AIDS RESEARCH AND HUMAN RETROVIRUSES Volume 8, Number 12, 1992 Mary Ann Liebert, Inc., Publishers

Expression of Human CD4 in Transgenic Mice Does Not Confer Sensitivity to Human Immunodeficiency Virus Infection PATRICK LORES,1 VÉRONIQUE BOUCHER,2 CHARLES MACKAY,3 MARIKA PLA,4 HARALD VON BOEHMER,3 JACQUES JAMI,1 FRANÇOISE BARRÉ-SINOUSSI,2 and JEAN-CLAUDE WEILL3

ABSTRACT Transfection of the human CD4 molecule into mouse cells does not confer susceptibility to human immunodeficiency virus type 1 (HIV-1) infection.10 Expression of the human CD4 molecule in transgenic mice was seen to offer some new possibilities. However, transgenic mouse T cells expressing either the human CD4 receptor, or a hybrid human/mouse CD4 receptor alone or in conjunction with human major histocompatibility complex class I molecules, were refractory to in vitro HIV-1 infection. In addition, no infection was observed after in vivo HIV jnoculation to mice of these various transgenic lines. Injection of recombinant gpl60 viral protein to the transgenic mice did not alter their T and B cell populations. The existence of a dominant block in mouse cells that

prevents HIV entry is discussed.

INTRODUCTION

AN

ideal animal model system for studying the pathogenesis of human AIDS and for easily evaluating the efficacy of vaccines and therapeutic drugs has not yet been reported. Animals models have been described in primates''2 and cats,3 but to date most attempts to reproductively infect a variety of laboratory animals with human immunodeficiency virus (HIV) have failed. Some results have been reported on experimental HIV infection of rabbits4 or of reconstituted severe combined immune deficiency (SCID) mice engrafted with human cells,5 or of mice inoculated with HIV-infected cells,6 but the development of a rodent model that could support HIV infection would present many obvious advantages including availability, convenience, and low cost, all in an animal with a well-characterized immune system. Transfection of HIV proviral DNA into mouse cells or its introduction into transgenic mice is followed by viral replication, although less efficient than in human permissive cell lines.7'9 The mouse CD4 receptor, a homologue of the human

'Unité 257

CD4 receptor, does not bind HIV.10 Moreover, a syncytium cannot be formed by mouse cells expressing gpl60 with mouse cells expressing a transfected human CD4 cDNA, while the cell fusion occurs when the CD4-expressing cells are of human ' ' origin. When human CD4 is expressed in vitro at the surface of mouse cells, binding of HIV occurs but is not followed by

entry.I0

There may be several explanations for this absence of cell fusion: ( 1 ) Introduction of the human CD4 gene by transfection or retroviral infection may not result in proper integration of the CD4 receptor in the mouse cell membrane: it has been shown that biophysical membrane properties of cells may play a major role in their susceptibility to HIV infection.1213 (2) Upon binding of HIV in permissive human cells, a protein kinase C (PKC)-dependent phosphorylation of the CD4 receptor has been reported which may play a role in the process of viral entry.14 The homologous human and mouse CD4 molecules have significant differences in their intracellular domains,'5 and it is unclear whether human CD4 receptors can be activated by PKC when they are expressed in mouse cells. (3) Because some

de l'Institut National de la Santé et de la Recherche Médicale, Institut Cochin de

Saint-Jacques, 75014 Paris, France.

2Institut Pasteur, 25 rue du Dr Roux, 75724 Paris Cedex 15, France. 3The Basel Institute for Immunology, Grenzacherstrasse 487. CH-4005 Basel, Switzerland. "Centre Hayem, Hôpital Saint-Louis, Paris, France. 2063

Génétique Moléculaire,

24

rue

du

Faubourg

2064

LORES ET AL.

nonlymphoid human cells are susceptible to HIV upon expression of the CD4 receptor,10 a second still unknown species specific molecule ubiquitous in most human cell types might be necessary for viral entry. In order to test these different possibilities we have produced and assayed for ability to support HIV infection several types of transgenic mice expressing the extra-

cellular domain of the human CD4 receptor either alone or in with a human major histocompatibility complex (MHC) class I molecule.

conjunction

Plasmid constructions

pBXT4.

The 3-kb Eco RI fragment of the human CD4 cDNA the plasmid was ligated to the 4.1-kb Eco '7 RI-Nru I fragment encompassing the mouse H-2Kb promoter. The H-2-CD4 fragment was ligated to the Bgl II site of the

pT4b,16)

EV142 cDNA expression vector's upstream of a 0.6-kb human growth hormone (hGH) gene fragment. This hGH fragment includes the 3' untranslated region of exon 5, the polyadenylation signal, and 3' flanking sequence. This generated the pBXT4 plasmid. A 4.3-kb Hind III-Eco RI fragment purified from this plasmid was used for microinjections. This fragment contains the human CD4 gene under the control of the H-2 promoter and the 3' region of the hGH gene (Fig. 1). Human/mouse CD4. The 0.6-kb Bgl H-Eco RI hGH gene fragment from the plasmid EV142 was ligated to pUC8 cut at the Bam HI and Eco RI sites. The pUC8hGH plasmid was cut at the Hind III and Pst I sites of the poly linker and ligated to a 0.8-kb Xmn I-Pst I 3' fragment corresponding to the carboxy-terminal '5 part of the mouse CD4 cDNA and to a Hind III-Nhe I fragment (from pBXT4) blunted at the Nhe I site, containing the H-2K promoter and the amino-terminal part of the human CD4 cDNA. In the resulting human/mouse hybrid CD4 gene, the blunted Nhe I/Xmn I ligation between the two cDNAs was checked by A

promoter

Hindlll

B

hCD4

(Nrul/Smal) (BamHI/EcoRI)

promoter

(EBV)-transformed human B cell line (not shown).

