206
1160 (1992) 206-212 © 1992 Elsevier Science Publishers B.V. All rights reserved 0167-4838/92/$05.00
BBAPRO 34333
Expression of a hyperthermophilic aspartate aminotransferase in Escherichia coli M.I. Arnone a L. Birolo a, M.V. Cubellis a G. Nitti b, G. Marino a,c and G. Sannia a a Dipartimento di Chimica Organica e Biologica, Universit?l di Napoli, Napoli (Italy), b Farmitalia Carlo Erba, Centro Ricerche, Biotecnologie, Nerviano (Italy) and c Department of Biochemistry, Imperial College of Science and Technology, London (UK) (Received 21 April 1992)
Key words: Aspartate aminotransferase; Archaebacteria; Hyperthermophilia; Thermostability; Expression; Protein purification; ( S. solfataricus ); ( E. coli )
The gene for an archaebacterial hyperthermophilic enzyme, aspartate aminotransferase from Sulfolobus solfataricus (AspATSs), was expressed in Escherichia coli and the enzyme purified to homogeneity. A suitable expression vector and host strain were selected and culture conditions were optimized so that 6-7 mg of pure enzyme per litre of culture were obtained repeatedly. The recombinant enzyme and the authentic AspATSs are indistinguishable: in fact, they have the same molecular weight, estimated by means of SDS-PAGE and gel filtration, the same g m values for 2-oxo-glutarate and cysteine sulphinate and the same UV-visible spectra. Moreover, recombinant AspATSs is thermophilic and thermostable just as the enzyme extracted from Sulfolobus solfataricus. The protocol described may be used to produce thermostable archaebacterial enzymes in mesophilic hosts.
Introduction Aspartate aminotransferase (AspAT, EC 2.6.1.1) is a pyridoxal 5'-phosphate-dependent enzyme which catalyzes the reversible transfer of an amino group from aspartic acid to 2-oxo-glutarate. The functioning of this enzyme can be studied using spectroscopic techniques with pyridoxal 5'-phosphate as a natural internal report probe and for this reason AspAT was considered a useful model to study enzymatic catalysis. So far, many data concerning the primary and tridimensional structure and the catalytic mechanism of several mesophilic AspATs have been collected [1,2]. Recently, AspAT has been purified from two thermophilic microorganisms, the Bacillus species (YM-2) [3,4] and a thermoacidophilic archaebacterium, Sulfolobus solfataricus [5]. AspAT from S. solfataricus (AspATSs) is a useful model to study the adaptation of
Correspondence to: G. Sannia, Dipartimento di Chimica Organica e Biologica, Universit~ di Napoli, Via Mezzocannone 16, 80134 Napoli, Italy. Abbreviations: AspAT, aspartate aminotransferase; AspATSs, aspartate aminotransferase from Sulfolobus solfataricus; CSA, cysteine sulphinate; IPTG, isopropyl fl-o-thiogalactoside; PMP, pyridoxamine 5'-phosphate.
transaminases to very high temperatures, since it has an optimum temperature for activity at 100°C and an apparent melting temperature above 100°C [6]. No special features, except for the absence of cysteines, were detected in the primary structure of the protein [7] which could account for the hyperthermophilicity observed. AspATSs, although evolutionarily distant from eubacterial and eukaryotic AspATs, shares many structural and functional analogies with its mesophilic counterparts [6-9]. The definition of the tridimensional structure will be very useful to understand the properties of AspATSs, but for this purpose it is necessary to purify the protein into a homogeneous form and large amounts are required. This project relies on the availability of large quantities of biomass and it is severely limited by the difficulty of growing cultures of an acidothermophilic archaebacterium which lives in extreme conditions (87°C, pH 3.5) [10]. It is not possible to overcome this problem by simply inserting the gene encoding AspATSs into a mesophilic eubacterial host since the archaebaeterial regulative signals are different from the eubacterial ones [11]. Since most thermophilic enzymes have been isolated from archaebacteria it is useful to device a general protocol to produce thermostable proteins in suitable mesophilic hosts. This paper describes how AspATSs was expressed and conveniently purified from Escherichia
coli.
