JUlY 1991, p. 3676-3680 0022-538X/91/073676-05$02.00/0 Copyright C) 1991, American Society for Microbiology JOURNAL OF VIROLOGY,

Vol. 65, No. 7

Expression of an Enhancer-Binding Protein in Insect Cells Transfected with the Autographa californica Nuclear Polyhedrosis Virus IEI Gene LINDA A. GUARINO* AND WEN DONG Department of Entomology and The Center for Advanced Invertebrate Molecular Sciences,

Texas A&M University, College Station, Texas 77843-2475 Received 14 November 1990/Accepted 3 April 1991

The baculovirus Autographa californica nuclear polyhedrosis virus contains an element known as homoloregion 5 (hr5) which is an enhancer of delayed-early viral gene expression. To begin to identify proteins that interact with hr5, DNA-protein interactions were analyzed by using extracts from Spodopterafrugiperda cells and a fragment of DNA containing the left half of the hr5 enhancer. This 252-bp DNA fragment contains two copies of a 30-bp direct repeat (DR30) and two copies of a 24-bp imperfect palindrome contained within a 60-bp direct repeat (DR60). Extracts prepared from normal S. frugiperda cells and cells transfected with pUC8 lacked enhancer-binding proteins. However, when gel shift assays were performed with extracts from cells transfected with a plasmid containing the viral trans-activator IEl gene, two DNA-protein complexes were formed. Both DNA-protein complexes were specifically inhibited by competition with a 60-bp oligonucleotide corresponding to DR60 but not by competition with a different oligonucleotide corresponding to DR30. Formation of the two complexes did not appear to involve cooperative interactions between binding proteins. When DR60 was used as a probe, a single complex was formed. To measure the enhancer activity of DR60, a reporter plasmid was constructed that contained DR60 cloned upstream of the reporter chloramphenicol acetyltransferase gene under the control of the delayed-early 39K promoter. Transient expression analysis indicated that the oligonucleotide increased expression of this gene 300-fold over the level obtained in the absence of any enhancer sequences. gous

The genome of Autographa californica nuclear polyhedrosis virus (AcMNPV) is a double-stranded, circular, covalently closed, supercoiled DNA molecule of approximately 128 kbp (for a review, see reference 1). The viral DNA consists primarily of unique sequences with the potential capacity to encode more than 100 proteins. In addition, five homologous regions (hrl to hr5) of approximately 500 to 800 bp in length are interspersed along the length of the genome (2, 6). In infected cells, viral genes are expressed in a temporally regulated, sequential fashion (1, 12). The immediate-early genes are expressed in the absence of de novo viral protein synthesis. Functional immediate-early gene products are required for the expression of delayed-early genes. The synthesis of late genes is coincident with the onset of viral DNA replication. The very late genes are maximally expressed during the occlusion phase, after the peak of late gene expression. Central to the understanding of temporal gene regulation in AcMNPV is the identification of transacting factors and cis-acting elements which control the expression of each class. For this purpose, a transient assay system was devised for the functional mapping of regulatory genes (7). A recombinant plasmid was constructed that contains the reporter gene encoding chloramphenicol acetyltransferase (CAT) under the control of the delayed-early 39K promoter (designated the 39CAT gene) and used to search for immediate-early genes regulating delayed-early gene expression (7). The immediate-early gene, IEl, was identified by this assay. In addition to 39CAT, IE-1 trans activates several other delayed early genes (9, 13).