Cytofluorometric analysis Transgenic mice were checked for expression of human CD4 using immunofluorescence and a FACScan flow cytometer. Cell suspensions were prepared from spleen, thymus, and lymph nodes, and were stained with fluorescein isothiocyanate-conjugated anti-CD4 monoclonal antibody (OKT4a, Ortho Diagnostics, Raritan, NJ)

and an anti-mouse MHC class I (Cedar Lane Laboratories Limited, Hernby, Ontario). Mouse T cell subsets were identified using mouse CD4 and CD8 monoclonal antibodies (Becton Dickinson & Co., Mountain View, CA).

Cell preparation

Nhel

(BamHI/Bglll)

hmCD4 fusion cDNA Pstl

mice

were

stimulated with 2

u-g/ml

of concanavalin A

(ConA) in Dulbecco's modified Eagle's medium (DMEM) containing 10% fetal calf serum (FCS) and 50 U/ml recombinant human interleukin 2 (1L-2) (gift of F. Sinigaglia, Roche, Basel).

cDNA_hGH

(Nrul/Smal) (BamHI/Eco RI) (Nhel/Xmnl)

FIG. 1.

Human CD4 (hCD4) and human/mouse CD4 (hmCD4) transgenic mice were obtained and characterized as described.19 Trangenic mice expressing both the human CD4 receptor and MHC class I antigens were obtained by crossing human CD4 transgenic mice and transgenic mice carrying both human class I heavy (HLA-B27.2) and light (ß2-microglobulin ) chains.20 The level of expression of human class I antigens in our transgenic mice was similar to its expression in an Epstein-Barr virus

genic

EcoRI

human-mouse CD4 4.0 kb H2IC

of transgenic mice

Transgenic mouse cells. Lymph node cells from hCD4 trans-

human CD4 4.3 kb

H2Kf)

site. The Hind III-Eco RI 4-kb fragment (Fig. 1 ) purified from this plasmid was used for pronuclear microinjections. This fragment contains a composite cDNA coding for a fusion human/mouse CD4 molecule made of the two amino-terminal extracellular domains of the human CD4, the rest of the molecule belonging to the mouse CD4.

Production

MATERIALS AND METHODS

(from

sequencing ensuring that the correct reading frame was restored in the composite cDNA, generating a GGG codon at the junction

hGH (BamHI/Bglll)

Structure of human CD4 (A) and human/mouse CD4 (B) DNA fragments used for generation of transgenic mice. Indicated segments of hybrid genes are: (1) sequence (-2017, +9) of the mouse H-2Kb regulatory and promoter sequences (hatched boxes), (2) human CD4 cDNA (black box), either complete in human CD4 construct or its 5' part fused to the 3' part of the mouse CD4 cDNA (grey box) in the human/mouse CD4 construct, and (3) polyadenylation signal sequence contained in human growth hormone gene (open box).

Cultures were maintained by further stimulation with ConA in the presence of a feeder layer of splenic cells irradiated with 3000 rads. In some experiments, CD8+ T cells were removed from the cultures after the addition of mouse CD8 monoclonal antibody and panning on sheep anti-rat Ig-coated Petri dishes. The efficiency of depletion was monitored by FACS analysis.

Binding of recombinant gpl60 by transgenic lymphoid cells Lymph node cells (106) from hmCD4 transgenic

mice were incubated in the presence of various concentrations of recombinant soluble gpl6021 in DMEM plus 10% FCS at 37°C for 4 h. Cells were then washed and incubated with biotin-conjugated CD4 monoclonal antibody (OKT4a) followed by avidin-phyoerythrin (Becton Dickinson), and were then analyzed with a FACScan flow cytometer.

HUMAN CD4 TRANSGENIC MICE

Infectivity studies Virus supernatants from CEM cells releasing high levels of HIV-1 (LAI strain) were used for infectivity studies. Cells were infected with HIV-1/LAI at multiplicities of infection ranging from 0.01 to 0.1, then washed extensively, and placed at 106 cells/ml in DMEM containing 10% FCS and recombinant IL-2. Twice a week, culture supernatants were tested for reverse transcriptase (RT) activity as previously described22 and for viral antigen expression by using a capture immunoassay (ELAVIA Ag, Diagnostics Pasteur). At different intervals after infection, virus-inoculated cells and control cells were examined for HIV-1 proviral DNA by polymerase chain reaction (PCR) and for viral RNA expression by in situ hybridization. On day 6 after viral inoculation, an aliquot of infected cells was also cocultivated at a ratio 1:3 with phytohemagglutinin (PHA)stimulated human peripheral blood lymphocytes (PBL) from a seronegative donor. The cocultures were maintained in RPMI1640 medium supplemented with 10% FCS and recombinant lectin-free IL-2. Coculture supernatants were checked twice a week for RT activity and for viral antigen for up to 30-40 days.