207
Experimental Procedures Plasmid construction The plasmid pKK-AAT was constructed ligating a double stranded oligonucleotide obtained by annealing two synthetic oligonucleotides, AGCTTCCATGGTCTCGCTACTAGACTI'TAACGGAAATATGTCACAAGTFACTGGAGAGACTACCTI'ATFGTATAAGGAAATTGCTAGAAACGTAGAAAAGACTAAG G and GATCC CTrAGTCTITI'CTACGTITCTAGCAATITCCTTATACAATAAGGTAGTCTCTCCAGTAACTFGTGACATATITCCGTI'AAAGTCTAGTAGCGAGACCATGGA (kindly provided by Dr. S. De Biase, Beckman, Italy) and a fragment Dde I-Nco I (1100 bp) obtained from pllG22, into the expression vector pKK233-2 (Pharmacia) linearized with NcoI and dephosphorylated, p l l G 2 2 is a recombinant plasmid containing the complete sequence of the AspATSs gene and its flanking regions [7]. pTrc-AAT was obtained ligating an NcoI fragment (1200 bp) rescued from pKK-AAT into pTrc99A (Pharmacia) linearized with NcoI and dephosphorylated. All DNA manipulations were carried out using standard procedures [12]. Bacterial cultures and enzyme purification E. coli strain JM105 (supE, endA, sbcB15, hsdR4 rpsL thi, A(lac-proAB), / F ' [traD36, proAB +, lacI q, lacZ M15]) (Pharmacia) was transformed with pKKAAT and grown overnight in M-9 minimal medium [12] containing 1 /zg/ml thiamine, 25/zg/ml streptomycin, 100/zg/ml ampicillin. E. coli strain RB791 (W3110 laclqL8) (kindly provided by Dr. R. Ziliotto, Farmitalia Carlo Erba, Italy) was transformed either with pKK-AAT or with pTrcA_AT and grown overnight in Super Broth medium [13] containing 100 /zg/ml ampicillin. 0.2 ml of the overnight cultures was diluted in 10 ml PYG medium [14] containing 100 /~g/ml ampicillin, 0.1% 2-oxoglutarate, 0.01% pyridoxine and incubated at 37°C with .constant shaking. The growth of JM105 transformed with pKK-AAT and of RB791 transformed either with pKK-AAT or with pTrc-AAT was monitored at 600 nm. Isopropyl /3-D-thiogalactoside (IPTG, 1 mM final concentration) was added to different cell densities as indicated in Fig. 1, to induce the expression of recombinant AspATSs. Cells were collected by centrifugation and lysed as described by Sambrook et al. [12], adding 2-oxoglutarate and pyridoxamine 5'-phosphate (PMP) to the extraction buffer (2 mM and 0.1 mM final concentration, respectively). The soluble fraction of the extract of cell pellets was heated at 75°C for 10 min and centrifuged (12000 x g, 10 min, 4°C). Thermostable recombinant AspATSs activity was assayed at 60°C [5]
in the clear supernatants. Large-scale production of recombinant AspATSs was obtained inoculating 1 litre PYG medium containing 100/zg/ml ampicillin with 20 ml of an overnight culture of RB791 transformed with pKK-AAT. Cells were grown at 37°C with shaking; IPTG (1 mM final concentration) was added when A600 nm reached 4.5 and the incubation continued for 16 h. The pellet of 1 litre culture of RB791 transformed with pKK-AAT was lysed as indicated above and the soluble fraction of the extract was dyalized against 0.1 M potassium-phosphate (pH 7.0), 0.1 mM PMP, 2 mM 2-oxo-glutarate and applied to an affinity column of anti-AspATSs antibodies (prepared as described by Marino et al. [5]). The column was washed with 20 mM potassium phosphate (pH 7.0), 2 M KC1 and eluted with 50 mM succinate (pH 3.0), 0.15 M KC1, 0.1 mM PMP, 2 mM 2-oxo-glutarate. Cells of S. solfataricus (Ss) strain MT4 were kindly supplied by Dr. Agata Gambacorta (Servizio batteri Termofili, Istituto per la Chimica di Molecole di Interesse Biologico, CNR, Napoli). AspATSs extracted from S. solfataricus was purified as previously described by Marino et al. [5] using as the final chromatographic step fractionation on an affinity column of anti-AspATSs antibodies.
