Vol. 12, No. 4
MOLECULAR AND CELLULAR BIOLOGY, Apr. 1992, p. 1592-1604 0270-7306/92/041592-13$02.00/0
Copyright © 1992, American Society for Microbiology
Expression of the CD4 Gene Requires
a
Myb Transcription Factor
GERALD SIU,l* ANDREA L. WURSTER,l JOSEPH S. LIPSICK,2 AND STEPHEN M. HEDRICK' Department of Biology and the Cancer Center, University of California, San Diego, La Jolla, California 92093-0063,1 and Department of Microbiology, School of Medicine, State University of New York, Stony Brook, New York 11794-86212 Received 18 September 1991/Accepted 6 January 1992
We have analyzed the control of developmental expression of the CD4 gene, which encodes an important recognition molecule and differentiation antigen on T cells. We have determined that the CD4 promoter alone functions at high levels in the CD4+ CD8- mature T cell but not at the early CD4+ CD8+ stage of T-cell development. In addition, the CD4 promoter functions only in T lymphocytes; thus, the stage and tissue specificity of the CD4 gene is mediated in part by its promoter. We have determined that a Myb transcription factor binds to the CD4 promoter and is critical for full promoter function. Thus, Myb plays an important role in the expression of T-cell-specific developmentally regulated genes.
The CD4 glycoprotein is expressed
on
cells results in the inhibition of differentiation (4, 50, 68). Recently, the murine c-myb gene was mutated to a nonfunctional form by using homologous recombination (43). Mice homozygous for the mutation were found to be profoundly anemic by day 15 of development. These data indicate that properly regulated c-myb expression is essential for hematopoietic differentiation. In addition, myb antisense oligonucleotides have been shown to inhibit the growth of hematopoietic cells (1, 14, 15), and elevated levels of myb expression can transiently increase the proliferation rate of hematopoietic cells (17). These data indicate that in addition to its role in development, Myb may play an important role in cell growth. Analyses of myb expression in T lymphoid cells indicate that it is expressed at high levels in cortical thymocytes, which represent primarily the immature CD4+ CD8+ and CD4- CD8- populations and at much lower levels in medullary lymphocytes, which represent the more mature single-positive CD4+ CD8- and CD4- CD8+ populations (60, 67). c-myb expression in mature T cells was found to be low but was inducible upon mitogen or interleukin stimulation (36, 48, 52, 65, 69). This effect may be mediated primarily by interleukin-2 (IL-2), as stimuli that do not induce IL-2 or IL-2 receptor expression do not affect c-myb expression (63). Nonetheless, the potential role of myb in T-lymphocyte activation and development is unknown. Recent experiments have shown that at least three members of the Myb family, v-Myb, c-Myb, and B-Myb, are sequence-specific DNA-binding proteins that can transactivate promoters (3, 27, 32, 42, 44, 74). It has therefore been proposed that Myb affects development primarily by controlling transcription of developmentally important genes. Recently, a gene that was inducible by infection with the E26 virus, which contains a myb-ets fusion oncogene, has been identified (44). This gene, mim-1, was found to be promyelocyte specific and to have three Myb binding sites within 100 bp upstream of its transcriptional start site. However, the function of mim-1 and its role in development are unknown. Because of its unique role in the function and development of T cells, we were interested in studying the elements that control the expression of the murine CD4 gene. Using both reporter assays and mRNA analyses in transient transfection of T-cell clones and lines, we determined that the CD4 promoter functions in a stage- and tissue-specific manner. Using electrophoretic mobility shift assays, mutational analyses, and transactivation analyses, we have determined that multiple factors bind to the CD4 promoter and that a
specific subsets of
mature T cells and thymocytes and plays an important role
both in T-cell antigen-specific activation and in T-cell development (37, 47). T cells are capable of recognizing antigen only in the form of an oligopeptide bound to a membrane protein encoded within the major histocompatibility complex (MHC) (for a review, see reference 22). The antigenspecific and MHC allele-specific interaction is mediated primarily by the T-cell antigen receptor, whereas CD4 and CD8, another glycoprotein similar in function to CD4, recognize nonpolymorphic regions of the MHC molecule (10, 55). This latter interaction serves both to increase the affinity of the T cell for the antigen-presenting cell (APC) and to provide additional stimulatory signals via the tyrosine kinase pS6Ick (49). CD4 binds to MHC class II molecules and is expressed only on T cells bearing MHC class II-restricted T-cell antigen receptors (TCRs), primarily helper T (TH) cells (66). Thus, CD4 plays an important role in specifying T-cell antigen/MHC recognition and may also influence T-cell functional subclass. CD4 also plays a critical role in T-cell development. Immature thymocytes initially do not express TCR, CD4, or CD8. These CD4- CD8- (double-negative) cells differentiate to express high levels of all three molecules, forming TCR+ double-positive (CD4+ CD8+) cells that compose the largest thymocyte subpopulation (12, 70). CD4+ CD8+ thymocytes that bind MHC class II molecules via the TCR and CD4 downregulate the expression of CD8 and maintain the expression of CD4; conversely, thymocytes that ligate MHC class I molecules via the TCR and CD8 molecules downregulate CD4 and maintain CD8 expression (2, 29, 31, 58, 59). This process of selection results in the mature TCR+ singlepositive (CD4+ CD8- and CD4- CD8+) populations that seed the peripheral lymphoid organs. The nuclear oncoprotein Myb is believed to be an important regulator of cell growth and differentiation in hematopoietic cells (38, 62). Myb is a member of a closely related family of Myb-like proteins and is generally expressed in immature cells of the hematopoietic lineage and downregulated during differentiation (6, 7, 18, 45, 73). Cells transformed with either avian myeloblastosis virus or E26 maintain an immature phenotype, and transfection of vectors expressing high constitutive levels of c-Myb into erythroid *
Corresponding author.