PCR

analysis

On days 6, 10, and 17 after infection, DNA was extracted from both infected and noninfected cells and subjected to PCR using two pairs.ofprimers. The first pair corresponded to HIV-1 longterminal repeat (LTR) primers designated SK29 and SK30.23 The second pair was selected to bracket a sequence in the gag region according to published HIV-1 sequences.24 The sequences of these oligonucleotides were, respectively, (5' GGCAAATGGTACATCAGCCATATC 3') and (5' TCTGCAGCTTCCTCATTGATGGTCT 3'). One microgram of the DNA samples was

amplified as described.23

In situ

hybridization

In situ hybridization lished procedure.25

Inoculation

was

performed using a previously pub-

of transgenic mice

with HIV-1

Transgenic mice were inoculated either intraperitoneally (IP) intracerebrally (IC) with various concentrations of HIV-1/ LAI (0.1-10 TCID50) or with 105 CEM-infected cells. Control animals consisted of 2-mo-old nontransgenic (C57BL7 6 x CBA/He)Fl male and female mice injected with infectious virus, and transgenic mice inoculated either with heat-inactivated virus or with a diluted pellet from noninfected CEM cell or

supernatant,

or

with noninfected CEM cells. At intervals of

postinfection, serum samples were tested for HIV-1 antibodies by enzyme-linked immunosorbent assay (ELAVIA Ab, Diagnostics Pasteur) and for HIV-1 antigenemia. Every other week after infection, blood, spleen, lymph nodes, and in some cases liver, brain, lungs, thymus, and bone marrow were harvested and divided into portions for virus isolation22 and for PCR analysis using both LTR and gag primers. HIV inoculations were performed within an L3 security level laboratory. All the inoculated animals tained in cages facility. Before

were

transferred to and mainwithin the L3 the mice were

placed in glovebox isolators being individually taken out,

2065

either anesthetized for examination and blood drawing, for collection of tissues in a laminar flow hood.

hCD4

or

killed

transgenic mice injected with gpl60

hCD4 transgenic mice were immunized with gp 160 according following protocol: (1) 50 u,g of gpl60 in 0.2 ml in complete Freund's adjuvant (CFA) subcutaneously, (2) 5 wk later, the same injection in incomplete Freund adjuvant (IFA), (3) 1 mo later 50 u.g of gpl60 in 0.5 ml intravenously, (4) 1 wk later same as in step 3. Five hCD4 transgenic mice and five control littermates were injected in parallel. Three hCD4 transgenic mice were also injected with: (step 1) PBS-CFA, (step 2) PBS-IFA, and (steps 3 and 4) PBS. to the

Analysis of the with gpl60

hCD4

transgenic mice injected

One week after the last injection, lymph node and spleen cells were removed from the hCD4 and control mice, and the number of B cells was determined. T cells (B cell-depleted by anti-Ig column) were cultured with 5 X 10s X-irradiated cells (300 rads) from BALB/c mice in the presence of either ConA (2.5 u-g/ml), or antibodies against the CD3 complex (500-A2,26 7 + u.g/ml) or the T cell receptor (TCR) ß chain (H57-597,27 6 p-g/ml) or in the presence of gpl60 (10 p.g/ml). After 3 days of culture, uptake of [3H]thymidine (specific activity 5 Ci/u,M) was measured as described.28

RESULTS

Transgenic mice Two types of transgenic mice were produced, expressing either the human CD4 receptor (hCD4) or a hybrid human/ mouse CD4 receptor (hmCD4), each under the control of a mouse H-2Kb promoter (Fig. 1). The hCD4 transgenic mice were crossed with transgenic mice expressing the human HLA B27 heavy chain and ß2-microglobulin and the resulting Fl mice expressed the CD4 receptor together with human MHC class I molecules. Human CD4 expression was strongest in spleen and lymph nodes, and weakest in thymus (Fig. 2, upper rows). As a consequence of the promoter used, CD4 expression correlated with the expression of endogenous MHC class I and was therefore positive on both T and B cells. The proportions of T cell subsets in transgenic mice and expression of endogenous cell surface molecules, such as mouse CD4, CD8 (Fig. 2, lower row), MHC class I, and MHC class II (not shown) were identical to those seen in nontransgenic mice. Similar results were obtained in both hCD4 and hmCD4 transgenic mice. The expression of human CD4 was approximately five times lower in activated hCD4 mouse T cells than in human T4 cells. Two hCD4 and one hmCD4 transgenic lines (all derived from microinjected (C57BL/6xCBA/HE)F2 zygotes) were selected for further experiments. Mice homozygous or heterozygous for the transgene were used. The capacity of hmCD4 transgenic cells to bind HIV-1 was assessed with recombinant gpl60 glycoprotein. As shown in Fig. 3, gpl60 competed with OKT4a in a dose-dependent

LORES ET AL.

2066

Thymus

Lymph node

Spleen

h. CD4 transgenic mice

o

normal mice

human CD4 FITC

2

Ü

8

h. CD4 transgenic mice

mouse

CD8 FITC

(Upper rows) Expression of human CD4 protein on lymphocytes from human CD4 transgenic mice. Lymphocytes from lymph node, spleen, and thymus from either transgenic (top) or nontransgenic mice (bottom) were reacted with anti-human CD4-FITC (green fluorescence, x-axis) and with anti-mouse MHC I-biotin followed by avidin-phycoerythrin (red fluorescence, y-axis). Quadrants were constructed according to control antibody staining. Human CD4 expression by transgenic lymphocytes (under the control of the H-2 promoter) paralleled MHC class I expression on peripheral lymphocytes and thymocytes. (Lower row) Normal expression of mouse CD4 and CD8 on human CD4 transgenic lymphocytes. Cells were stained with anti-CD4phycoerythrin and anti-CD8-FITC, and showed the typical two color staining pattern as seen for lymph node, spleen, and thymus from nontransgenic mice (not shown). FIG. 2.

