3, 3×1017 N+/cm2 treatment; 5, 5×1017 N+/ cm2 treatment. a, AAO1; b, AAO2; c, AAO3
increased at 96 HAI under an ion flux of 3×1017 N+/cm2; however, it was not significantly different from that of the control. The data demonstrated that lower and higher ion flux ion beams could increase ABA content more effectively.
Discussion Ion beam irradiation is a type of abiotic stress whose stimulation effects during implantation have been discovered by previous researchers [15]. The effect can be produced by sputtering and digging effects on seed capsules caused by ion momentum, which leave multiple perforations and channels, which can help seeds to absorb water and oxygen during germination [16]. Moreover, it may also be because of the stimulation effect that the plant retrotransposons could be transcriptionally activated by ion beam irradiation [17]. However, there is a paucity of knowledge about the molecular mechanism of the stimulation effects of ion beam implantation. ABA is a phytohormone that plays critical roles in adaptive responses to stresses such as drought and high salinity [12]. Some studies indicated that ion beam
Fig. 4 The highest transcript levels of SDR1 appeared at 72 HAI in an ion flux of 5×1017 N+/cm2 (a). The transcript levels of SDR1 increased at 96 HAI under vacuum and other ion flux treatments and were higher in an ion flux of 1×1017 N+/cm2 than the treatment. The higher and lower ion fluxes could both elevate SDR1 transcripts, but the enhancement effect appeared later under the lower ion flux treatment. For SDR2 (b), only 5× 1017 N+/cm2 could significantly enhance the transcription. The expression profiles of SDR3 under different ion beam treatments similarly increased at 72 HAI, decreased at 96 HAI, then increased at 120 HAI (c). Z, vacuum treatment; 1, 1×1017 N+/cm2 treatment; 3, 3×1017 N+/cm2 treatment; 5, 5×1017 N+/cm2 treatment. a SDR1, b SDR2, c SDR3
Appl Biochem Biotechnol (2014) 173:239–247
245
Fig. 5 P450 transcript levels were increased and then decreased under vacuum and 1×1017 N+/cm2 treatment. The highest transcript levels of P450 appeared at 96 HAI in an ion flux of 1×1017 N+/cm2, while the highest transcript level of P450 appeared at 72 HAI in an ion flux of 3×1017 and 5×1017 N+/cm2. The P450 transcript was found to be more abundant under 1×1017 and 5×1017 N+/cm2 than under 3×1017 N+/cm2. Z, vacuum treatment; 1, 1×1017 N+/cm2 treatment; 3, 3×1017 N+/cm2 treatment; 5, 5×1017 N+/cm2 treatment. a P450-1, b P450-2
implantation rice seeds showed this stimulation effect, meanwhile, ABA signal genes are differentially expressed in rice seedlings [12]. The ABA level rose in liquorice seedlings treated by ion beam implantation at a particular ion flux when they were subjected to drought conditions [16]. This showed that an ABA signal network is involved in the response of the rice to ion beam irradiation stress. Therefore, it is important to study the mechanism of ABA signal pathways for a response to ion beam irradiation stress. These results will shed light on the mechanism of the stimulation effects of ion beam implantation. Before this work, little was known about the relationship between ion beam implantation and endogenous hormone ABA gene expression. In this research, the regulation of the key genes’ expression involved in ABA biosynthesis in rice implanted by ion beam was studied. The results showed that the transcriptional activity of NCED, AAO1, and SDR2 were higher in rice seedlings treated by a beam with an ion flux of 3×1017 and 5×1017 N+/cm2 than those treated by a beam with an ion flux of 1×1017 N+/cm2. However, 1×1017 N+/cm2 ion flux ion beam implantation could enhance the expression level of ZEP, AAO2, and P450-2. Then, 1× 1017 and 5×1017 N+/cm2 ion flux ion beam implantations can both enhance the expression level of AAO3, SDR1, and P450-1. According to germination rate and simplified vigour index, 1×1017 and 5×1017 N+/cm2 ion flux ion beam implantations damaged embryonic rice, while