1592
VOL. 12, 1992
transcription factor from the Myb family plays a critical role in CD4 promoter function and thus contributes to expression of the CD4 gene. MATERIALS AND METHODS Cell types. We have analyzed T-cell lines and clones of each developmental phenotype in our studies. For the mature T cells, we use antigen-specific T-cell clones, as these cells are untransformed and thus are functionally closer to in vivo mature T cells than lymphomas. For the mature TCR+ CD4 single-positive (subsequently referred to as CD4+) phenotype, we have used the D10 and C.F6 antigen-specific TH cell clones (11, 30); both of these cells express high levels of CD4 mRNA and no detectable levels of CD8 mRNA by Northern (RNA) blot analysis (data not shown). For the mature TCR+ CD8 single-positive (CD8+) phenotype, we have used the L3 and CTLL-2 Tc clones (16, 39), both of which express high levels of CD8 mRNA and no detectable levels of CD4 mRNA (data not shown). For immature T-cell clones, we have used the AKRlG1 and 1010 thymomas as representatives of the double-positive (CD4+ CD8+) phenotype (25, 53) and the S49 and SL12410 thymomas for the double-negative (CD4- CD8-) phenotypes (23, 24a). For non-T-cell controls, we have used the B-cell hybridoma LK 35.2 (28), the Abelson-transformed pre-B cell 22D6, the DCEK fibroblast (54), and the HeLa epithelial cell lines. Transactivation experiments were conducted primarily in the QT6 quail fibroblast cell line (27). Isolation of cytoplasmic RNA. Cells were washed twice in lx phosphate-buffered saline (PBS) and resuspended in 0.14 M NaC14.01 Tris-HCI (pH 8.0)-0.015 M MgCl2 at a concentration of 107 cells per ml. Cells were lysed with the addition of 0.2% Nonidet P-40, and the nuclei were pelleted by centrifugation at 1,500 x g for 5 min. The supernatant was recovered and brought to 1% sodium dodecyl sulfate (SDS)-5 mM EDTA-100 ,ug of proteinase K per ml and incubated at 50°C for 15 min. The solution was then phenolchloroform extracted, and the nucleic acids were precipitated with ethanol. Isolation of genomic cosmid clones and subcloning. A genomic library constructed from DNA isolated from the G8 T-cell clone (8) was screened by using a full-length CD4 cDNA probe according to standard procedures. The J4 cosmid was mapped with restriction enzymes by using the partial restriction-enzyme digestion method. All subcloning of the CD4 promoter fragments into the promoter cloning site of psVOALA5' vector (9) was done by standard procedures (40). The 5' end of each promoter deletion corresponds to a different restriction enzyme site in the CD4 5' flanking region (Fig. 1B), whereas in each case the 3' end of the promoter fragment corresponded to the XhoI restriction enzyme fragment in the CD4 5' untranslated region (Fig. 1B). The number in each name corresponds to the amount of 5' flanking region included in the promoter fragment; thus, pVOPA-101 contains 101 bp of CD4 promoter region. pVOPA-54R consists of a BglII-Bsu36I restriction enzyme fragment containing the CD4 promoter region from the Bsu36I site 54 bp upstream of the cap site to the BglII site in the 5' flanking region; this construct thus is similar to pVOP but has had the region from +71 to -54, including the CD4 cap sites, deleted. The TCR 1-chain enhancer used in these experiments was a 1.0-kb BglII-NcoI restriction enzyme fragment from the TCR ,3-chain locus (33). Multimerization of the CD4 promoter was done by using the polylinker of the pKS plasmid vector (Stratagene); multimerizations of the
Myb DIRECTS CD4 TRANSCRIPTION
1593
mutant and wild-type promoters were done in the same manner, using the same vector restriction enzyme cloning sites. For the cotransfection experiments, the CD4 promoter fragment was cloned into the upstream XbaI restriction enzyme site in the Elb-CAT vector (35). S1 nuclease protection and primer extension. Si nuclease experiments were carried out according to the protocol of Kadonaga (27a). A single-stranded end-labeled CD4 promoter probe was generated by using a synthetic oligonucleotide whose sequence is the complement to the 5' untranslated region of the CD4 cDNA starting at the XhoI restriction enzyme site. This oligonucleotide was labeled with 32P by using T4 polynucleotide kinase and hybridized to singlestranded DNA isolated from an M13mpl8 subclone containing the CD4 promoter cloned in the sense orientation. The primer was extended with cold nucleotides and Klenow fragment, and the resulting double-stranded DNA was treated with a restriction enzyme that cleaved in the linker distal to the primer and the promoter fragment. The strands were then disassociated by gel electrophoresis by using 50 mM NaCI-1 mM EDTA-50 mM NaOH as the running buffer, and the single-stranded promoter fragment was isolated by electroelution. For the Si reaction, 130,000 cpm of probe was annealed to 25 to 40 ,ug of total RNA isolated from the different cell lines in 80% formamide-0.02 M piperazineN,N'-2-bis(ethanesulfonic acid) (PIPES; pH 6.4)-0.4 M NaCI-1 mM EDTA in a total volume of 10 ,ul. The annealing mixture was incubated sequentially at 70°C for 3 min and at 45°C for 3 h. Ten units of Si nuclease in 200 R1 of digestion buffer (0.03 M sodium acetate [pH 5.0], 0.25 M NaCl, 0.001 M ZnSO4, 5% glycerol) was then added, and the mixture was incubated at 25°C for 10 min. The reaction mixture was brought to 8 mM EDTA to stop the reaction and was extracted with phenol-chloroform. The digestion products were then precipitated with ethanol and run on a 6% sequencing gel. The primer extension reactions utilized the CD4 5' untranslated region oligonucleotide primer described above. The primer was labeled with 32P as described above, annealed to 24 ,ug of total RNA in 2 mM Tris (pH 7.8)-0.2 mM EDTA (pH 8.0)-0.25 M KCl in a total reaction volume of 15 pI for 2 min at 75°C, and allowed to cool to 42°C. Twenty units of RNAsin was added to the reaction mixture, and the mixture was incubated for 1 h at 42°C. The extension reaction was initiated with the addition of 20 U of avian myeloblastosis virus reverse transcriptase and 23 ml of an extension mix containing 11 mM Tris (pH 8.0), 5.6 mM MgCl2, 56 pug of actinomycin D per ml, 2.8 mM dithiothreitol (DTT), and 0.2 mM deoxynucleoside triphosphates and incubated at 37°C for 1 h. The extension products were then precipitated with ethanol and sized on a 6% sequencing gel. Cell maintenance and transient transfections. The D10, C.F6, L3, and CTLL-2 T-cell clones were grown in EHAA medium supplemented with 10% fetal calf serum, glutamine, 50 ,uM ,B-mercaptoethanol, and 100 U of human recombinant IL-2 (kindly provided by Cetus Corp.) (71) per ml. The D10 TH cell clone was stimulated every 14 days with antigen as follows: 106 resting T cells were added to 107 irradiated B1O.A spleen APCs and 100 pug of conalbumin per ml in a total volume of 10 ml of medium without IL-2; this stimulation mix was then incubated in a T25 tissue-culture flask upright in a 5% CO2 incubator for 2 days; the cells were then split 1:5 into medium containing 100 U of IL-2 per ml. The C.F6 TH clone was stimulated in a similar manner except that the initial stimulation contained 107 resting T cells, 5 x 107 irradiated B1O.A spleen APCs, and 30 jig of whole
1594
SIU ET AL.
MOL. CELL. BIOL. 5kb
A.)
CD4 gene U9
Bam HI
a
*
III
* II
1I
Bgl
Cia I
II
I I
Eco RI
Eco RV
IXI
HindM
II I
nhoI
J4
pJi4
B.) V 4-415 VI TCTAGAACAGCCGACTTAGTGGATCTGTTGGGAATCTAAATTTTCCATTGATTAAATTG
TTTTTTT
A-336 AAAACATGGCATTACTGCATAGGCAGCCTAGTCTGGCCTTGAGCTTGTGATTTTTCTGCsTAAATCACCCAGTGCTGGGG
A-265 III IV TTAtAQ1C2rATGCCCGTGCCCGTGCCCGTGCCTGTAAGCCTTGCCTCWLTM3&CCTAACCAGGCTGTTTCAGCTTTTT A-101
A-141
ACGGCACCAAACAATAGTGACATTCCAGACTCCAGCTTGATTCTGCTCAGGCATTTTCAG-GACTTTGGCATTTTTAATT
_-54 4-22 GGGTGGGAGGGAGGGACTCCTGAGGGCTGGCTTACGTCCGCCGTGCAGAGGAGCCTCA
I
U
TTTZ==C-CCAA
v
v
4A+36
CGACCAGGCTTCCTGTCTTTTCATTTACGAACATCTGTGAAGGCAAAGCAAGACTCTCTTCTTCACTAGGTACCTGTTTG Xbo I CAAAGTCTCGAG
FIG. 1. (A) Genomic cosmid clone containing the murine CD4 gene. Black boxes indicate exons of the CD4 gene; the arrow indicates transcription orientation. pJ4BX9 is a 1.0-kb BglII-XhoI restriction enzyme fragment that contains the 5' end of the CD4 mRNA and immediate 5' flanking region. (B) CD4 promoter sequence. This sequence of the pJ4BX9 fragment extending from the XhoI restriction site in the 5' untranslated region to the XbaI restriction site at -415 has been published previously (19). Arrowheads indicate transcription initiation points. Deletion points indicated represent restriction enzyme sites used in promoter deletion studies. Boxed sequences indicate potential Myb recognition sites. All potential Myb recognition sequences either are perfect matches with the consensus Myb recognition site (3) or are 1-bp mismatches from the consensus but conserve the critical core AAC sequence.