for binding to hmCD4 transgenic lymphocytes, although at the gpl60 concentration used, complete inhibition of OKT4a binding was not observed. manner

infection of activated T cells from CD4 transgenic mice

HIV-1

To determine the susceptibility of CD4 transgenic mouse cells infection by HIV-1, ConA-stimulated mononuclear cells obtained from hCD4, hmCD4, and hCD4 x HLAB27-ß2M mice were inoculated with HIV-1 at multiplicities of infection (MOI) of 0.01 and 0.1. Lymphoid cells from normal mice were studied in parallel. There was no evidence of viral expression in cell free supernatants of long-term infected cultures, as determined by the absence of RT activity and viral antigen (Fig. 4). Moreover, in situ hybridization did not detect any viral mRNA in inoculated culture cells (data not shown). However, p25 antigen could be detected in the cultures soon after infection, and RT activity was detectable on day 3 in the supernatants of cells exposed to a high amount of virus (MOI 0.1). Such transient detection early after infection could have been the result of to

residual viral antigens from the inocula. This idea is supported by the absence of RT activity in the supernatants of PHAstimulated human PBL cells cocultivated with the infected transgenic mouse cells, starting on day 6 after viral inoculation. The absence of viral production by infected mouse cells expressing human CD4 was also found in the case of hmCD4 and hCD4 x HLA B27-ß2M cells after depletion of the CD8+ T cell population. To determine whether some HIV-1 might have entered the transgenic cells and integrated into their genome, DNA from cultures inoculated with 0.01 MOI were subjected to PCR. The presence of HIV-1 proviral DNA could not be detected in infected cells from the three transgenic mouse types (data not

shown). Inoculation

of human

CD4

transgenic mice with HIV-1

The susceptibility of transgenic mice to in vivo HIV-1 infection was examined in three series of inoculations. Each group consisted of 5 or 10 animals, except for the hCD4 x HLA B27-ß2M group which comprised 3 animals. hCD4 and hmCD4

HUMAN CD4 TRANSGENIC MICE

2067

0gp160 Mm A 'Whs, i

jj

r

A i*i

i

ü

J

i .

i

JUT1

9^ggP1 60

V

O

E

27yggp160

c

Ué

was

as

well

as

gpl60

DISCUSSION

Y

A=L

or TCR ß chain antibodies, similar in both types of mice (Table 1).

by ConA, CD3,

tat.

anti-human CD4

FIG. 3. Lymphocytes from human/mouse CD4 transgenic mice bind gpl60. Lymphocytes were incubated with either 0, 9, or 27 u.g/ml of gpl60 for 4 h and were then stained with OKT4a-biotin followed by avidin-phycoerythin. Fluorescence intensity of OKT4a staining was assessed by flow cytometry.

mice were 1-3 mo old, whereas CD4 x HLA B27 mice were 6-8 mo old at the time of inoculation. Inoculated animals were examined at regular intervals from up to 6 mo for the presence of antibodies to HIV-1 and of viral antigen in their sera. The 18 animals that were scored were all negative. The presence of HIV-1 in circulating PBL and in lymph node biopsies was explored by measuring RT activity after cocultivating mouse cells with normal human PBL. No virus could be isolated from the mouse specimens collected every 2 wk during the first 2 mo, and in one mouse, 4 mo postinoculation. In total, 11 mice were examined. PCR analysis of mouse DNA prepared from several organs of 11 inoculated animals failed to reveal any HIV-1 pro viral DNA. In another attempt, 5 x 105 HIV-1-infected CEM cells were inoculated IP into four newborn and five adult transgenic hCD4 mice, respectively. There was no evidence of HIV-1 infection, and PCR analysis of DNA from different organs for one animal from each group was negative.

Injection of CD4 transgenic mice with gpl60 After immunization with gpl60 followed by injection

of soluble gpl60, hCD4 transgenic mice had very similar numbers of B cells in lymph nodes and spleen as in control mice (not shown). In addition, the in vitro proliferation of T cells induced

We have investigated the possibility that introduction of the human CD4 molecule in the mouse germline may confer susceptibility to HIV infection. Introduction of the human CD4 molecule by in vitro retroviral infection did not confer to mouse cells susceptibility to HIV infection.10 Transgenesis offered several advantages when compared to transfection or retroviral infection: the insertion of the human CD4 receptor into the cell membrane during normal mouse development, access by using the ubiquitous H-2 promoter to drive expression to many different mouse cellular populations, and the possibility to coexpress different receptors at the surface of mouse cells easily by crossing the CD4 transgenic mice with other specific transgenic mice. The presence of the human CD4 molecule did not seem to alter murine T cell development in our transgenic mice and allowed mouse T cells expressing the human CD4 transgene to bind HIV-1 gpl60. Controversial results whether HIV binding induces phosphorylation of a cytoplasmic domain of CD4 that 31 might influence the entry of the virus29 prompted us to replace the human carboxy-terminal region of the transgene, which is not involved in HIV binding by the mouse CD4 carboxy-terminal region. T cells from transgenic mice expressing either the human CD4 receptor or a fusion human/mouse CD4 protein could not be infected with HIV. To test the possibility that a second molecule present in all human cells might participate with CD4 in virus entry, suggested by the observation that HeLa cells become sensitive to HIV infection when they express the CD4 receptor,10 we crossed hCD4 with HLAB27/ß2M transgenic mice. Expression of these molecules at the surface of Fl mouse T cells failed to confer susceptibility to HIV infection. This result was in agreement with the block of fusion of CD4-bearing mouse cells with HIV gp 160-expressing cells even when the former cells expressed human MHC class I ' ' or class II. To address the proposition suggesting the requirement of multiple accessory human cellular components for viral entry, Tersmette et al.32 have tested different human X mouse T cells hybrids expressing human CD4, which had retained all the human chromosomes. Upon challenge with HIV, in no case was an infection obtained. Similar negative results had been obtained by us, using a series of human x mouse fibroblast hybrid clones well characterized for retention of various combinations of most of the human chromosomes, transiently transfected by CD4 cDNA (unpublished observations). This promoter allows ubiquitous expression in transgenic mice, particularly in liver, kidney, heart, and lymphoid organs.33 This feature might therefore reveal susceptibility to HIV infection of nonlymphoid mouse cells. After different protocols of in vivo inoculation, we never observed a viral expression in these different transgenic mouse lines. Several authors have proposed models for the immunodeficiency associated with HIV infection which do not require that the majority of T cells are infected with the virus. For instance, the gpl20 protein could bind to CD4 of T cells, and after internalization, associate with class II molecules and thus form a

2068

LORES ET AL. (A)

(B) HIV Ag

RT .