Fig. 6 Effect of N+ ion beam implantation on ABA level of rice seedlings. c, control; z, vacuum treatment; 1, 1× 1017 N+/cm2 treatment; 3, 3×1017 N+/cm2 treatment; 5, 5×1017 N+/cm2 treatment
246
Appl Biochem Biotechnol (2014) 173:239–247
the damage was less severe at an ion flux of 3×1017 N+/cm2 [12]. Nevertheless, the time of ABA biosynthesis genetic up-regulation at 1×1017 N+/cm2 lagged behind that at 3×1017 and 5×1017 N+/cm2 ion flux. This implied that the higher ion flux ion beam implantation groups had stronger stress signals for embryo rice than those subjected to lower ion fluxes, so it could more quickly up-regulate the genetic transcription activity. However, the expression pattern of SDR3 was special as it was obviously up-regulated at all ion flux ion beam implantation groups, yet the effect appeared later at an ion flux of 3×1017 N+/cm2. Although previous studies showed that the ZEP gene was not regulated by abiotic stress [18], this study showed that the transcription level in rice seedlings was enhanced by ion beam implantation. ABA biosynthesis is induced by drought and salt stresses, then the ABA can activate ABA synthesis by a positive feedback mechanism and enhance the resistance of the plant to environmental stress [19]. ABA signalling transduction pathways induce stomatal closure during adaptive plant responses to drought, inhibiting or decreasing their ethylene biosynthesis and enhancing the cell resistance against dehydration stress by activating the ABA-dependent, or ABA-independent, gene expression pathways [19]. In this work, endogenesis ABA content increased in rice seedlings treated by different ion flux ion beams. This implied that there were continuous stress effects induced by ion beam irradiation, and this stress enhanced ABA biosynthesis when subjected thereto. The increasing contents of endogenesis ABA in the cells can promote the expression of the genes responding to stresses. ABA acted as a signal molecule by transduction among the different tissues, which can also promote the stress-response systems. It is therefore important for plants as they adapt to environmental stress. The genes involved in ABA biosynthesis were up-regulated by ion beam implantation and then enhanced ABA biosynthesis. It is speculated that ABA was involved in the response to resistance against ion beam irradiation stress. These results provide new information about the molecular mechanisms of biological effects induced by ion beam irradiation. Acknowledgements This work was supported by the Key Technology Projects of Henan Province (#10210110108), the Foundation and Cutting-edge Technology Projects of Henan Departance of Science and Technology (#132300410122), and the National Natural Science Fund of China (#30800204 and U1204307).
References 1. Yu, Z. L., Yu, L. D., Vilaithong, T., & Brown I. (2006). Springer Science and Business Media Inc., New York. 2. Mo, H. L., Yu, S. B., Deng, G. F., Qin, G., & Liang, G. F. (1999). Guangxi Agricultural Sciences, 36, 103– 105 (in Chinese). 3. Wu, Y. J., Zhang, Y., Wu, J. D., Tong, J. P., Li, H., Deng, L. Y., et al. (2005). Plasma Science & Technology, 2, 2783–2788. 4. Zhao, L. Z., Wang, H. H., Wang, Y., Li, Y. M., Zhen, D. S., & Jie, H. M. (2006). Acta Agricultural Borealioccidentalis Sinica, 15, 17–19 (in Chinese). 5. Wang, X. Q., Yao, J. M., Yuan, C. L., Wang, J., & Yu, Z. L. (2002). Plasma Science & Technology, 5, 1505–1510. 6. Zheng, X. X., Wu, B. S., & Lu, J. (2006). Nuclear Techniques, 29, 111–115. 7. Yu, Z. L. (2008). IEEE Transactions on Plasma Science, 28, 128–132. 8. Wu, L. F., & Yu, Z. L. (2001). Radiation and Environmental Biophysics, 40, 53–57. 9. Li, K., Nie, Y. L., Zhang, D. Z., Zhang, J., & Zhang, G. F. (2007). IEEE transactions on Plasma Science, 35, 454–459. 10. Cutler, S. R., Rodriguez, P. L., Finkelstein, R. R., & Abrams, S. R. (2010). Annual Review of Plant Biology, 61, 651–679.