pigeon cytochrome c per ml in 10 ml of medium without IL-2. The L3 Tc clone was also stimulated every 2 weeks; 106 resting T cells were added to 5 x 107 irradiated BALB/c spleen APCs in medium with 100 U of IL-2 per ml. The AKRlG1, S49, LK, DCEK, and HeLa cell lines were maintained in EHAA supplemented with 10% fetal calf serum and glutamine. The QT6 cell line was maintained in Dulbecco's modified medium supplemented with 10% fetal calf serum and glutamine. All cells except QT6 were transfected by the DEAE-dextran method. All T-cell clones were transfected 4 days after antigen stimulation and 2 days after the addition of IL-2. Cells (107 per transfection point) were washed in TS solution (25 mM Tris-HCl [pH 7.4], 137 mM
NaCl, 5 mM KCI, 0.7 mM CaCl2, 0.5 mM MgCl2) and resuspended in 1.5 ml of TS containing 3 pg of the construct plasmid DNA and 500 p,g of DEAE-dextran per ml. The transfection mixture was incubated at room temperature for 20 min, and the cells were subsequently washed once with TS, resuspended in 10 ml of growth medium, and incubated fQr 48 h prior to harvesting. QT6 fibroblast cells were transfected by a modified CaPO4 transfection technique (5). Approximately 2 x 106 QT6 cells were grown in a 10-cm tissue culture dish, washed once with PBS, and provided with 10 ml of fresh growth medium. Separately, a DNA mix was prepared by adding 10 ,g of DNA and 50 p,l of 2.5 M CaCl2 solution in a total volume of 500 RI to 500 ,ul of 2x
VOL. 12, 1992
BES buffer solution at pH 6.95 (2x BES is 50 mM BES [pH 6.95], 280 mM NaCl, and 1.5 mM Na2HPO4). The mix was incubated for 20 min at room temperature and added slowly dropwise to the plate of cells while the medium was gently swirled. Cells were incubated overnight at 37°C in a 3% CO2 atmosphere, washed twice, provided with fresh growth medium, and incubated overnight again at 37°C in a 10% CO2 atmosphere. Cells were then harvested as described below. Reporter assays. All cells were harvested, washed twice in lx PBS, and resuspended in 100 ,1u of 100 mM potassium phosphate (pH 7.8)-i mM DTT. Cells were then lysed by three freeze-thaw cycles, and the extracts were cleared of debris by centrifugation. Luciferase assays were performed as described previously (9). Ten microliters of cell extract was added to 250 ,1u of 25 mM glycylglycine (pH 7.8) and 15 mM MgSO4. The reaction was initiated by the injection of 100 ,ul of 1 mM luciferin and 100 ,l of 17.5 mM ATP (pH 7.5), and the light emission was recorded by a Monolight 2010 luminometer (Analytical Luminescence). Chloramphenicol acetyltransferase (CAT) assays were performed as described previously (40). Twenty microliters of cellular extract was combined with 40 ,lI of acetyl coenzyme A (3.5-mg/ml) in 0.25 M Tris (pH 7.8) buffer, 40 RI of 0.25 M Tris (pH 7.8), and 1.5 pl of [14C]chloramphenicol. The reaction mixture was incubated at 37°C for 4 h to overnight. The reaction products were extracted with 1 ml of ethylacetate; the organic phase was recovered and lyophilized to dryness, and the pellet was resuspended in 10 pI of ethylacetate. The sample was spotted on a thin-layer chromatography plate and run in a 200-ml chamber with a 9:1 chloroform/ methanol buffer. The plate was exposed to X-ray film overnight to visualize the reaction products. The radioactive spots on the plates were cut out and counted on a scintillation counter in order to quantify percent conversion. For the transactivation analyses, CAT assays were performed by the phase extraction method as described previously (57). Nuclear extract preparation. Nuclear extracts from cultured cells were prepared according to the protocol of Waterman and Jones (72). Cells were washed once in 1 x PBS-5 mM MgCl2 and resuspended in 4 packed-cell volumes of buffer H (10 mM Tris [pH 7.9], 10 mM KCl, 0.75 mM spermidine, 0.15 mM spermine, 0.1 mM EDTA, 0.1 mM EGTA, 2 mM DTT, 0.1 mM fluoride, 2 mg of benzamidine per ml, 1 ,ug of pepstatin per ml, 4 ,ug of leupeptin per ml, 10 ,ug of aprotinin per ml). The cells were swelled on ice for 15 min and lysed with 10 to 15 strokes (or more, as needed) of a Dounce homogenizer. The nuclei were pelleted at 3,000 x g for 8 min, washed once in buffer H, and resuspended in 4 packed-cell volumes of buffer D (50 mM Tris-HCl [pH 7.5], 10% sucrose, 0.42 M KCl, 5 mM MgCl2, 0.1 mM EDTA, 20% glycerol, 2 mM DTT, 0.1 mM phenylmethylsulfonyl fluoride, 2 mg of benzamidine per ml, 1 ,ug of pepstatin per ml, 4 ,ug of leupeptin per ml, 10 ,ug of aprotinin per ml). The suspension was stirred on ice in a cold room for 30 min and centrifuged at 25,000 rpm for 1 h in an SW28 rotor. The supernatant was recovered, and proteins were precipitated with 53% (NH4)2SO4 (0.33 g/ml of supernatant) and centrifuged at 16,000 rpm for 20 min in the SW28 rotor. The pellets were recovered and resuspended in 50 mM Tris-HCl (pH 7.6)-12.5 mM MgCI2-1 mM EDTA-1 mM DTT-20% glycerol-0.1 M KCI and desalted on a Bio-Gel P10 filtration column. The protein concentration of the resulting fractions was determined by the Coomassie blue assay (Pierce). Fractions containing protein were then pooled, realiquoted, and stored at -70°C.