HIV

RT 10

Ag

(C)

RT

HIV

Ag -12

jn'rOOO-

10

0

10 20 30 40 50

0

10 20 30 40 50

DAYS

(D)

RT

0

HIV Ag

0

10 20 30 40 50

DAYS

RT

(E)

HIV

DAYS

10 20 30 40 50

DAYS

DAYS

HIV

Ag

loVooo--, 2

\0f~°-r2

10 20 30 40 50

(F)

RT

Ag

0

10 20 30 40 50 DAYS

FIG. 4. HIV-1 infection of transgenic mouse cells. ConA-activated mononuclear cells from both transgenic or nontransgenic animals were infected with HIV-1/LAI. Virus expression by infected cells was monitored by measuring RT (•) and P25 antigen (O) in cell free supernatants and by measuring RT in coculture experiments with PHA-stimulated human PBL ( ). RT is expressed in cpm/ml of supernatant; antigen detection is represented by OD at 492nm. (A) cells from a normal mouse (MOI 0.01); (B) Human CD4 transgenic mouse cells (MOI 0.1); (C) Human CD4 HLAB27 transgenic cells (MOI 0.1); (D) Human/mouse CD4 transgenic cells (MOI 0.01); (E) Human/mouse CD4 transgenic cells (MOI 0.01); (F) Human/mouse CD4 transgenic cells depleted in CD8+ T cells (MOI 0.1). All RT values indicated under the dashed lines are considered as negative. =

=

=

=

=

=

Table 1. Results

Responding T cells ahCD4 transgenic«—gp 160 5 X 103 5 x 104 5 x 105 bcontrol littermate«— gpI60 5 x 103 5 x 104 5 x 105 chCD4 transgenic«—adjuvant 5 5 5

x x

x

103 104 105

of

Immunizations

of

gpl60

Anti-ß

Con A

Anti-CD3

118,300 313,300 350,500

142,900 271,700 230,400

40,000 82,400 86,700

41,900

141,400 132,500

4,000 44,900 49,200

100 810

98,400 282,300 374,000

122,700 315,400 342,800

TCR

gp!60

1,300 2,900

300

100 100 400

6,200

100 140 300

100 200 100

18,400 52,200 61,200

100

1,000 4,000

100 200 400

aCD4 transgenic and bnontransgenic control littermates were immunized with gp 160 and further

challenged with two injections of soluble gpl60. CCD4 transgenic mice were immunized with adjuvant and further challenged with PBS. Various numbers of purified T cells were cultured in the presence of ConA (2.5 u-g/ml), CD3 antibody (7 p-g/ml), TCR ß antibody (6 p-g/ml), orgpl60 (10 u-g/ml) and uptake of thymidine was measured (see Materials and Methods).

2069

HUMAN CD4 TRANSGENIC MICE

ligand which can be recognized by class II restricted T cells; the latter develop into cytotoxic cells and destroy gpl20 presenting T cells.34'35 On the other hand, binding of gpl20 to CD4 at the surface of T cells could induce negative signals, preventing activation of these cells by antigen.36~38 We have performed preliminary experiments to test these hypotheses by injecting CD4 transgenic mice with recombinant gpl60. Anti-human CD4 antibodies block in vitro T cell proliferation mediated through CD3-TCR triggering,13 thus showing that the human CD4 molecule is functional on T cells in these transgenic mice. Because class II MHC molecules are not expressed on murine T cells, we took advantage of the transgenic CD4 expression on B

cells which do express these class II receptors. Because in the transgenic mice the CD4 may be expressed by many different tissues whereas our concern was the CD4 expressing hemopoietic cells only, we also tested hemopoietic chimeras prepared with bone marrow cells from hCD4 transgenic donor. Immunization of the hCD4 transgenic mice with gpl60, followed by injections of soluble gpl60, did not induce any reduction in the number of B cells in both lymph nodes and spleen. In addition, in vitro T cell proliferation induced by ConA, CD3, or TCR ß chain antibodies, as well as gpl60, was very similar in both hCD4 transgenic and control mice after gpl60 treatment. Thus, by this preliminary test, we could not find support for one or the other hypothesis explaining the immunodeficiency of AIDS patients despite the fact that most of their T cells are uninfected. Very^similar negative results were also obtained with hCD4 chimeras injected with soluble gpl60 alone or with supernatant from virus-infected human cells. These preliminary experiments do not rule out any of the hypotheses since we cannot be sure how long and in what quantity the gpl60 is present in the experimental animals. Further attempts will involve the construction of mice which express gpl20 constitutively. Infection of human peripheral blood lymphocytes by HIV-1 seems to occur mainly through the CD4 receptor (reviewed in Sattenau and Weiss39). However, relatively few CD4+ cells are actually infected.40_44 Moreover, paradoxical results on HIVsusceptible CD4~ and HIV-resistant CD4+ cell lines45"48 and also the reported role in either HIV adsorption or HIV fusion of some accessory molecules such as the LFA-1 adhesion receptor, Fc receptors, and cell membrane-associated glycolipids and proteases4953 tend to render the picture more complex. A family of human specific molecules could either independently or in various combinations along with the CD4 receptor be part of the fusion process taking place between the cell membrane and the virus envelope. In some rare cases during virus infection, the presence of some of these putative accessory molecules might allow virus entry even in the absence of the CD4 receptor.4548 Their total absence, on the other hand, could prevent viral entry into cells despite the presence of the CD4 receptor.45 It has been suggested that such accessory molecules could bind to various regions of CD4 outside the gpl20 binding domain and thus play a role in the cellular tropism observed