Appl Biochem Biotechnol (2014) 173:239–247
247
11. Umezawa, T., Nakashima, K., Miyakawa, T., Kuromori, T., Tanokura, M., Shinozaki, K., et al. (2010). Plant Cell Physiology, 51, 1821–1839. 12. Ya, H. Y., Chen, Q. F., Wang, W. D., Chen, W. G., Qin, G. Y., & Jiao, Z. (2012). Journal of Radiation Research, 53, 558–569. 13. Livak, K. J., & Schmittgen, T. D. (2001). Methods, 25, 402–408. 14. Wu, S. R., Chen, W. F., & Zhou, X. (1988). Plant Physiology Communications, 6, 51–56 (in Chinese). 15. Li, Y. F., Liang, Y. Z., & Yu, Z. L. (2006). Practaculture Science, 23, 13–17 (in Chinese). 16. Zhang, X. S., Wu, L. J., Yu, L. X., Wei, S. L., Liu, J. N., & Yu, Z. L. (2007). Plasma Science and Technology, 2, 135–240. 17. Ya, H. Y., Gu, Y. H., & Jiao, Z. (2007). Journal of Plant Physiology and Molecular Biology, 33, 507–516. 18. Tuteja, N. (2007). Plant Signaling & Behavior, 2, 135–138. 19. Zhang, J. H., Jia, W. S., Yang, J. C., & Ismail, A. M. (2006). Field Crops Research, 97, 111–119.
Expression of the Key Genes Involved in ABA Biosynthesis in Rice Implanted by Ion Beam Q. F. Chen & H. Y. Ya & Y. R. Feng & Z. Jiao Received: 19 August 2013 / Accepted: 25 February 2014 / Published online: 16 March 2014 # Springer Science+Business Media New York 2014
Abstract The plant hormone abscisic acid (ABA) plays a central role in adaptive stress responses to abiotic environments, but little information exists about its responses to implantation with low-energy ion beams. The genes related to ABA synthesis including zeaxanthin epoxidase(ZEP), 9-cis-epoxycarotenoid dioxygenase (NCED), abscisic aldehyde oxidase (AAO), short-chain dehydrogenase/reductase-like(SDR), and cytochrome P450 in rice seedlings germinating from seeds implanted by ion beam for 72, 96, and 120 h after imbibitions (HAI) were determined by real-time PCR. Moreover, we also explored the changes of endogenous ABA content in rice seedlings after 48, 72, 96, 120, and 144 h after imbibitions using enzyme-linked immunosorbent assay (ELISA). The results showed that ion beam implantation could enhance the genes’ transcription activity which was involved in ABA biosynthesis. However, the response of each gene is not consistent with the underlying differences in ion flux. The obviously up-regulated expression of ZEP, AAO2, SDR, and P450-2 were observed underlying the behaviour at an ion flux of 1×1017 N+/cm2. However, the expression of NCED, AAO1, and SDR2 can be enhanced by 5×1017 N+/cm2. The expression of AAO3, SDR1, and P450-1 can be elevated underlying the both ion flux of 1× 1017 N+/cm2 and 5×1017 N+/cm2. The expression of SDR3 can be enhanced in every ion flux. The results of ELISA showed that endogenous ABA level in rice seedlings increased at treatment with vacuum, 1×1017 and 5×1017 N+/cm2. Collectively, ion beam irritation can enhance the expression of genes involved in ABA biosynthesis, resulting in increasing content of endogenous ABA in rice. Our findings suggest that ABA pathway was involved in the adaption to irradiation with ion beam in plants. Keywords Ion beam implantation . ABA biosynthesis . Gene expression
Introduction In the mid-1980s, Zengliang and his colleagues found that the leaves of an ion beam-implanted rice appeared yellow stripes, like carrying the “Apollo” corn. The idea that applying ion Q. F. Chen : H. Y. Ya : Y. R. Feng : Z. Jiao (*) Henan Provincial Key Laboratory of Ion Beam Bio-engineering, Zhengzhou University, Zhengzhou, Henan 450052, People’s Republic of China e-mail: [email protected] H. Y. Ya College of Life Sciences Luoyang, Normal University, Luoyang, Henan 471022, People’s Republic of China
240
Appl Biochem Biotechnol (2014) 173:239–247