*

Although IEl is necessary for the trans activation of delayed-early genes in transient expression assays, subsequent experiments have shown that it is not sufficient for maximal induction. When DNA containing hr5 cloned upstream of 39CAT was cotransfected with pIEl, CAT expression increased 1,000-fold. Besides its cis-activating capability, the hr5 enhancer exhibited other characteristics of viral enhancer elements, including orientation independence, position independence, the ability to regulate heterologous promoters, and the ability to increase the number of RNA polymerase molecules transcribing the linked gene (8). The nucleotide sequence of the 484-bp hr5 enhancer was determined, and two repeated sequences were found. There are six copies of a 24-bp inverted repeat, four of them contained within a 60-bp direct repeat (DR60), and three copies of a 30-bp repeat (DR30). cis activation of 39K by the hr5 enhancer requires IEl, although the enhancers have little effect on the expression of IE1. These results raise interesting questions concerning the nature of the interaction between TEl and the enhancer. Three possible mechanisms of action can be considered. One is that a host factor binds to the enhancer in the absence of IE1, but because transcription cannot occur in the absence of TEl, the effect of the enhancer is not observed. Another is that TEl interacts with (complexes with, induces, or modifies) a host factor, thereby enabling it to bind to enhancer sequences. Finally, it is possible that TEl activates directly through binding to the enhancer. To begin to investigate these possibilities, we tested extracts of Spodoptera frugiperda cells for the presence of factors which bind to the hr5 enhancer. Cells transfected with IEl express a protein which binds the hr5 enhancer, while normal S. frugiperda cells do not. Competition with specific oligonucleotides

Corresponding author. 3676

BACULOVIRUS ENHANCER-BINDING PROTEIN

VOL. 65, 1991

3677

A HindIll

MIUlI

agcttgcatgccACGCGTAAAACACAATCAAGTATGAGTCATAAGCTGATGTCATGTTTTGCACACGGCTCATAACCG 78 acgtacggTGCGCATTTTGTGTTAGTTCATACTCAGTATTCGACTACAGTACAAAACGTGTGCCGAGTATTGGC DR30 EcoRI

AACTGGCTTTACGAGTAGAATTCTACTTGTAACGCAC GATCAGTGGATGATGTCATTTGTTTTTCAAATC GAGATGATGTCATGTTTTGCACACGGCTCATA 180

TTGACCGAAMTGCTCATCTTMGATGAACAIGCGTGCTAGTCACCTACTACAGTAAACAAAAAGTTTAGCTCTACTACAGTACAAAACGTGTGCCGAGTAT IR24 DR30 EcoRI

EcoRV

AACTCGCTTTACGAGTAGAATTCTACGTGTAACGCACGATCGATTGATGAGTCATTTGTTTTGCAATATGAT TTGAGCGAAATGCTCATCTTAAGATGCACATTGCGTGCTAGCTAACTACTCAGTAAACAAAACGTTATACTA

252

IR24

B EcoRI

I R60

CTCATAACCGAACTGGCTTTACGAGTAGAATTCTACTTGTAACGCACGATCAGTGGATGA GAGTATTGGCTTGACCGAAATGCTCATCTTAAGATGAACATTGCGTGCTAGTCACCTACT IR24

DR30

CTGATGTCATGTTTTGCACACGGCTCATAA GACTACAGTACAAAACGTGTGCCGAGTATT

FIG. 1. (A) Nucleotide sequence of the 252-bp enhancer fragment used for gel retardation experiments. The conserved 24-bp palindrome (IR24) is indicated by a double-headed arrow; the 30-bp direct repeat (DR30) is indicated by a single arrow. Sequences in boldface indicate relevant restriction sites; sequences in lowercase are derived from the vector. (B) Sequences of the oligonucleotides used for competition assays.