among different strains of HIV.54-56 Mouse cells do not possess the adequate receptor and the putative accessory molecules necessary for HIV binding and entry. They appear to be defective in factors necessary for a strong viral expression.57 Our results with transgenic T cells and those obtained on somatic cell hybrids (Ashorn et al.," Ters-

al.,32 and our unpublished observations) suggest that there may also be a dominant block in mouse cells at the step of viral entry. Although housekeeping genes from the parental cells normally remain active in somatic cell hybrids,58 it is difficult to formally exclude that some of these genes may become repressed. Such a dominant block to HIV infection," if confirmed, would be reminiscent of resistance to infection to influenza virus conferred by MX 1 proteins in a few strains of mice.59 It would also indicate that rodent cells cannot be used in experimental systems which are designed to uncover putative additional factors for HIV-1 infection. It could be of great basic and applied value to define a molecule that prevents HIV-1 mette et

entry.

ACKNOWLEDGMENTS This work was supported by the French Agence Nationale de Recherche sur le SIDA (ANRS). We particularly wish to thank F. Chapeville for allowing us to perform HIV infection of mice in the L3 facilities of the Institut Jacques Monod and G. Lefèvre and the members of the local Biosafety Committee for their guidance and support. We thank R. Axel for providing us with the pT4b plasmid, M. Kaczorek from Pasteur vaccines for the recombinant gpl60, K. Hafen and T. Leste-Lasserre for technical assistance, N. Schoeptlin for preparing the manuscript, and S. Abrignoni, A. Traunecker, P. Sonigo, R. H. Bassin, and S. Salahuddin for critical reading of the manuscript. The Basel Institute for Immunology was founded and supported by Hoffmann La Roche, Basel, Switzerland.

REFERENCES 1. Fultz PN, McClure HM, Swenwon RB, McGarth CR, Brodie A, Getchell JP, Jensen FC, Anderson DC, Broderson JR, and Francis DP: Persistent infection of chimpanzees with human T-Iymphotropic virus type III/Lymphadenopathy-associated virus: a potential model for acquired immunodeficiency syndrome. J Virol

1986;58:116-124. 2. Letvin NL, Daniel MD, Sehgal PK, Desrosiers RC, Hunt RD, Waldron LM, MacKey JJ, Schmidt DK, Chalifoux LV, and King NM: Induction of AIDS-like disease in macaque monkeys with T-cell tropic retrovirus STLV-III. Science 1985;230:71-73. 3. Pedersen NC, Ho EW, Brown ML, and Yamamoto JK: Isolation of a T-lymphotropic virus from domestic cats with an immunodeficiency-like syndrome. Science 1987;235:790-793. 4. Kulaga H, Folks T, Rutledge R, Truckenmiller ME, Gugel E, and Kindt TJ: Infection of rabbits with human immunodeficiency virus 1. J Exp Med 1989;169:321-326. 5. Namikawa R, Kaneshima H, Lieberman M, Weissman IL, and McCune JM: Infection of the SCID-hu mouse by HIV-1. Science

1989;242:1684-1686. 6. Locardi C, Puddu P, Ferrantini M, Parlanti E, Sestili P, Varano F, and Bellardelli F: Persistent infection of normal mice with human immunodeficiency virus. J Virol 1992;66:1649-1654. 7. Adachi A, Gendelman HE, Koenig S, Folks T, Willey R, Rabson A, and Martin MA: Production of acquired immunodeficiency syndrome-associated retrovirus in human and nonhuman cells transfected with an infectious molecular clone. J Virol 1986;

59:284-291.

LORES ET AL.

2070 8. Leonard JM, Abramczuk JW, Pezen DS, Rutledge R, Belcher JH, Hakim F, Shearer G, Lamperth L, Travis W, Fredrickson T, Notkins AL, and Martin MA: Development of disease and virus recovery in transgenic mice containing HIV proviral DNA. Science

1988;242:1665-1670. 9.

Levy JA, Cheng-Mayer C, DinaD, andLuciwPA: AIDS retrovirus (ARV-2) clone replicates in transfected human and animal fibro-

blasts. Science 1986;232:998-1001. 10. Maddon PJ, Dalgleish AG, McDougal JS, Clapman PR, Weiss RA, and Axel R: The T4 gene encodes the AIDS virus receptor and is expressed in the immune system and the brain. Cell I986;47:333-

348, 11. Ashorn PA, Berger EA, and Moss B: Human immunodeficiency virus envelope glycoprotein/CD4-mediated fusion of nonprimate cells with human cells. J Virol 1990;64:2149-2156. 12. Lehr HA, Zimmer JP, Hübner C, Ballmann M, Hachmann W, Vogel W, Baisch H, Hartter P, Albani M, Kohlschütter A, and Schmitz H: Decreasing binding of HIV-1 and vasoactive intestinal peptide following plasma membrane fluidization of CD4+ cells by

phenytion. Virology 1990;179:609-617.