Protein analysis SDS-PAGE was performed as described by Weber et al. [15] on a 12.5% acrylamide gel. Analytical isoelectric focusing in the pH range 4.07.5 was performed on a polyacrylamide gel slab using a Multiphor apparatus from LKB, following the manufacturer's instructions. The pH gradient was measured directly on the gel using a surface pH electrode. The activity of aspartate aminotransferase was detected on the gel at 60°C using the method described by Yagi et al. [16]. The NH2-terminal sequence of thermostable AspAT expressed in E. coli was determined by automated Edman degradation. An Applied Biosystems 470A gas-phase sequencer equipped with an on-line 120A phenylthiohydantoin amino-acid analyzer and a 900A data module was used following the manufacturer's instructions. Gel filtration was performed on a Superose 12 PC 3.2/30 column using a Smart system (Pharmacia LKB). The flow rate of the eluent, 50 mM sodium-phosphate (pH 7.0), 0.15 M NaCI was 40 p.l/min. The enzymatic activity of AspATSs was measured as previously described [5] by monitoring the rate of increase of absorbance at 412 nm due to the addition of the enzyme to a reaction mixture (2 ml) containing 2 mM 2-oxo-glutarate and 13 mM L-cysteine sulphinate (CSA) in 50 mM Tris-HC1 (pH 8.5), 0.1 mM EDTA and 0.15 mM 5,5'-dithiobis(2-nitrobenzoic acid). To
208 determine the K m values, the concentrations of 2-oxoglutarate and CSA were varied in the assay mixture. CD measurements were performed on cells of path length 1 mm using a JASCO J-500A automatic recording spectropolarimeter equipped with a Lauda RCS thermostate. The experiments were carried out in 5 mM potassium phosphate (pH 7.5) at a concentration of 0.2 mg purified transaminases per ml and the temperature of the sample was directly monitored in the cell by a hand-made thermister sensor. UV-visible absorption spectra and kinetic measurements were performed using a Beckman diode array spectrophotometer model DU7500. Protein concentration was determined using the Bio-Rad Protein Assay System [17]. Results
Production and purification of recombinant AspATSs The aim of this work was to produce and purify an archaebacterial thermostable enzyme from E. coil with high yields and in a homogeneous form. This paper describes how this was achieved in the case of AspATSs. Wild-type AspATSs was purified from S. solfataricus and its main physico-chemical properties, including the N-terminal sequence, were determined [5,6]. When the purified protein is analyzed using electrofocusing, three main subforms are observed whose nature is still unclear (Fig. 2B). Moreover, although the purification protocol for wild-type AspAT from S. solfataricus includes, besides others, a fractionation on specific antibodies coupled to Sepharose, it yields a product which is not homogeneous. In fact, SDS-PAGE reveals the presence of minor contaminants (Fig. 2A) which can be eliminated by reverse-phase HPLC. Due to the difficulties in obtaining AspATSs in a highly homogeneous form and to the difficulties in growing S. solfataricus, it was decided to try to produce the enzyme in E. coli. In a first attempt, the gene coding for AspATSs and its 5'-flanking region (200 bp) were ligated into pEMBL18 and inserted into E. coli HB101. The transformed strain did not produce any protein that was immunologically or functionally related to AspATSs (data not shown). For this reason, the AspATSs gene was inserted into two plasmids, pKK233-2 or pTrc99A, specially designed to express foreign proteins in E. coli [18,19]. Both plasmids contain the strong trc-promoter and an NcoI cloning site. A double stranded oligonucleotide, with an extention which can be ligated into an NcoI-cleaved site and an extention which can be ligated into a DdeI-cleaved site, was synthesized. This oligonucleotide contains the AUG initiation triplet and the sequence coding for AspATSs from Ser-2 to Thr-31.
Activity [IU (1Oral culture)/A,**..] 1
0.8
0.6
0.4
1
° 11 0
2
4
6
8
A 6OOnrn Fig. l. Induction of recombinant AspATSs. The induction of recombinant AspATSs was tested in three vector/host systems under different conditions. The transformed E. coli cells were inoculated into 10 ml PYG medium, incubated at 37°C and the growth was interrupted at different times by cooling in ice. The cells recovered by centrifugation were lysed as described in Experimental Procedures. The values of AspAT activity were determined in the soluble fraction of each extract at 60°C after thermal inactivation (10 min at 75°C) of endogenous E. coli AspAT. Induction with 1 mM IPTG started at different cell densitites (as indicated by arrows): when growth reached 0.6 A6o0 nm (JM105 transformed with pKK-AAT, 0); 1.0 A6oo ,,1 (RB791 transformed with pKK-AAT, +); 1.0 h600 nm (RB791 transformed with pTrc-AAT, O); 4.5 A60onm (RB791 transformed with pKK-AAT, *); 4.5 A60onm (RB791 transformed with pTrc-AAT, x).