implantation techniques to change the characteristic of an organism and achieve an effective genetic improvement was thus put forward. Since then, the ion beam, as a new mutagen, has received progressively more attentions. Additionally, ion implantation mutation, integrating the factors of mass, energy, and charge, can induce biological molecules damaged and induce atoms displaced, recombined, and compounded. In the past three decades, ion implantation, as a new tool for genetic modification, has been applied to breeding of crops and microbes [1–5]. As a new resource of mutagens, low-energy ion beam implantation is characterized as limited physiological damages, wide mutation spectrum, and high mutation frequency in comparison with other mutagenicity methods [6]. The mechanism of the bio-effects of ion beam implantation on cereal seeds, such as rice (Oryza sativa), wheat (Triticum aestivum), and soybean et al., has been substantiated by many studies in the past 30 years. At an appropriate amount of energy into an organism, a process including ion mass deposition, energy deposition, and charge exchange take place [7]. Most of those studies focus physical factors on the biological effect. The implanted ions can reach nuclei theoretically and cause damages in DNA molecule, thus inducing mutations when the DNA repair fails [8]. There are also some studies focused on the cellular and molecular levels on the mechanism of the bio-effects. Cytological analysis indicated that ion beams were effective in producing chromosome aberrations [8]. The implanted ions can also lead to genetic effects such as base substitutions or deletions and insertions of a single base or a small DNA fragment [7, 9]. As an important phytohormone, abscisic acid (ABA) plays a critical role in regulating numerous developmental stages, such as seed maturation and dormancy. In addition, ABA plays a central role in adaptive stress responses to abiotic environment including drought, high salinity, and low temperature in a plant [10, 11]. Thus, ABA can be considered to be a stressresistant phytohormone. Ion beam implantation is a kind of stress. The content variation of ABA in seedlings germinating from the seeds implanted by the ion beam reflects the stress resistance of a plant [12]. It remains elusive whether ABA signalling pathway is involved in the plant response to ion beam stress. In order to confirm this speculation, we studied the expression of the key genes involved in ABA biosynthesis in rice implanted by the ion beam. Furthermore, endogenous ABA levels in rice seedlings germinating from the seeds implanted by the ion beam were detected. The results of this paper will be more important for understanding the molecular mechanism of the bio-effects of ion beam radiation on cereal seeds.
Materials and Methods Plant Materials Seeds of rice variety Xindao-10 (Oryza sativa L. ssp. Japonica), as the wild type for the nitrogen ion beam implantation, were offered by the XinXiang Academy of Agricultural Sciences. The implanted seeds were planted in a greenhouse at 25 °C after ion implantation. After the seeds had been incubated for 48 h, the seedlings were collected every 24 h and divided into two groups, namely one group was used in the investigation of the ABA level, and the other group was used for the RNA isolation. Ion Implantation The nitrogen ion implantation was performed on TITAN ion machine (UIL.0.512, TNV. Russia). Dry seeds were irradiated by a nitrogen ion beam with three influxes: 1×1017, 3× 1017, and 5×1017 N+/cm2. Energy was 30 KeV. Three replications were done under each ion
Appl Biochem Biotechnol (2014) 173:239–247
241