13. Zimmer JP, Lehr HA, Hübner C, Lindner SG, Ramsperger R, Claussen M, Kohlschütter A, and Schmitz H: Effects of membrane lipid and fluidity modifications on HIV-1 infectibility of primate lymphocytes in vitro. Biosci Rep 1990;10:263-270. 14. Doyon L, Bernier J, and Sekaly RP: 1990. Study of T-cell differentiation using a CD4 transgenic mouse model. Abstract for the 10th International Conference on Lymphatic Tissues and Germinal Centers in Immune Reactions, Compiègne, France, p. 9. 15. Maddon PJ, Molineaux SM, Maddon DE, Zimmerman KA, Godfrey M, Alt FW, Chess L, and Axel R: Structure and expression of the human and mouse T4 genes. Proc Nati Acad Sei USA

1987;84:9155-9159. 16. Maddon PJ, Littman DR, Godfrey M, Maddon DE, Chess L, and Axel R: The isolation and nucleotide sequence of a cDNA encoding the T cell surface protein T4: a new member of the immunoglobulin gene family. Cell 1985;42:93-104. 17. Kimura A, Israël A, Le Bail O, and Kourilsky P: Detailed analysis of the mouse H-2Kb promoter: enhancer-like sequences and their role in the regulation of class I gene expression. Cell 1986;44:261272. 18. Low MJ, Hammer RE, Goodman RH, Habener JF, Palmiter RD, and Brinster RL: Tissue-specific posttranslational processing of pre-prosomatostatin encoded by a metallothionein-somatostatin fusion gene in transgenic mice. Cell 1985;41:211-219. 19. Bucchini D, Ripoche MA, Stinnakre MG, Desbois P, Lores P, Monthioux E, Absil J, Lepesant JA, Pictet R, and Jami J: Pancreatic expression of human insulin gene in transgenic mice. Proc. Nati Acad. Sei. USA 1986;83:2511-2515. 20. Pia M, Samaan A, Gillet D, Reboul M, Frangoulis B, Opoloski A, Chopin M, Degos L: 1990. Transgenic Mice and Mutants in MHC Research. Springer-Verlag, Berlin, pp. 173-178. 21. Kieny MP, Lathe R, Rivièr, Y, Dott K, Schmitt D, Girard M, Montagnier L, and Lecocq J-P: Improved antigenicity of the HIV env protein by cleavage site removal. Protein Eng 1988;2:219-225. 22. Barré-Sinoussi F, Chermann JC, Rey F, Nugeyre MT, Chamaret S, Gruest J, Dauguet C, Axler-Blin C, Vezinet-Brun F, Rouzioux C, Rozenbaum W, and Montagnier L: Isolation of a T lymphotropic retrovirus from a patient at risk for acquired immune deficiency syndrome (AIDS). Science 1983;220:868-870. 23. Kwok S, Mack DH, Mullis KB, Poiesz B, Ehrlich G, Blair D, Friedman-Kien A, and Sninsky JJ: Identification of human immunodeficiency virus sequences by using in vitro enzymatic amplification and oligomer cleavage detection. J Virol 1987;61:1690-1694. 24. Wain-Hobson S, Sonigo P, Danos O, Cole S, and Alizon M: Nucleotide sequence of the AIDS virus, LAV. Cell 1985;40:9-17.

25. David FJE, Autran B, Tran HC, Menu E, Raphaël M, Debré P, Hsi BL, Wegman TG, Barré-Sinoussi F, and Chaouat G: CD4 positive human trophoblast cells may explain transmission of HIV-1 infection from mother to child. Clin Exp Immunol 1992; in press. 26. Havran WL, Poenie M, Kimura J, Tsien R, Weiss A, and Allison JP: Expression and function of the CD3-antigen receptor on murine CD4+8+ thymocytes. Nature 1987;300:170-173. 27. Kubo RT, Born W, Kappler JW, Marrack P, and Pigeon M: Characterization of a monoclonal antibody which detects all murine ab T cell receptors. J Immunol 1989;142:2736-2742. 28. Schreier MH, Iscove NN, Tees R, Aarden L, and von Boehmer H: Cloning of killer and helper T cells: growth requirements, specificity and retention of function in longterm culture. Immunol Rev

1980;51:315-336. 29.

von Borstel RC II, Donovan NJ, Steimer KS, and Littman DR: Internalization of the human immunodefi-

Bedinger P, Moriaty A,

virus does not require the cytoplasmic domain of CD4. Nature 1988;334:162-165. 30. Fields AP, Bednarik DP, Hess A, and May WS: Human immunodeficiency virus induces phosphorylation of its cell surface receptor. Nature 1988;333:278-280. 31. Hoxie JA, Rackowski JL, Haggarty BS, and Gaulton GN: T4 endocytosis and phosphorylation induced by phorbol esters but not by mitogen or HIV infection. J Immunol 1988;140:786-795. 32. Tersmette M, van Dongen JJM, Clapman PR, De Goede REY, Wolvers-Tettero ILM, Van Kessel AG, Huisman JG, Weiss RA, and Miedema F: Human immunodeficiency virus infection studied in CD4-expressing human-murine T-cell hybrids. Virology

ciency

1989;168:267-273. 33. Morello D, Moore G, Salmon MR, Yaniv M, and Babinet C: Studies on the expression of an H-2K/human growth hormone fusion gene in transgenic mice. EMBO J. 1986;5:1877-1883. 34. Lanzavecchia A, Roosnek E, Gregory T, Berman P, and Abrignani S: T cells can present antigens such as HIV gpl20 targeted to their own surface molecules. Nature 1988;334:530. 35. Siliciano RF, Lawton T, Knall C, Karr RW, Berman P, Gregory T, and Reinherz EL: Analysis of host-virus interactions in AIDS with anti-gpl20 T cell clones: effect of HIV sequence variation and a mechanism for CD4+ cell depletion. Cell 1988;54:561-575. 36. Chirmule N, Kalyanaraman V, Oyaizu N, and Pahwa S: Inhibitory influences of envelope glycoproteins of HIV-1 on normal immune responses. J AIDS 1988;1:425-430. 37. Diamond DC, Sleckman BP, Gregory T, Lasky LA, Greenstein JL, and Burakoff SJ: Inhibition of CD4+ T cell function by the HIV envelope protein gpl20. J. Immunol. 1988;41:3715-3717. 38. Mann DL, Lasane F, Popovic M, Arthur LO, Robey WG, Blattner WA, and Newman MJ: HTLV-III large envelope protein (gpl20) suppresses PHA-induced lymphocyte blastogenesis. J Immunol