Myb DIRECTS CD4 TRANSCRIPTION
1595
EMSA/UV cross-linking. The electrophoretic mobility shift assay (EMSA) protocol was based on the procedures of Marine and Winoto (41). End-labeled DNA probe was labeled as described above, using T4 polynucleotide kinase. Radiolabeled DNA probe (2 x 104 cpm) was added to 8 ,ug of nuclear extract and 2 to 4 ,ug of poly(dI-dC) per ml in a total volume of 20 ,ul of reaction buffer (10 mM N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid [HEPES]-KOH [pH 7.9], 50 mM NaCl, 5 mM Tris-HCl [pH 7.5], 15 mM EDTA, 1 mM DTT, 10% glycerol). The binding mix was incubated at room temperature for 20 min, and the complexes were subsequently resolved on a 4% nondenaturing polyacrylamide gel run in glycine buffer (190 mM glycine, 25 mM Tris-HCl [pH 8.5], 1 mM EDTA) for approximately 2 h. The gel was then dried and exposed to X-ray film overnight. For the cold competition experiments, nonradioactive oligonucleotides were added at 25- or 250-fold molar excess to the binding mix without the radioactive probe, and the mix was incubated at room temperature for 20 min. The radioactive probe was then added, and the EMSA was carried out subsequently as described above. For EMSA comparisons between the unmutated and mutated promoter regions, the reactions were carried out as described above except that the binding buffer contained 5 mM MgSO4 and 5 mM EDTA. For UV cross-linking, the EMSA binding reaction was carried out as described above and subsequently exposed to a short-wave (254-nm) UV light box for 1 to 8 h. Immunoprecipitations of the UV cross-linking reaction were carried out with either the rabbit anti-Myb BP2 antiserum (3a) or normal rabbit serum; the immunoprecipitates were then resolved on a 5% SDS-polyacrylamide gel, dried, and exposed to X-ray film overnight. Promoter mutagenesis. The CD4 promoter region between the MseI restriction site at -101 and the XhoI restriction site at +71 was cloned into the EcoRV site of pKS. The promoter was then digested with PJIMI, which cleaves within site I. The 3' overhanging ends were then blunt ended with T4 DNA polymerase, and an SphI linker (New England Biolabs) was inserted into this site. The mutants were screened by SphI digestion and DNA sequencing by using the sequencing kit from Pharmacia. Because of the imprecision of the T4 DNA polymerase, several mutants were obtained that had deletions of additional nucleotides. These constructs were selected for further mutagenesis in order to maintain the same number of nucleotides in the promoter region. These constructs were then digested with SphI, the 3' overhanging ends were again removed by using T4 DNA polymerase, and the mutants were screened by loss of the SphI site and DNA sequencing. The X series mutants were generated by oligonucleotide-directed mutagenesis as described by Kunkel et al. (34). Briefly, the -101/+71 promoter fragment or the single site I mutants were subcloned into the pKS plasmid vector (Stratagene), and singlestranded phage was generated in the dut ung Escherichia coli strain CJ236. An oligonucleotide containing the sequence 5'-AA!TTTTrCTTCTTCCCC-3' (synthesized by Research Genetics) was used to prime synthesis of the second strand by using T7 DNA polymerase. The extension mix was then transformed into the dut+ ung+ strain DH1, and mutants were identified by DNA sequencing. The mutant promoter fragments were then resubcloned into the psVOALA5' luciferase vector and transfected into T cells as described above.
MOL. CELL. BIOL.
SIU ET AL.
1596
B
4-
A.) 0
^
c..z-.
3-
* *
DIO CF6 * L3 E CTLL-2
._
lb
.
-
Cco'w v ._
lb
-d*
2I O-
4b
0 T
(C
C'
A
C A
FIG. 2. Utilization of multiple initiation points of transcription by the CD4 gene. Primer extension (A) and Si nuclease protection (B) analyses of RNA purified from D10, AKRlG1, and 22D6 cell lines are shown. For the primer extension analysis, the oligonucleotide primer used is complementary to the CD4 5' untranslated region starting at the XhoI restriction enzyme site (see Fig. 1B). Markers represent sequencing reactions using the same oligonucleotide as a sequencing primer. Arrows indicate extension products. For the Si analysis, the probe used is the pVOP promoter fragment labeled at the XhoI site; markers are as for the primer extension analysis. Arrows indicate protection products. No additional bands are observed (data not shown).
C"
Co-
1.2
B.)
1.0 ._ 0.8
*
Cu coI v
AKRIGI
* S49 * LK
-
0.6
ElleLa
m 0.4
0.2
RESULTS The CD4 gene utilizes multiple initiation points of transcription. Using a murine CD4 cDNA probe, we isolated a cosmid that contains the murine CD4 gene and flanking regions (Fig. 1A), and we subcloned and sequenced a 1.1-kb BglII-XhoI fragment that contains portions of the CD4 5' untranslated region and flanking region (Fig. 1B and data not shown). To identify the CD4 initiation point of transcription, we conducted both primer extension and Si nuclease analyses on mRNA isolated from the D10 CD4+ and the AKRlG1 CD4+ CD8+ T cells (Fig. 2). The CD4 gene utilizes three tightly clustered initiation sites for mRNA transcription, which we have designated the +1, +7, and +11 sites. Primer extension analysis indicates that all three positions are used, whereas we identify unambiguously the +1 and +11 positions by using only Si analysis; this slight difference probably reflects imprecision in the techniques. Analysis of the sequence present immediately 5' to the cap site indicates that although there is no consensus TATA sequence, several recognition sites for other transcription factors can be identified in the promoter region. For example, we have identified six potential binding sites for the Myb nuclear oncoprotein within the 415-bp region 5' to the initiation points of transcription, designated I to VI (Fig. 1B). These sites imply that the Myb transcription factor may play a role in CD4 transcription (see
below). The CD4 promoter is active in mature CD4+ T cells but not mature CD8+, immature, or non-T cells. To study CD4 promoter function and specificity, we cloned CD4 promoter fragments into the luciferase reporter gene construct psVOALA5' (9) and used these constructs to transfect T and non-T cells of different CD4 and CD8 phenotypes. Luciferase activity was determined as a measure of the transcriptional activity of each construct (Fig. 3). To ensure that transcription of these constructs initiates from the appropriate CD4 cap site in the promoter fragment, we used a synthetic oligonucleotide corresponding to the antisense sequence of a portion of the luciferase gene to perform primer extension analysis on RNA purified from transfected
0.0
Ith
cqs
cmn
w.uxr c)~~~~~~~~~~0 V)
0 c:o
(Construtcts FIG. 3. CD4 promoter function in cells of different CD4 and CD8 phenotypes. The relative activity of each CD4 promoter/enhancer combination reflects normalization to a control transfection of the luciferase gene under the transcriptional control of the human ,-actin promoter/enhancer, which was arbitrarily given a value of 1. Average absolute light units for the 0-actin promoter/enhancer construct transfection were approximately 20,000 for D10, L3, and CTLL-2, 8,000 to 10,000 for C.F6, AKRlG1, and S49, and 50,000 for HeLa and LK. Average light units for a promoterless construct were 100. The relative activities of each promoter deletion were then averaged together; error bars represent 1 standard deviation. All transfections were internally controlled for transfection efficiency in a reporter assay using a construct containing the CAT gene under the control of the thymidine kinase promoter. (A) CD4 promoter activity in mature T cells. All transfections were repeated three to nine times in all cell types. Constructs are described in Materials and Methods. Transfection data for the -415, -336, -265, and -141 deletions are not shown; we do not detect significant differences in activity between these deletions and the -101 deletion. (B) CD4 promoter activity in immature T and non-T cells. PE and SVE refer to the TCR p-chain enhancer and the simian virus 40 early enhancer, respectively. All transfections were repeated five to nine times. Data similar to those obtained with the -/- thymoma S49 and the +/+ thymoma AKRlG1 were obtained with the -/- thymoma SL12410 and the +/+ thymoma 1010 (data not shown). pVOPA-54 and PEpVOPA-54 were not tested in HeLa and LK cells.
cells (Fig. 4). The 1.0-kb BglII-XhoI fragment construct, referred to as pVOP, is capable of generating high levels of transcripts from the CD4 cap site in the mature CD4+ D10 and C.F6 TH cells. Indeed, expression appears to be almost twofold over the levels obtained by using a control vector that contains the luciferase gene and the human ,-actin
Myb DIRECTS CD4 TRANSCRIPTION
VOL. 12, 1992
A AA$.*
Competitor
-
Fold excess
-
Origin-
-
1597
Os OS M3 M4 M5 25X 250X
So
I
k.
_ _J
a T
Complex A Complex B_. Complex C
Lt
..911!