flux, two hundred seeds were implanted in each replicates, while two hundred of vacuum treated seeds and no-implanted seeds served as control. RNA Extraction Total RNA was purified from uniform seedlings in each replicate using Trizol reagent (Invitrogen) and treated with RNase-free DNase I (Promega). The DNase-digested RNA samples were stored at −70 °C and used for reverse transcription by M-MLV reverse transcriptase (Promega) according to the supplier’s instruction. Quantitative Reverse Transcription PCR for Genes Real-time quantitative reverse transcription polymerase chain reaction assay (qRT-PCR) was conducted using the cDNA samples derived from rice seedlings. The expression analysis of genes was performed with SYBR Premix ExTaq (TaKaRa Biotechnology Co. Ltd, Product Code: DRR041A), and experiments were performed according to the manufacturer’s instructions. The primers used in the assay are shown in Table 1, which were designed based on the corresponding genes’ coding sequences in this work. Three replications were performed in order to determine the mean and standard deviation of the expression level. The relative qualification 2−ΔΔCT method [13] was used to calculate genes’ expression levels. The amplification of rice tubulin transcripts was used as an internal standard control for the quantitative RT-PCR assay. ABA Level Assay ABA was extracted and purified according to Wu et al. [14]. The endogenous ABA level of rice seedlings was measured by enzyme-linked immunosorbent assay (ELISA) kits (AGDIA Biotechnology Co Ltd.). The percentage of binding was calculated according to the formula % Binding ¼ ðStandard or Sample O:D:−NSB O:D:Þ 100=ðBo O:D:−NSB O:D:Þ: The Logit was calculated according to the formula Logit ðB=Bo Þ ¼ Ln ½% Binding=ð100 −ð% BindingÞÞ ABA content was calculated according to the formula ½Sample Concentration ¼ e Logit −ððy −intercept
ð=slopeÞ
Results Expression Profile of Genes Related to ABA Biosyntheses Pathway in Rice Seedlings The induced transcription raise of genes related to ABA syntheses, including NCED, ZEP, AAO, SDR, P450, etc. in rice seedlings from the seeds implanted by N+ beam, was observed by qRT-PCR assay (Fig. 1). Especially, the transcription raise of NCED as a key enzyme in ABA biosynthesis could increase the ABA content in rice seedling, sequentially strengthening the radiation tolerance of rice seedlings. The transcript level of NCED was highest at a dose of
242
Appl Biochem Biotechnol (2014) 173:239–247
Table 1 Primers used in real-time PCR experiments Gene symbol LOC_Os07g18154
Primers
Sequence(5’-3’)
Target
AAO1 F
TTCGCCATTTGTTCGTAA
AAO1
AAO1 R
CAGAGGAGGTTGCTCAAG
AAO1
LOC_Os07g18158
AAO2 F
CCCTTGACGCCAACACTG
AAO2
LOC_Os07g07050
AAO2 R AAO3 F
CCGCTTTCGCCACTTATT CGCCTGGTAAAGTGTCTA
AAO2 AAO3
AAO3 R
AATTGCTCCTTGAGTGGT
AAO3
NCED F
CACTCCCTTCTCATTCCC
NCED
NCED R
AGCCCTTGTTCAGGTTAA
NCED
SDR1 F
TGACAGCCAGGGACGAGA
SDR1
SDR1 R
TCAGCCAACCGAGAAACG
SDR1
LOC_Os04g45000
SDR2 F
CGCCCAAGGAGTAGATAACA
SDR2
LOC_Os07g48640
SDR2 R SDR3 F
GACAGCAGCAGAGGCAGTAA TAGCCATCTTCGCCACC
SDR2 SDR3
LOC_Os12g24800 LOC_Os04g4492
SDR3 R
GCAAAGGGACTCAACAGC
SDR3
LOC_Os04g37619
ZEP F
ATAGATGATGGCAACAAGGTAA ATAGAT GATGGCAACAAGGTAA
ZEP
LOC_Os01g50520
ZEP R P450-1 F
TCAATGTCAGGAGGCACAA ACTTGTACGAGCCATACTGGA
ZEP P450-1
P450-1 R
TGAGGGCATACTTCGGTTA
P450-1
P450-2 F
GTGGGTTTCCTGGTGGTAG
P450-2
P450-2 R
GTGAGGGCATACTTCGGTTA
P450-2
LOC_Os09g26950
Fig. 1 The transcript level of NCED was elevated by ion beam implantation. The transcript level of NCED in the ion flux of 5×1017 N+/cm2 was 21 times greater than the control, intermediate in an ion flux of 3×1017 N+/cm2, and relatively low in an ion flux of 3×1017 N+/cm2. The analysis by qRT-PCR revealed that the transcript level of NCED was elevated more dramatically by a higher ion flux beam implantation. z, vacuum treatment; 1, 1× 1017 N+/cm2 treatment; 3, 3×1017 N+/cm2 treatment; 5, 5×1017 N+/cm2 treatment