1987;138:2640-2644. 39. Sattentau QJ, and Weiss RA: The CD4 antigen: physiological ligand and HIV receptor. Cell 1988;52:631-633. 40. Brinchmann JE, Albert J, and Vartdal F: Few infected CD4+ T cells but a high proportion of replication-competent provirus copies in asymptomatic human immunodeficiency virus type 1 infection. J Virol 1991;65:2019-2023. 41. David D, Ho MD, Tarsem Moudgil MS, and Masud Alam MS: Quantitation of human immunodeficiency virus type 1 in the blood of infected persons. N Engl J Med 1989;321:1621-1625. 42. Psallidopoulos MC, Schnittman SM, Thompson LM III, Baseler M, Fauci AS, Lane HC, and Salzman NP: Integrated proviral human immunodeficiency virus type 1 is present in CD4+ peripheral blood lymphocytes in healthy seropositive individuals. J Virol

1989;63:4626-4631. 43. Schnittman SM, Psallidopoulos MC, Lane EC, Thompson L, Baseler M, Massari F, Fox CH, Salzman NP, and Fauci AS: The

HUMAN CD4 TRANSGENIC MICE reservoir for HIV-1 in human peripheral blood is a T cell that maintains expression of CD4. Science 1989;242:305-308. 44. Simmonds P, Balfe P, Peutherer JF, Ludlam CA, Bishop JO, and Brown AJL: Human immunodeficiency virus-infected individuals contain provirus in small numbers of peripheral mononuclear cells at low copy numbers. J Virol 1990;64:864-872. 45. Chesebro B, Buller R, Portis J, and Wehrly K: Failure of human immunodeficiency virus entry and infection in CD4 positive human brain and skin cells. J Virol 1990;64:215-221. 46. Clapham PR, Weber JN, Whitby D, Mclntosh K, Dalgleish AG, Maddon PJ, Deen KC, Sweet RW, and Weiss RA: Soluble CD4 block the infectivity of diverse strains of HIV and SIV for T cells and monocytes but not for brain and muscle cells. Nature

1989;337:368-370. Moudgil T, Vinters HV, and Ho DD: CD4-independent,

47. Li XL,

48.

productive infection of a neuronal cell line by human immunodeficiency virus type 1. J Virol 1990;64:1383-1387. Tateno M, Gonzalez-Scarano F, and Levy JA: Human immunodeficiency virus can infect CD4-negative human fibroblastoid cells.

Proc Nati Acad Sei USA 1989;86:4287-4290. 49. Harouse JM, Bhat S, Spitalnik SL, Laughlin M, Steffano K, Silberberg DH. and Gonzalez-Scarano F: Inhibition of entry of HIV-1 in neural cell lines by antibodies against galactosyl ceramide. Science 1991;253:320-323. 50. Hattori T, Koito A, Takatsuki K, Kido H, and Katanuma N: Involvement of tryptase-related cellular protease(s) in human immunodeficiency virus type 1 infection. FEBS Lett 1989;248:48-52. 51. HildrethJEK, andOrentasRJ: Involvement of a leukocyte adhesion

2071 receptor (LFA-1) in HIV-induced syncytium formation. Science 1989;244:1075-1078. 52. McKeating JA, Griffiths PD, and Weiss RA: HIV susceptibility conferred to human fibroblasts by cytomegalovirus-induced Fc receptor. Nature 1990;343:659-661. 53. Pantaleo G, Butini L, Grazioso C, Poli G, Schnittmann SM, Greenhouse JJ, Gallin JI, and Fauci AS: Human immunodeficiency virus (HIV) infection in CD4+ T lymphocytes genetically deficient in LFA-I: LFA-1 is required for HIV-mediated cell fusion but not for viral transmission. J Exp Med 1991;173:511-514. 54. Hwang SS, Boyle TJ, Lyerly HK, and Cullen BR: Identification of the envelope V3 loop as the primary determinant of cell tropism in HIV-1. Science 1991;253:71-74. 55. Kim S, Ikeuchi K, Groopman J, and Baltimore D: Factors affecting cellular tropism of human immunodeficiency virus. J Virol

1990;64:5600-5604. 56. O'Brien WA, Koyanagi Y, Namazie A, Zhao J-Q, Diagne A, Idler K, Zack JA, and Chen ISY: HIV-1 tropism for mononuclear phagocytes can be determined by regions of gpl20 outside the CD4-binding domain. Nature 1990;348:69-73. 57. Trono D, and Baltimore D: A human cell factor is essential for HIV-1 Rev action. EMBO J 1990;9:4155-4160. 58. Weiss MC, and Ephrussi B: Studies of interspecific (rat x mouse) somatic hybrids. II. Lactate dehydrogenase and b-glucuronidase. Genetics 1966;54:1111-1122. 59. Arnheiter H, and Meier E: MX proteins: antiviral proteins by chance or by necessity. New Biol 1990;2:851-857.

Address

24

rue

reprint requests to:

Dr. Patrick Lores Unité INSERM 257 CHU Cochin Port Royal du Faubourg Saint Jacques 75014 Paris, France