NS -i G
C
w
''
A
;il
B
4
Q_R _W Probe
MOLECULAR AND CELLULAR BIOLOGY, Apr. 1992, p. 1592-1604 0270-7306/92/041592-13$02.00/0
Copyright © 1992, American Society for Microbiology
Expression of the CD4 Gene Requires
a
Myb Transcription Factor
GERALD SIU,l* ANDREA L. WURSTER,l JOSEPH S. LIPSICK,2 AND STEPHEN M. HEDRICK' Department of Biology and the Cancer Center, University of California, San Diego, La Jolla, California 92093-0063,1 and Department of Microbiology, School of Medicine, State University of New York, Stony Brook, New York 11794-86212 Received 18 September 1991/Accepted 6 January 1992
We have analyzed the control of developmental expression of the CD4 gene, which encodes an important recognition molecule and differentiation antigen on T cells. We have determined that the CD4 promoter alone functions at high levels in the CD4+ CD8- mature T cell but not at the early CD4+ CD8+ stage of T-cell development. In addition, the CD4 promoter functions only in T lymphocytes; thus, the stage and tissue specificity of the CD4 gene is mediated in part by its promoter. We have determined that a Myb transcription factor binds to the CD4 promoter and is critical for full promoter function. Thus, Myb plays an important role in the expression of T-cell-specific developmentally regulated genes.
The CD4 glycoprotein is expressed
on
cells results in the inhibition of differentiation (4, 50, 68). Recently, the murine c-myb gene was mutated to a nonfunctional form by using homologous recombination (43). Mice homozygous for the mutation were found to be profoundly anemic by day 15 of development. These data indicate that properly regulated c-myb expression is essential for hematopoietic differentiation. In addition, myb antisense oligonucleotides have been shown to inhibit the growth of hematopoietic cells (1, 14, 15), and elevated levels of myb expression can transiently increase the proliferation rate of hematopoietic cells (17). These data indicate that in addition to its role in development, Myb may play an important role in cell growth. Analyses of myb expression in T lymphoid cells indicate that it is expressed at high levels in cortical thymocytes, which represent primarily the immature CD4+ CD8+ and CD4- CD8- populations and at much lower levels in medullary lymphocytes, which represent the more mature single-positive CD4+ CD8- and CD4- CD8+ populations (60, 67). c-myb expression in mature T cells was found to be low but was inducible upon mitogen or interleukin stimulation (36, 48, 52, 65, 69). This effect may be mediated primarily by interleukin-2 (IL-2), as stimuli that do not induce IL-2 or IL-2 receptor expression do not affect c-myb expression (63). Nonetheless, the potential role of myb in T-lymphocyte activation and development is unknown. Recent experiments have shown that at least three members of the Myb family, v-Myb, c-Myb, and B-Myb, are sequence-specific DNA-binding proteins that can transactivate promoters (3, 27, 32, 42, 44, 74). It has therefore been proposed that Myb affects development primarily by controlling transcription of developmentally important genes. Recently, a gene that was inducible by infection with the E26 virus, which contains a myb-ets fusion oncogene, has been identified (44). This gene, mim-1, was found to be promyelocyte specific and to have three Myb binding sites within 100 bp upstream of its transcriptional start site. However, the function of mim-1 and its role in development are unknown. Because of its unique role in the function and development of T cells, we were interested in studying the elements that control the expression of the murine CD4 gene. Using both reporter assays and mRNA analyses in transient transfection of T-cell clones and lines, we determined that the CD4 promoter functions in a stage- and tissue-specific manner. Using electrophoretic mobility shift assays, mutational analyses, and transactivation analyses, we have determined that multiple factors bind to the CD4 promoter and that a
specific subsets of
mature T cells and thymocytes and plays an important role
both in T-cell antigen-specific activation and in T-cell development (37, 47). T cells are capable of recognizing antigen only in the form of an oligopeptide bound to a membrane protein encoded within the major histocompatibility complex (MHC) (for a review, see reference 22). The antigenspecific and MHC allele-specific interaction is mediated primarily by the T-cell antigen receptor, whereas CD4 and CD8, another glycoprotein similar in function to CD4, recognize nonpolymorphic regions of the MHC molecule (10, 55). This latter interaction serves both to increase the affinity of the T cell for the antigen-presenting cell (APC) and to provide additional stimulatory signals via the tyrosine kinase pS6Ick (49). CD4 binds to MHC class II molecules and is expressed only on T cells bearing MHC class II-restricted T-cell antigen receptors (TCRs), primarily helper T (TH) cells (66). Thus, CD4 plays an important role in specifying T-cell antigen/MHC recognition and may also influence T-cell functional subclass. CD4 also plays a critical role in T-cell development. Immature thymocytes initially do not express TCR, CD4, or CD8. These CD4- CD8- (double-negative) cells differentiate to express high levels of all three molecules, forming TCR+ double-positive (CD4+ CD8+) cells that compose the largest thymocyte subpopulation (12, 70). CD4+ CD8+ thymocytes that bind MHC class II molecules via the TCR and CD4 downregulate the expression of CD8 and maintain the expression of CD4; conversely, thymocytes that ligate MHC class I molecules via the TCR and CD8 molecules downregulate CD4 and maintain CD8 expression (2, 29, 31, 58, 59). This process of selection results in the mature TCR+ singlepositive (CD4+ CD8- and CD4- CD8+) populations that seed the peripheral lymphoid organs. The nuclear oncoprotein Myb is believed to be an important regulator of cell growth and differentiation in hematopoietic cells (38, 62). Myb is a member of a closely related family of Myb-like proteins and is generally expressed in immature cells of the hematopoietic lineage and downregulated during differentiation (6, 7, 18, 45, 73). Cells transformed with either avian myeloblastosis virus or E26 maintain an immature phenotype, and transfection of vectors expressing high constitutive levels of c-Myb into erythroid *
Corresponding author.