indicates that the factor binds within the 60-bp conserved sequences (DR60). MATERIALS AND METHODS Cell culture and CAT assays. The conditions for cell culture and CAT assays have been described previously (5, 7, 17). Plasmid DNAs were purified according to the boiling procedure (10), precipitated with polyethylene glycol (11), and purified on cesium chloride-ethidium bromide gradients. Transfections with plasmid DNAs were performed according to method I of Summers and Smith (17). Preparation of cell extracts. Whole cell extracts were prepared by a modification of the procedure of Zimarino and Wu (18). S. frugiperda cells were grown to 106/ml in Spinner culture. For the initial experiments, 106 cells were plated in six-well plates (Coming) and transfected with 1 ,ug of pIE1 or pUC8 DNA exactly as described previously (7). After 24 h, cells were removed by scraping, washed twice in 1 ml of cold phosphate-buffered saline (PBS), and resuspended in 100-,u volumes of extraction buffer (10 mM N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid [HEPES; pH 7.2], 0.4 M NaCl, 0.1 mM EGTA, 0.5 mM dithiothreitol, 0.5 mM phenylmethylsulfonyl fluoride). The cells were incubated on ice for 10 min and then microfuged at 2,000 rpm for 2 min. The supernatant was removed and used immediately in gel retardation assays. For large-scale preparation of cell extracts, 500 ml of Spinner cells at 106 cells per ml were collected by centrifugation and resuspended in 125 ml of Grace's insect medium. An equal volume of transfection buffer (7) containing 500 ,ug of pIEl was added. After 2 h at 27°C, the cells were collected by centrifugation and resuspended in 500 ml of complete medium. The cells were incubated at 27°C for 24 h and then washed three times by centrifugation in 100 ml of PBS. The packed cell volume was measured, and then the cells were resuspended in 4 volumes of extraction buffer. After 10 min on ice, the cells were pelleted by centrifugation. The supernatant was adjusted to 20% glycerol and frozen at -70°C.

Extracts prepared in this way were active for over 6 months with no detectable loss in activity. Gel retardation assays. A 484-bp MluI fragment of hr5 was cloned into the MluI site of pIBI-24 (International Biotechnologies, Inc.). Probes were end labeled with T4 polynucleotide kinase at the HindIII site in the multiple cloning region (15). After digestion with EcoRV, the 252-bp fragment corresponding to the left half of hr5 was purified by electrophoresis on 5% polyacrylamide gels. The probe (10,000 cpm; approximately 1 pmol) was incubated with 5 ,ul of nuclear extract in a total volume of 20 ,ul of 10 mM Tris (pH 7.5)-100 mM NaCl-1 mM dithiothreitol-20% glycerol-1 p.g of poly (dI-dC) double-stranded heteropolymer (Boeringer Mannheim Biochemicals) for 20 min at 4°C. DNA-protein complexes (3, 4) were resolved on 5% polyacrylamide gels in 10 mM Tris (pH 7.5)-i mM EDTA. The gels were run for 4 h at 200 V at 4°C, dried, and exposed for 16 h to XAR film.

RESULTS Gel retardation analysis. To determine whether normal S. frugiperda cells contain factors that interact with the AcMNPV hr5 enhancer or whether the IEl gene product is required for binding, nuclear extracts were prepared from normal, mock-transfected, and pIEl-transfected cells. Gel retardation experiments were performed by using a 252-bp probe that contained the left half of hr5 (Fig. 1). This fragment contains two copies of the 24-bp palindrome contained within a 60-bp direct repeat (DR60) that is conserved in all five enhancer regions and two copies of the direct repeat (DR30) that is found in hr5 only (7). The hr5 fragment was 32P end labeled and incubated with the indicated amounts of nuclear extracts in the presence of poly(dI-dC). The resulting complexes were separated by electrophoresis on a nondenaturing polyacrylamide gel. Incubation of hr5 with the cell extract transfected with pUC8 did not result in the formation of specific complexes (Fig. 2). Identical results were obtained with extracts prepared from normal cells (data not shown). During the course of these experiments, we

J. VIROL.

GUARINO AND DONG

3678

hr5 IR 60 DR30 p_UC8 Lx 5 1 Ox 2x 5x 1 Ox 2x 5x lOx 20x 2x 5x 1 Ox 20x

Q

i FIG.

2.

and 6)

analysis

Gel retardation

Hindlll-EcoRV

fragment

.

was

4

of hr5. An end-labeled

incubated with

no

252-bp

cell extract (lanes 1

RId

(lanes 2 and 7), 2 (lanes 3 and 8), 3 (lanes (lanes 5 and 10) of crude cell extract from cells transfected with pUC8 (lanes 1 to 5) or pIEl (lanes 6 to 10).