Appl Biochem Biotechnol (2014) 173:239–247
243
5×1017 N+/cm2 and was 21 times greater than the control (Fig. 1). Analysis by qRT-PCR revealed that the transcript level of NCED was elevated more dramatically by a higher dose ion beam implantation. For ZEP, its transcripts decreased significantly from 72 HAI to 96 HAI, then increased with increasing imbibition time (Fig. 2) in different ion beam-treated seeds’ seedlings. ZEP transcripts reached their highest levels in seedlings from seeds treated at 1×1017 N+/cm2 at 120 HAI, which was 10.7 times greater than the control. However, ZEP transcripts remained at a lower level than control at 96 HAI. The expression profiles of AAO1 under different ion beam treatments differed (Fig. 3a). The highest transcript occurred at a dose of 5×1017 N+/cm2 at 72 HAI. But for AAO2, a dose of 1× 1017 N+/cm2 could significantly enhance the AAO2 transcript level at 96 HAI (Fig. 3b). The highest transcript of AAO3 appeared at a dose of 1×1017 N+/cm2 at 96 HAI and 5×1017 N+/ cm2 at 72 HAI (Fig. 3c). The highest transcript levels of SDR1 appeared at 72 HAI at a dose of 5×1017 N+/cm2 (Fig. 4a) and higher at a dose of 1×1017 N+/cm2 at 96 HAI. For SDR2, only 5×1017 N+/cm2 could significantly enhance the transcription (Fig. 4b). The expression profiles of SDR3 under different ion beam treatments similarly increased at 72 HAI then decreased at 96 HAI then increased at 120 HAI (Fig. 4c). The transcript levels of P450 at a dose of 1×1017 N+/cm2 at 96 HAI and at 5×1017 N+/cm2 at 72 HAI were higher than the control (Fig. 5). Altered ABA Content in Rice Seedlings We quantified the ABA content in rice seedlings that might be affected by ion beam implantation. Consistent with our expectations, ABA contents vary widely among the different treatments in this work. ABA contents were substantially increased in vacuum seedlings compared with control, which was 12.6 times greater than the control at 6 days (Fig. 6). An ion flux of 5×1017 N+/cm2 could increase ABA content rapidly (Fig. 6), and there were two processes involved therein. In the lower ion flux of 1×1017 N+/cm2, the ABA content subsequently increased to reach its highest level at 120 HAI (Fig. 6). The ABA content
Fig. 2 ZEP transcripts reached highest levels in the seedlings from seeds treated by an ion flux of 1×1017 N+/ cm2 at 120 HAI, which was 10.7 times greater than the control. Z, vacuum treatment; 1, 1×1017 N+/cm2 treatment; 3, 3×1017 N+/cm2 treatment; 5, 5×1017 N+/cm2 treatment
244
Appl Biochem Biotechnol (2014) 173:239–247
Fig. 3 AAO1 transcripts decreased from 72 HAI to 96 HAI then increased at 120 HAI in every ion flux ion beam implantation The highest transcript was in an ion flux of 5×1017 N+/cm2 at 72 HAI. An ion flux of 3×1017 N+/ cm2 could significantly enhance the AAO2 transcript level at 96 HAI. There were slight increases in the AAO3 transcript level from 72 HAI to 96 HAI then decreases at 120 HAI under vacuum treatment. Furthermore, the transcript level of AAO3 increased significantly at 1×1017 and 5×1017 N+/cm2 at 96 HAI and 72 HAI, respectively. Z, vacuum treatment; 1, 1×1017 N+/cm2 treatment; 3, 3×1017 N+/cm2 treatment; 5, 5×1017 N+/ cm2 treatment. a, AAO1; b, AAO2; c, AAO3
increased at 96 HAI under an ion flux of 3×1017 N+/cm2; however, it was not significantly different from that of the control. The data demonstrated that lower and higher ion flux ion beams could increase ABA content more effectively.