1592
VOL. 12, 1992
transcription factor from the Myb family plays a critical role in CD4 promoter function and thus contributes to expression of the CD4 gene. MATERIALS AND METHODS Cell types. We have analyzed T-cell lines and clones of each developmental phenotype in our studies. For the mature T cells, we use antigen-specific T-cell clones, as these cells are untransformed and thus are functionally closer to in vivo mature T cells than lymphomas. For the mature TCR+ CD4 single-positive (subsequently referred to as CD4+) phenotype, we have used the D10 and C.F6 antigen-specific TH cell clones (11, 30); both of these cells express high levels of CD4 mRNA and no detectable levels of CD8 mRNA by Northern (RNA) blot analysis (data not shown). For the mature TCR+ CD8 single-positive (CD8+) phenotype, we have used the L3 and CTLL-2 Tc clones (16, 39), both of which express high levels of CD8 mRNA and no detectable levels of CD4 mRNA (data not shown). For immature T-cell clones, we have used the AKRlG1 and 1010 thymomas as representatives of the double-positive (CD4+ CD8+) phenotype (25, 53) and the S49 and SL12410 thymomas for the double-negative (CD4- CD8-) phenotypes (23, 24a). For non-T-cell controls, we have used the B-cell hybridoma LK 35.2 (28), the Abelson-transformed pre-B cell 22D6, the DCEK fibroblast (54), and the HeLa epithelial cell lines. Transactivation experiments were conducted primarily in the QT6 quail fibroblast cell line (27). Isolation of cytoplasmic RNA. Cells were washed twice in lx phosphate-buffered saline (PBS) and resuspended in 0.14 M NaC14.01 Tris-HCI (pH 8.0)-0.015 M MgCl2 at a concentration of 107 cells per ml. Cells were lysed with the addition of 0.2% Nonidet P-40, and the nuclei were pelleted by centrifugation at 1,500 x g for 5 min. The supernatant was recovered and brought to 1% sodium dodecyl sulfate (SDS)-5 mM EDTA-100 ,ug of proteinase K per ml and incubated at 50°C for 15 min. The solution was then phenolchloroform extracted, and the nucleic acids were precipitated with ethanol. Isolation of genomic cosmid clones and subcloning. A genomic library constructed from DNA isolated from the G8 T-cell clone (8) was screened by using a full-length CD4 cDNA probe according to standard procedures. The J4 cosmid was mapped with restriction enzymes by using the partial restriction-enzyme digestion method. All subcloning of the CD4 promoter fragments into the promoter cloning site of psVOALA5' vector (9) was done by standard procedures (40). The 5' end of each promoter deletion corresponds to a different restriction enzyme site in the CD4 5' flanking region (Fig. 1B), whereas in each case the 3' end of the promoter fragment corresponded to the XhoI restriction enzyme fragment in the CD4 5' untranslated region (Fig. 1B). The number in each name corresponds to the amount of 5' flanking region included in the promoter fragment; thus, pVOPA-101 contains 101 bp of CD4 promoter region. pVOPA-54R consists of a BglII-Bsu36I restriction enzyme fragment containing the CD4 promoter region from the Bsu36I site 54 bp upstream of the cap site to the BglII site in the 5' flanking region; this construct thus is similar to pVOP but has had the region from +71 to -54, including the CD4 cap sites, deleted. The TCR 1-chain enhancer used in these experiments was a 1.0-kb BglII-NcoI restriction enzyme fragment from the TCR ,3-chain locus (33). Multimerization of the CD4 promoter was done by using the polylinker of the pKS plasmid vector (Stratagene); multimerizations of the
Myb DIRECTS CD4 TRANSCRIPTION
1593
mutant and wild-type promoters were done in the same manner, using the same vector restriction enzyme cloning sites. For the cotransfection experiments, the CD4 promoter fragment was cloned into the upstream XbaI restriction enzyme site in the Elb-CAT vector (35). S1 nuclease protection and primer extension. Si nuclease experiments were carried out according to the protocol of Kadonaga (27a). A single-stranded end-labeled CD4 promoter probe was generated by using a synthetic oligonucleotide whose sequence is the complement to the 5' untranslated region of the CD4 cDNA starting at the XhoI restriction enzyme site. This oligonucleotide was labeled with 32P by using T4 polynucleotide kinase and hybridized to singlestranded DNA isolated from an M13mpl8 subclone containing the CD4 promoter cloned in the sense orientation. The primer was extended with cold nucleotides and Klenow fragment, and the resulting double-stranded DNA was treated with a restriction enzyme that cleaved in the linker distal to the primer and the promoter fragment. The strands were then disassociated by gel electrophoresis by using 50 mM NaCI-1 mM EDTA-50 mM NaOH as the running buffer, and the single-stranded promoter fragment was isolated by electroelution. For the Si reaction, 130,000 cpm of probe was annealed to 25 to 40 ,ug of total RNA isolated from the different cell lines in 80% formamide-0.02 M piperazineN,N'-2-bis(ethanesulfonic acid) (PIPES; pH 6.4)-0.4 M NaCI-1 mM EDTA in a total volume of 10 ,ul. The annealing mixture was incubated sequentially at 70°C for 3 min and at 45°C for 3 h. Ten units of Si nuclease in 200 R1 of digestion buffer (0.03 M sodium acetate [pH 5.0], 0.25 M NaCl, 0.001 M ZnSO4, 5% glycerol) was then added, and the mixture was incubated at 25°C for 10 min. The reaction mixture was brought to 8 mM EDTA to stop the reaction and was extracted with phenol-chloroform. The digestion products were then precipitated with ethanol and run on a 6% sequencing gel. The primer extension reactions utilized the CD4 5' untranslated region oligonucleotide primer described above. The primer was labeled with 32P as described above, annealed to 24 ,ug of total RNA in 2 mM Tris (pH 7.8)-0.2 mM EDTA (pH 8.0)-0.25 M KCl in a total reaction volume of 15 pI for 2 min at 75°C, and allowed to cool to 42°C. Twenty units of RNAsin was added to the reaction mixture, and the mixture was incubated for 1 h at 42°C. The extension reaction was initiated with the addition of 20 U of avian myeloblastosis virus reverse transcriptase and 23 ml of an extension mix containing 11 mM Tris (pH 8.0), 5.6 mM MgCl2, 56 pug of actinomycin D per ml, 2.8 mM dithiothreitol (DTT), and 0.2 mM deoxynucleoside triphosphates and incubated at 37°C for 1 h. The extension products were then precipitated with ethanol and sized on a 6% sequencing gel. Cell maintenance and transient transfections. The D10, C.F6, L3, and CTLL-2 T-cell clones were grown in EHAA medium supplemented with 10% fetal calf serum, glutamine, 50 ,uM ,B-mercaptoethanol, and 100 U of human recombinant IL-2 (kindly provided by Cetus Corp.) (71) per ml. The D10 TH cell clone was stimulated every 14 days with antigen as follows: 106 resting T cells were added to 107 irradiated B1O.A spleen APCs and 100 pug of conalbumin per ml in a total volume of 10 ml of medium without IL-2; this stimulation mix was then incubated in a T25 tissue-culture flask upright in a 5% CO2 incubator for 2 days; the cells were then split 1:5 into medium containing 100 U of IL-2 per ml. The C.F6 TH clone was stimulated in a similar manner except that the initial stimulation contained 107 resting T cells, 5 x 107 irradiated B1O.A spleen APCs, and 30 jig of whole
1594
SIU ET AL.
MOL. CELL. BIOL. 5kb
A.)
CD4 gene U9
Bam HI
a
*
III
* II
1I
Bgl
Cia I
II
I I
Eco RI
Eco RV
IXI
HindM
II I
nhoI
J4
pJi4
B.) V 4-415 VI TCTAGAACAGCCGACTTAGTGGATCTGTTGGGAATCTAAATTTTCCATTGATTAAATTG
TTTTTTT
A-336 AAAACATGGCATTACTGCATAGGCAGCCTAGTCTGGCCTTGAGCTTGTGATTTTTCTGCsTAAATCACCCAGTGCTGGGG
A-265 III IV TTAtAQ1C2rATGCCCGTGCCCGTGCCCGTGCCTGTAAGCCTTGCCTCWLTM3&CCTAACCAGGCTGTTTCAGCTTTTT A-101
A-141
ACGGCACCAAACAATAGTGACATTCCAGACTCCAGCTTGATTCTGCTCAGGCATTTTCAG-GACTTTGGCATTTTTAATT
_-54 4-22 GGGTGGGAGGGAGGGACTCCTGAGGGCTGGCTTACGTCCGCCGTGCAGAGGAGCCTCA
I
U
TTTZ==C-CCAA
v
v
4A+36
CGACCAGGCTTCCTGTCTTTTCATTTACGAACATCTGTGAAGGCAAAGCAAGACTCTCTTCTTCACTAGGTACCTGTTTG Xbo I CAAAGTCTCGAG
FIG. 1. (A) Genomic cosmid clone containing the murine CD4 gene. Black boxes indicate exons of the CD4 gene; the arrow indicates transcription orientation. pJ4BX9 is a 1.0-kb BglII-XhoI restriction enzyme fragment that contains the 5' end of the CD4 mRNA and immediate 5' flanking region. (B) CD4 promoter sequence. This sequence of the pJ4BX9 fragment extending from the XhoI restriction site in the 5' untranslated region to the XbaI restriction site at -415 has been published previously (19). Arrowheads indicate transcription initiation points. Deletion points indicated represent restriction enzyme sites used in promoter deletion studies. Boxed sequences indicate potential Myb recognition sites. All potential Myb recognition sequences either are perfect matches with the consensus Myb recognition site (3) or are 1-bp mismatches from the consensus but conserve the critical core AAC sequence.