4 and

or

9),

with 1 or

5

found that it

probe in the heating the DNA. In the absence of these precautions, a nonspecific complex was sometimes formed with the extracts prepared from normal cells. The formation of this complex was variable, and we believe it to be due to partial denaturation of the probe, which has a low G±C content (40%). This phenomenon has previously been reported in other systems (16). was

was

6

7

8

9

10

1

2

313 14

very important to maintain the

presence of 0.1 M NaCl and to avoid

When hr5

5

FIG. 4. Competition analysis of DNA-protein complexes. Binding reaction mixtures were prepared by using 5 p.1 of extract from cells transfected with pIEl. Prior to addition of the probe, competitors were added to the reaction mixtures in excess molar amounts as indicated: lanes 1 to 3, Hae-111-digested pUC8; lanes 4 to 6, unlabeled Hindll-EcoRV fragment of h; lanes 6 to 10, DR60; lanes 11 to 14, DR30.

incubated with extracts made from cells

transfected with pIEl,

two DNA-protein complexes were (complexes I and II). The fastest-migrating complex, was formed with the least amount of added complex the slower-migrating complex, was extract, and complex observed only with more extract. The amount of probe in the two complexes was determined by Cerenkov counting of the excised gel slices. The results are presented in Fig. 3 as a the amount of cell plo't of radioactivity in each band extract added. Both complexes increased linearly with information creasing extract added, indicating that complex is not cooperative. To confirm that the binding was specific for hr5 DNA, competition experiments were performed with an excess of unlabeled probe or nonspecific DNA (Fig. 4). Excess unlabeled probe inhibited all three complexes (lanes 4 to 6), while addition of excess HaeIII-digested pUC8 had no effect (lanes 1 to 3). To further define the sequences within the probe that

formed

I,

II,

agai'nst

interact with proteins in the extract, synthetic oligonucleotides were synthesized and used in competition analyses. Competition with the 60-bp repeat containing the conserved 24-bp palindrome inhibited formation of all three DNAprotein complexes (lanes 7 to 10), indicating that both complexes were due to DNA-protein interactions at sequences within the 60-bp repeat. The addition of excess DNA corresponding to the smaller direct repeat (DR30) did not inhibit DNA protein interactions (lanes 13 to 16). Functional analysis of 60-bp repeat. To confirm that sequences within the 60-bp oligonucleotide were suffici'ent for DNA-protein complex formation, the oligonucleotide was 5' end labeled and used in gel retardation experiments (Fig. 5). A single, specific complex was formed with the 60-bp oligonucleotide. As a control, the 30-bp oligonucleotide was also labeled and tested with the same extract. Gel retardation assay indicated that DNA-protein complexes were not formed with this probe (data not shown). To determine whether the 60-bp sequence was sufficient for enhancer function, the oligonucleotide was cloned upstream of the 39CAT promoter (39cat-DR60). S. frugiperda cells were transfected with pIEl and p39cat-DR60. As controls, cells were transfected with pIEl and either p39cathr5, which contains the entire hr5 sequence, or p39cat, which has no enhancer sequences. As previously reported, the presence of the entire hr5 enhancer upstream of 39CAT increases CAT activity more than 1,000-fold over the activity seen in the absence of enhancer sequences. The presence of the 60-bp oligonucleotide increased CAT expression approximately 300-fold (Table 1).

DISCUSSION

0

1

2

iil

3

4

5

extract added

FIG. 3. Complex formation as a function of extract concentration. The regions of the gel corresponding to complex I and II were excised and quantitated by Cerenkov counting.