Discussion Ion beam irradiation is a type of abiotic stress whose stimulation effects during implantation have been discovered by previous researchers [15]. The effect can be produced by sputtering and digging effects on seed capsules caused by ion momentum, which leave multiple perforations and channels, which can help seeds to absorb water and oxygen during germination [16]. Moreover, it may also be because of the stimulation effect that the plant retrotransposons could be transcriptionally activated by ion beam irradiation [17]. However, there is a paucity of knowledge about the molecular mechanism of the stimulation effects of ion beam implantation. ABA is a phytohormone that plays critical roles in adaptive responses to stresses such as drought and high salinity [12]. Some studies indicated that ion beam
Fig. 4 The highest transcript levels of SDR1 appeared at 72 HAI in an ion flux of 5×1017 N+/cm2 (a). The transcript levels of SDR1 increased at 96 HAI under vacuum and other ion flux treatments and were higher in an ion flux of 1×1017 N+/cm2 than the treatment. The higher and lower ion fluxes could both elevate SDR1 transcripts, but the enhancement effect appeared later under the lower ion flux treatment. For SDR2 (b), only 5× 1017 N+/cm2 could significantly enhance the transcription. The expression profiles of SDR3 under different ion beam treatments similarly increased at 72 HAI, decreased at 96 HAI, then increased at 120 HAI (c). Z, vacuum treatment; 1, 1×1017 N+/cm2 treatment; 3, 3×1017 N+/cm2 treatment; 5, 5×1017 N+/cm2 treatment. a SDR1, b SDR2, c SDR3
Appl Biochem Biotechnol (2014) 173:239–247
245
Fig. 5 P450 transcript levels were increased and then decreased under vacuum and 1×1017 N+/cm2 treatment. The highest transcript levels of P450 appeared at 96 HAI in an ion flux of 1×1017 N+/cm2, while the highest transcript level of P450 appeared at 72 HAI in an ion flux of 3×1017 and 5×1017 N+/cm2. The P450 transcript was found to be more abundant under 1×1017 and 5×1017 N+/cm2 than under 3×1017 N+/cm2. Z, vacuum treatment; 1, 1×1017 N+/cm2 treatment; 3, 3×1017 N+/cm2 treatment; 5, 5×1017 N+/cm2 treatment. a P450-1, b P450-2
implantation rice seeds showed this stimulation effect, meanwhile, ABA signal genes are differentially expressed in rice seedlings [12]. The ABA level rose in liquorice seedlings treated by ion beam implantation at a particular ion flux when they were subjected to drought conditions [16]. This showed that an ABA signal network is involved in the response of the rice to ion beam irradiation stress. Therefore, it is important to study the mechanism of ABA signal pathways for a response to ion beam irradiation stress. These results will shed light on the mechanism of the stimulation effects of ion beam implantation. Before this work, little was known about the relationship between ion beam implantation and endogenous hormone ABA gene expression. In this research, the regulation of the key genes’ expression involved in ABA biosynthesis in rice implanted by ion beam was studied. The results showed that the transcriptional activity of NCED, AAO1, and SDR2 were higher in rice seedlings treated by a beam with an ion flux of 3×1017 and 5×1017 N+/cm2 than those treated by a beam with an ion flux of 1×1017 N+/cm2. However, 1×1017 N+/cm2 ion flux ion beam implantation could enhance the expression level of ZEP, AAO2, and P450-2. Then, 1× 1017 and 5×1017 N+/cm2 ion flux ion beam implantations can both enhance the expression level of AAO3, SDR1, and P450-1. According to germination rate and simplified vigour index, 1×1017 and 5×1017 N+/cm2 ion flux ion beam implantations damaged embryonic rice, while
Fig. 6 Effect of N+ ion beam implantation on ABA level of rice seedlings. c, control; z, vacuum treatment; 1, 1× 1017 N+/cm2 treatment; 3, 3×1017 N+/cm2 treatment; 5, 5×1017 N+/cm2 treatment
246
Appl Biochem Biotechnol (2014) 173:239–247
the damage was less severe at an ion flux of 3×1017 N+/cm2 [12]. Nevertheless, the time of ABA biosynthesis genetic up-regulation at 1×1017 N+/cm2 lagged behind that at 3×1017 and 5×1017 N+/cm2 ion flux. This implied that the higher ion flux ion beam implantation groups had stronger stress signals for embryo rice than those subjected to lower ion fluxes, so it could more quickly up-regulate the genetic transcription activity. However, the expression pattern of SDR3 was special as it was obviously up-regulated at all ion flux ion beam implantation groups, yet the effect appeared later at an ion flux of 3×1017 N+/cm2. Although previous studies showed that the ZEP gene was not regulated by abiotic stress [18], this study showed that the transcription level in rice seedlings was enhanced by ion beam implantation. ABA biosynthesis is induced by drought and salt stresses, then the ABA can activate ABA synthesis by a positive feedback mechanism and enhance the resistance of the plant to environmental stress [19]. ABA signalling transduction pathways induce stomatal closure during adaptive plant responses to drought, inhibiting or decreasing their ethylene biosynthesis and enhancing the cell resistance against dehydration stress by activating the ABA-dependent, or ABA-independent, gene expression pathways [19]. In this work, endogenesis ABA content increased in rice seedlings treated by different ion flux ion beams. This implied that there were continuous stress effects induced by ion beam irradiation, and this stress enhanced ABA biosynthesis when subjected thereto. The increasing contents of endogenesis ABA in the cells can promote the expression of the genes responding to stresses. ABA acted as a signal molecule by transduction among the different tissues, which can also promote the stress-response systems. It is therefore important for plants as they adapt to environmental stress. The genes involved in ABA biosynthesis were up-regulated by ion beam implantation and then enhanced ABA biosynthesis. It is speculated that ABA was involved in the response to resistance against ion beam irradiation stress. These results provide new information about the molecular mechanisms of biological effects induced by ion beam irradiation. Acknowledgements This work was supported by the Key Technology Projects of Henan Province (#10210110108), the Foundation and Cutting-edge Technology Projects of Henan Departance of Science and Technology (#132300410122), and the National Natural Science Fund of China (#30800204 and U1204307).