pigeon cytochrome c per ml in 10 ml of medium without IL-2. The L3 Tc clone was also stimulated every 2 weeks; 106 resting T cells were added to 5 x 107 irradiated BALB/c spleen APCs in medium with 100 U of IL-2 per ml. The AKRlG1, S49, LK, DCEK, and HeLa cell lines were maintained in EHAA supplemented with 10% fetal calf serum and glutamine. The QT6 cell line was maintained in Dulbecco's modified medium supplemented with 10% fetal calf serum and glutamine. All cells except QT6 were transfected by the DEAE-dextran method. All T-cell clones were transfected 4 days after antigen stimulation and 2 days after the addition of IL-2. Cells (107 per transfection point) were washed in TS solution (25 mM Tris-HCl [pH 7.4], 137 mM
NaCl, 5 mM KCI, 0.7 mM CaCl2, 0.5 mM MgCl2) and resuspended in 1.5 ml of TS containing 3 pg of the construct plasmid DNA and 500 p,g of DEAE-dextran per ml. The transfection mixture was incubated at room temperature for 20 min, and the cells were subsequently washed once with TS, resuspended in 10 ml of growth medium, and incubated fQr 48 h prior to harvesting. QT6 fibroblast cells were transfected by a modified CaPO4 transfection technique (5). Approximately 2 x 106 QT6 cells were grown in a 10-cm tissue culture dish, washed once with PBS, and provided with 10 ml of fresh growth medium. Separately, a DNA mix was prepared by adding 10 ,g of DNA and 50 p,l of 2.5 M CaCl2 solution in a total volume of 500 RI to 500 ,ul of 2x
VOL. 12, 1992
BES buffer solution at pH 6.95 (2x BES is 50 mM BES [pH 6.95], 280 mM NaCl, and 1.5 mM Na2HPO4). The mix was incubated for 20 min at room temperature and added slowly dropwise to the plate of cells while the medium was gently swirled. Cells were incubated overnight at 37°C in a 3% CO2 atmosphere, washed twice, provided with fresh growth medium, and incubated overnight again at 37°C in a 10% CO2 atmosphere. Cells were then harvested as described below. Reporter assays. All cells were harvested, washed twice in lx PBS, and resuspended in 100 ,1u of 100 mM potassium phosphate (pH 7.8)-i mM DTT. Cells were then lysed by three freeze-thaw cycles, and the extracts were cleared of debris by centrifugation. Luciferase assays were performed as described previously (9). Ten microliters of cell extract was added to 250 ,1u of 25 mM glycylglycine (pH 7.8) and 15 mM MgSO4. The reaction was initiated by the injection of 100 ,ul of 1 mM luciferin and 100 ,l of 17.5 mM ATP (pH 7.5), and the light emission was recorded by a Monolight 2010 luminometer (Analytical Luminescence). Chloramphenicol acetyltransferase (CAT) assays were performed as described previously (40). Twenty microliters of cellular extract was combined with 40 ,lI of acetyl coenzyme A (3.5-mg/ml) in 0.25 M Tris (pH 7.8) buffer, 40 RI of 0.25 M Tris (pH 7.8), and 1.5 pl of [14C]chloramphenicol. The reaction mixture was incubated at 37°C for 4 h to overnight. The reaction products were extracted with 1 ml of ethylacetate; the organic phase was recovered and lyophilized to dryness, and the pellet was resuspended in 10 pI of ethylacetate. The sample was spotted on a thin-layer chromatography plate and run in a 200-ml chamber with a 9:1 chloroform/ methanol buffer. The plate was exposed to X-ray film overnight to visualize the reaction products. The radioactive spots on the plates were cut out and counted on a scintillation counter in order to quantify percent conversion. For the transactivation analyses, CAT assays were performed by the phase extraction method as described previously (57). Nuclear extract preparation. Nuclear extracts from cultured cells were prepared according to the protocol of Waterman and Jones (72). Cells were washed once in 1 x PBS-5 mM MgCl2 and resuspended in 4 packed-cell volumes of buffer H (10 mM Tris [pH 7.9], 10 mM KCl, 0.75 mM spermidine, 0.15 mM spermine, 0.1 mM EDTA, 0.1 mM EGTA, 2 mM DTT, 0.1 mM fluoride, 2 mg of benzamidine per ml, 1 ,ug of pepstatin per ml, 4 ,ug of leupeptin per ml, 10 ,ug of aprotinin per ml). The cells were swelled on ice for 15 min and lysed with 10 to 15 strokes (or more, as needed) of a Dounce homogenizer. The nuclei were pelleted at 3,000 x g for 8 min, washed once in buffer H, and resuspended in 4 packed-cell volumes of buffer D (50 mM Tris-HCl [pH 7.5], 10% sucrose, 0.42 M KCl, 5 mM MgCl2, 0.1 mM EDTA, 20% glycerol, 2 mM DTT, 0.1 mM phenylmethylsulfonyl fluoride, 2 mg of benzamidine per ml, 1 ,ug of pepstatin per ml, 4 ,ug of leupeptin per ml, 10 ,ug of aprotinin per ml). The suspension was stirred on ice in a cold room for 30 min and centrifuged at 25,000 rpm for 1 h in an SW28 rotor. The supernatant was recovered, and proteins were precipitated with 53% (NH4)2SO4 (0.33 g/ml of supernatant) and centrifuged at 16,000 rpm for 20 min in the SW28 rotor. The pellets were recovered and resuspended in 50 mM Tris-HCl (pH 7.6)-12.5 mM MgCI2-1 mM EDTA-1 mM DTT-20% glycerol-0.1 M KCI and desalted on a Bio-Gel P10 filtration column. The protein concentration of the resulting fractions was determined by the Coomassie blue assay (Pierce). Fractions containing protein were then pooled, realiquoted, and stored at -70°C.