2El The gene product is essential for trans activation of both enhancers and delayed-early promoters (7-9). These observations suggest 6El that may be bifunctional in nature; it trans activates both a promoter and an enhancer. Alternatively, it is possible that the mechanism of action of trans activation of both targets is the same. There are no obvious sequence homologies between the 39K promoter and the enhancer which could serve as IEi-responsive elements. However, both regions are A+T rich, and binding sites may be present but not obvious. The exact mechanism by which iEl trans activates the 39K promoter is unknown, but it might involve direct binding to viral sequences or interac-

BACULOVIRUS ENHANCER-BINDING PROTEIN

VOL. 65, 1991 CD (.0

LF) C-

CD

I

C - D R6 0

1

2

FIG. 5. Gel retardation assays with oligonucleotide probes. The top strand of the oligonucleotide sequence shown in Fig. 1B was 5' end labeled with polynucleotide kinase. After hybridization with an equimolar amount of the complementary strand, binding reactions were performed. Lane 1, 252-bp hr5 probe; lane 2, DR60.

tions with host transcription factors (14). The fact that IEl1 activates many viral genes as well as heterologous genes (8, 9, 13) suggests that an indirect role may be more likely. The exact interaction between IEl and the enhancer is also unknown. To begin to investigate these interactions, gel retardation experiments using extracts from cells transfected with pIEl and enhancer DNA were performed. Under the conditions used for these assays, extracts prepared from normal or mock-transfected S. frugiperda cells do not interact with the baculovirus hr5 enhancer in vitro. However, we cannot eliminate the possibility that factors are present in normal cells but were not detected. Cells transfected with pIEl formed two specific complexes with an hr5 fragment. Competition analyses indicated that formation of complexes I and II was due to interactions of proteins and DNA sequences within the conserved 60-bp direct repeats. The fragment of hr5 used in this analysis TABLE 1. Enhancer activity of a synthetic 60-bp

oligonucleotidea Reporter plasmid

39cat

39cat-hr5 39cat-DR60

activityb

Fold stimulation

0.04 45.0 13.3

1 1,125 310

CAT

a Cells were transfected with 1 ,ug of the indicated CAT plasmid and 0.1 p.g of pIEl. After 24 h, the CAT activity was determined. b Expressed as nanomoles of chloramphenicol acetylated per minute per 106 cells.

3679

contains two of the 60-bp repeats. When DR60 was used as a probe, a single complex was formed. These data are consistent with the hypothesis that formation of complex I, the fastest-migrating complex, is due to the binding of protein to either one of the repeats, and formation of complex II is due to binding of protein to both repeats. Proof of this hypothesis will required purification of the factors binding to hr5. It is not known exactly where protein binds within the 60-bp repeat. We have synthesized several smaller oligonucleotides containing conserved sequences and attempted to use them as competitors or probes. Thus far, we have been unable to identify smaller sequences containing IR24 that efficiently interact with DNA-binding proteins in extracts from pIEl-transfected cells (data not shown). Our attempts at DNase I footprinting and methylation protection have been unsuccessful. We have also been unable to purify the binding activity by using either conventional chromatography or DNA affinity chromatography. Although the binding activity in crude cell extracts is stable, we have observed a rapid loss of activity in our purification techniques (data not shown). Quantitation of the amount of probe in each retarded band revealed that complex formation increased linearly with increasing amount of extract added to the binding reactions. A linear increase indicates that the binding is not cooperative. If complexes I and II were formed in a cooperative manper, we would expect to see a sigmoidal increase in the formation of complex II and a decrease in the formation of complex I as the amount of added extract was increased. The observed results are inconsistent with such a model, as there was a linear relationship between amount of extract and binding activity. However, this does not rule out the possibility that once bound, the proteins enhance transcription in a cooperative manner. To analyze the enhancer function of IR60, a reporter plasmid containing IR60 upstream of 39CAT was constructed. Transient assay analysis revealed that a single copy of the 60-bp repeat enhances 39CAT expression 300-fold over that seen in the absence of enhancer sequences. In the same experiment, the 484-bp MluI fragment of hr5 region which contains four 60-bp repeats enhances expression 1,100-fold. It is not known whether the higher activity of the larger fragment is due to an additive effect of the repeats or is due to the sequences not represented in the 60-bp oligonucleotide. The results presented here indicate that S. frugiperda cells transfected with IEl contain factors capable of interacting with the hr5 enhancer. Under the same conditions, binding was not detected with extracts prepared from normal cells. Currently, we cannot distinguish between the possibilities that TEl binds directly and that it mediates its activity through a host cell factor. We are now involved in identifying other proteins that may be involved in DNA-protein interactions. ACKNOWLEDGMENTS We thank Gerry Kovacs, Don Jarvis, and David Carson for helpful discussions. We thank Melinda Smith for excellent technical assistance. This research was supported by grant A127450 from the National Institutes of Health and grant DMB-8804732 from the National Science Foundation.