References 1. Yu, Z. L., Yu, L. D., Vilaithong, T., & Brown I. (2006). Springer Science and Business Media Inc., New York. 2. Mo, H. L., Yu, S. B., Deng, G. F., Qin, G., & Liang, G. F. (1999). Guangxi Agricultural Sciences, 36, 103– 105 (in Chinese). 3. Wu, Y. J., Zhang, Y., Wu, J. D., Tong, J. P., Li, H., Deng, L. Y., et al. (2005). Plasma Science & Technology, 2, 2783–2788. 4. Zhao, L. Z., Wang, H. H., Wang, Y., Li, Y. M., Zhen, D. S., & Jie, H. M. (2006). Acta Agricultural Borealioccidentalis Sinica, 15, 17–19 (in Chinese). 5. Wang, X. Q., Yao, J. M., Yuan, C. L., Wang, J., & Yu, Z. L. (2002). Plasma Science & Technology, 5, 1505–1510. 6. Zheng, X. X., Wu, B. S., & Lu, J. (2006). Nuclear Techniques, 29, 111–115. 7. Yu, Z. L. (2008). IEEE Transactions on Plasma Science, 28, 128–132. 8. Wu, L. F., & Yu, Z. L. (2001). Radiation and Environmental Biophysics, 40, 53–57. 9. Li, K., Nie, Y. L., Zhang, D. Z., Zhang, J., & Zhang, G. F. (2007). IEEE transactions on Plasma Science, 35, 454–459. 10. Cutler, S. R., Rodriguez, P. L., Finkelstein, R. R., & Abrams, S. R. (2010). Annual Review of Plant Biology, 61, 651–679.
Appl Biochem Biotechnol (2014) 173:239–247
247
11. Umezawa, T., Nakashima, K., Miyakawa, T., Kuromori, T., Tanokura, M., Shinozaki, K., et al. (2010). Plant Cell Physiology, 51, 1821–1839. 12. Ya, H. Y., Chen, Q. F., Wang, W. D., Chen, W. G., Qin, G. Y., & Jiao, Z. (2012). Journal of Radiation Research, 53, 558–569. 13. Livak, K. J., & Schmittgen, T. D. (2001). Methods, 25, 402–408. 14. Wu, S. R., Chen, W. F., & Zhou, X. (1988). Plant Physiology Communications, 6, 51–56 (in Chinese). 15. Li, Y. F., Liang, Y. Z., & Yu, Z. L. (2006). Practaculture Science, 23, 13–17 (in Chinese). 16. Zhang, X. S., Wu, L. J., Yu, L. X., Wei, S. L., Liu, J. N., & Yu, Z. L. (2007). Plasma Science and Technology, 2, 135–240. 17. Ya, H. Y., Gu, Y. H., & Jiao, Z. (2007). Journal of Plant Physiology and Molecular Biology, 33, 507–516. 18. Tuteja, N. (2007). Plant Signaling & Behavior, 2, 135–138. 19. Zhang, J. H., Jia, W. S., Yang, J. C., & Ismail, A. M. (2006). Field Crops Research, 97, 111–119.