Myb DIRECTS CD4 TRANSCRIPTION
1595
EMSA/UV cross-linking. The electrophoretic mobility shift assay (EMSA) protocol was based on the procedures of Marine and Winoto (41). End-labeled DNA probe was labeled as described above, using T4 polynucleotide kinase. Radiolabeled DNA probe (2 x 104 cpm) was added to 8 ,ug of nuclear extract and 2 to 4 ,ug of poly(dI-dC) per ml in a total volume of 20 ,ul of reaction buffer (10 mM N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid [HEPES]-KOH [pH 7.9], 50 mM NaCl, 5 mM Tris-HCl [pH 7.5], 15 mM EDTA, 1 mM DTT, 10% glycerol). The binding mix was incubated at room temperature for 20 min, and the complexes were subsequently resolved on a 4% nondenaturing polyacrylamide gel run in glycine buffer (190 mM glycine, 25 mM Tris-HCl [pH 8.5], 1 mM EDTA) for approximately 2 h. The gel was then dried and exposed to X-ray film overnight. For the cold competition experiments, nonradioactive oligonucleotides were added at 25- or 250-fold molar excess to the binding mix without the radioactive probe, and the mix was incubated at room temperature for 20 min. The radioactive probe was then added, and the EMSA was carried out subsequently as described above. For EMSA comparisons between the unmutated and mutated promoter regions, the reactions were carried out as described above except that the binding buffer contained 5 mM MgSO4 and 5 mM EDTA. For UV cross-linking, the EMSA binding reaction was carried out as described above and subsequently exposed to a short-wave (254-nm) UV light box for 1 to 8 h. Immunoprecipitations of the UV cross-linking reaction were carried out with either the rabbit anti-Myb BP2 antiserum (3a) or normal rabbit serum; the immunoprecipitates were then resolved on a 5% SDS-polyacrylamide gel, dried, and exposed to X-ray film overnight. Promoter mutagenesis. The CD4 promoter region between the MseI restriction site at -101 and the XhoI restriction site at +71 was cloned into the EcoRV site of pKS. The promoter was then digested with PJIMI, which cleaves within site I. The 3' overhanging ends were then blunt ended with T4 DNA polymerase, and an SphI linker (New England Biolabs) was inserted into this site. The mutants were screened by SphI digestion and DNA sequencing by using the sequencing kit from Pharmacia. Because of the imprecision of the T4 DNA polymerase, several mutants were obtained that had deletions of additional nucleotides. These constructs were selected for further mutagenesis in order to maintain the same number of nucleotides in the promoter region. These constructs were then digested with SphI, the 3' overhanging ends were again removed by using T4 DNA polymerase, and the mutants were screened by loss of the SphI site and DNA sequencing. The X series mutants were generated by oligonucleotide-directed mutagenesis as described by Kunkel et al. (34). Briefly, the -101/+71 promoter fragment or the single site I mutants were subcloned into the pKS plasmid vector (Stratagene), and singlestranded phage was generated in the dut ung Escherichia coli strain CJ236. An oligonucleotide containing the sequence 5'-AA!TTTTrCTTCTTCCCC-3' (synthesized by Research Genetics) was used to prime synthesis of the second strand by using T7 DNA polymerase. The extension mix was then transformed into the dut+ ung+ strain DH1, and mutants were identified by DNA sequencing. The mutant promoter fragments were then resubcloned into the psVOALA5' luciferase vector and transfected into T cells as described above.
MOL. CELL. BIOL.
SIU ET AL.
1596
B
4-
A.) 0
^
c..z-.
3-
* *
DIO CF6 * L3 E CTLL-2
._
lb
.
-
Cco'w v ._
lb
-d*
2I O-
4b
0 T
(C
C'
A
C A
FIG. 2. Utilization of multiple initiation points of transcription by the CD4 gene. Primer extension (A) and Si nuclease protection (B) analyses of RNA purified from D10, AKRlG1, and 22D6 cell lines are shown. For the primer extension analysis, the oligonucleotide primer used is complementary to the CD4 5' untranslated region starting at the XhoI restriction enzyme site (see Fig. 1B). Markers represent sequencing reactions using the same oligonucleotide as a sequencing primer. Arrows indicate extension products. For the Si analysis, the probe used is the pVOP promoter fragment labeled at the XhoI site; markers are as for the primer extension analysis. Arrows indicate protection products. No additional bands are observed (data not shown).
C"
Co-
1.2
B.)
1.0 ._ 0.8
*
Cu coI v
AKRIGI
* S49 * LK
-
0.6
ElleLa
m 0.4
0.2
RESULTS The CD4 gene utilizes multiple initiation points of transcription. Using a murine CD4 cDNA probe, we isolated a cosmid that contains the murine CD4 gene and flanking regions (Fig. 1A), and we subcloned and sequenced a 1.1-kb BglII-XhoI fragment that contains portions of the CD4 5' untranslated region and flanking region (Fig. 1B and data not shown). To identify the CD4 initiation point of transcription, we conducted both primer extension and Si nuclease analyses on mRNA isolated from the D10 CD4+ and the AKRlG1 CD4+ CD8+ T cells (Fig. 2). The CD4 gene utilizes three tightly clustered initiation sites for mRNA transcription, which we have designated the +1, +7, and +11 sites. Primer extension analysis indicates that all three positions are used, whereas we identify unambiguously the +1 and +11 positions by using only Si analysis; this slight difference probably reflects imprecision in the techniques. Analysis of the sequence present immediately 5' to the cap site indicates that although there is no consensus TATA sequence, several recognition sites for other transcription factors can be identified in the promoter region. For example, we have identified six potential binding sites for the Myb nuclear oncoprotein within the 415-bp region 5' to the initiation points of transcription, designated I to VI (Fig. 1B). These sites imply that the Myb transcription factor may play a role in CD4 transcription (see
below). The CD4 promoter is active in mature CD4+ T cells but not mature CD8+, immature, or non-T cells. To study CD4 promoter function and specificity, we cloned CD4 promoter fragments into the luciferase reporter gene construct psVOALA5' (9) and used these constructs to transfect T and non-T cells of different CD4 and CD8 phenotypes. Luciferase activity was determined as a measure of the transcriptional activity of each construct (Fig. 3). To ensure that transcription of these constructs initiates from the appropriate CD4 cap site in the promoter fragment, we used a synthetic oligonucleotide corresponding to the antisense sequence of a portion of the luciferase gene to perform primer extension analysis on RNA purified from transfected
0.0
Ith
cqs
cmn
w.uxr c)~~~~~~~~~~0 V)
0 c:o
(Construtcts FIG. 3. CD4 promoter function in cells of different CD4 and CD8 phenotypes. The relative activity of each CD4 promoter/enhancer combination reflects normalization to a control transfection of the luciferase gene under the transcriptional control of the human ,-actin promoter/enhancer, which was arbitrarily given a value of 1. Average absolute light units for the 0-actin promoter/enhancer construct transfection were approximately 20,000 for D10, L3, and CTLL-2, 8,000 to 10,000 for C.F6, AKRlG1, and S49, and 50,000 for HeLa and LK. Average light units for a promoterless construct were 100. The relative activities of each promoter deletion were then averaged together; error bars represent 1 standard deviation. All transfections were internally controlled for transfection efficiency in a reporter assay using a construct containing the CAT gene under the control of the thymidine kinase promoter. (A) CD4 promoter activity in mature T cells. All transfections were repeated three to nine times in all cell types. Constructs are described in Materials and Methods. Transfection data for the -415, -336, -265, and -141 deletions are not shown; we do not detect significant differences in activity between these deletions and the -101 deletion. (B) CD4 promoter activity in immature T and non-T cells. PE and SVE refer to the TCR p-chain enhancer and the simian virus 40 early enhancer, respectively. All transfections were repeated five to nine times. Data similar to those obtained with the -/- thymoma S49 and the +/+ thymoma AKRlG1 were obtained with the -/- thymoma SL12410 and the +/+ thymoma 1010 (data not shown). pVOPA-54 and PEpVOPA-54 were not tested in HeLa and LK cells.
cells (Fig. 4). The 1.0-kb BglII-XhoI fragment construct, referred to as pVOP, is capable of generating high levels of transcripts from the CD4 cap site in the mature CD4+ D10 and C.F6 TH cells. Indeed, expression appears to be almost twofold over the levels obtained by using a control vector that contains the luciferase gene and the human ,-actin
Myb DIRECTS CD4 TRANSCRIPTION
VOL. 12, 1992
A AA$.*
Competitor
-
Fold excess
-
Origin-
-
1597
Os OS M3 M4 M5 25X 250X
So
I
k.
_ _J
a T
Complex A Complex B_. Complex C
Lt
..911!
NS -i G
C
w
''
A
;il
B
4
Q_R _W Probe