3680

GUARINO AND DONG

REFERENCES 1. Blissard, G. W., and G. F. Rohrmann. 1990. Baculovirus diversity and molecular biology. Annu. Rev. Entomol. 35:127155. 2. Cochran, M., and P. Faulkner. 1983. Location of homologous DNA sequences interspersed at five regions in the baculovirus AcNPV genome. J. Virol. 45:961-970. 3. Fried, M., and D. Crothers. 1981. Equilibrium and kinetics of lac repressor-operator interactions by polyacrylamide gel electrophoresis. Nucleic Acids Res. 9:6505-6525. 4. Garner, M., and A. Revzin. 1981. A gel electrophoresis method for quantifying the binding of proteins to specific DNA regions: application to components of the E. coli lactose operon regulatory system. Nucleic Acids Res. 9:3047-3060. 5. Gorman, C. M., L. F. Moffat, and B. H. Howard. 1982. Recombinant genomes which express chloramphenicol acetyltransferase in mammalian cells. Mol. Cell. Biol. 2:1044-1051. 6. Guarino, L. A., M. A. Gonzalez, and M. D. Summers. 1986. Complete sequence and enhancer function of the homologous DNA regions of Autographa californica nuclear polyhedrosis virus. J. Virol. 60:224-229. 7. Guarino, L. A., and M. D. Summers. 1986. Functional mapping of a trans-activating gene required for expression of a baculovirus delayed-early gene. J. Virol. 57:563-571. 8. Guarino, L. A., and M. D. Summers. 1986. Interspersed homologous DNA of Autographa californica nuclear polyhedrosis virus enhances delayed-early gene expression. J. Virol. 60:215223. 9. Guarino, L. A., and M. D. Summers. 1987. Nucleotide sequence and temporal expression of a baculovirus regulatory gene. J.

J. VIROL.

Virol. 61:2091-2099. 10. Holmes, D. S., and M. Quigley. 1981. A rapid boiling method for the preparation of bacterial plasmids. Anal. Biochem. 114:193197. 11. Humphreys, G. O., G. A. Willshaw, and E. A. Anderson. 1975. A simple method for the precipitation of large quantities of pure plasmid DNA. Biochim. Biophys. Acta 383:457-463. 12. Kelly, D. C., and T. Lescott. 1980. Baculovirus replication protein synthesis in Spodoptera frugiperda cells infected with Trichoplusia ni nuclear polyhedrosis virus. Microbiologica 4:35-57. 13. Nissen, M. S., and P. D. Friesen. 1989. Molecular analysis of the transcriptional regulatory region of an early baculovirus gene. J. Virol. 63:493-503. 14. Ptashne, M. 1988. How transcriptional activators work. Nature

(London) 335:683-689. 15. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1990. Molecular cloning, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 16. Svaren, J., S. Inagami, E. Lovegren, and R. Chalkey. 1987. DNA denatures upon drying after ethanol precipitation. Nucleic Acids Res. 15:8739-8754. 17. Summers, M. D., and G. E. Smith. 1987. A manual of methods for baculovirus vectors and insect cell culture procedures. Texas Agricultural Experiment Station bulletin 1555. Texas Agricultural Experiment Station, College Station. 18. Zimarino, V., and C. Wu. 1987. Induction of sequence specific binding of Drosophila heat shock activator protein without protein synthesis. Nature (London) 327:727-730.