A fragment starting from a DdeI site and ending at an NcoI site was generated from a plasmid which carries the complete AspATSs gene, pllG22. This fragment encodes AspATSs from Lys-32 to the carboxyterminal residue Arg-402 and contains an UAG stop codon located 22 bp upstream from the NcoI site. The synthetic oligonucleotide and the fragment obtained from pllG22 were ligated into pKK233-2 generating pKKAAT. The NcoI insert encoding the complete AspAT gene was rescued from pKK-AAT and ligated into pTrc99A to generate pTrc-AAT. E. coli strain JM105 was transformed with pKK-AAT while E. coli strain RB791 was transformed either with pKK-AAT or with pTrc-AAT. Fig. 1 shows the induction of AspAT activity in the transformed E. coli strains by 1 mM IPTG under different conditions. Cell pellets of 10 ml cultures were lysed and the soluble fractions of the extracts were heated at 75°C for 10 min. This treatment completely inactivates the endogenous AspAT in E. coli. Recombinant thermostable AspAT was assayed in the different samples at 60°C. The strain which gives the highest expression of recombinant AspATSs is RB791 transformed with pKK-AAT. Therefore, this strain was chosen for large-scale production of recombinant AspATSs. Cells were grown at 37°C to an A600 nm o f 4.5, induced by addition of IPTG and then grown for a further 16 h. Under these conditions, 1 litre of culture produces about 6-7 mg of
209 active recombinant AspATSs equivalent to 1.7% of the soluble proteins. The soluble fraction of the cell pellet extract was dialysed against 0.1 M potassium phosphate (pH 7.0), 0.1 mM PMP and 2 mM 2-oxo-glutarate and was applied to an affinity column of anti-AspATSs antibodies. The column was washed with 20 mM potassium-phosphate (pH 7.0), 2 M KC1 and eluted with 50 mM succinate (pH 3.0), 0.15 M KCI, 0.1 mM PMP, 2 mM 2-oxo-glutarate. This single chromatographic fractionation is very efficient (Table I), as it produces a 58-fold purification with a yield of 90%. The purified recombinant AspATSs gives a single band on SDSPAGE (Fig. 2A) and a single band on isoelectrofocusing gel electrophoresis (Fig. 2B). Recombinant AspATSs was subjected to automated Edman degradation. The sequence of 21 amino-terminal amino acids is identical to that determined for the wild-type AspATSs [5]. The same analysis shows that the recombinant protein is contaminated (roughly 20%) by a product in which the amino-terminal methionine has not been processed. Preliminary mass electrospray experiments confirm these results and show the main component has a molecular mass of 45 606 Da (full data to be published), close to that predicted from the gene sequence [7]. In a different experiment, the soluble fraction of the extract of RB791 transformed with pKK-AAT was heated at 75°C for 10 min and then centrifuged at 12000 x g for 10 min at 4°C. Using this procedure, a 35-fold purification is obtained with a yield of 100%. Fig. 2 shows that most E. coli thermolabile proteins can be denatured and precipitated by heating. If the clear fraction is analyzed with SDS-PAGE, only minor contaminants of thermostable recombinant AspAT can be detected.
Recombinant AspATSs and wild-type AspATSs are functionally indistinguishable UV-visible absorption and CD spectra of recombinant AspATSs were recorded. The UV spectrum of recombinant AspATSs in the pyridoxal form shows a band due to the absorbance of the coenzyme at 345 nm while this band is shifted at 330 nm in the spectrum of the same enzyme in the pyridoxamine form (Fig. 3). No change in the UV spectrum of recombinant AspATSs in the pyridoxal form could be observed depending on
the pH in the range 4.0 to 8.5. The same behaviour was observed for the enzyme extracted from S. solfataricus
[5]. Table II shows the main physico-chemical and kinetic parameters of recombinant AspATSs compared with those determined for the enzyme extracted from S. solfataricus. They appear identical within the experimental errors, except for the fact that the preparation of the recombinant AspATSs lacks the acidic subforms and, possibly for this reason, shows a higher specific activity. It has been suggested that AspAT from S. solfataricus might undergo a conformational transition which is reflected by a non-linear Arrhenius plot of kcat [8], therefore, the activity of the recombinant AspATSs was assayed at different temperatures ranging from 35 to 90°C. The plots obtained for the wild-type and recombinant enzymes are parallel and both show a break at about 60°C (Fig. 4). Thermostability of recombinant AspATSs was assayed in two ways namely by measuring the melting temperature and the kinetics of inactivation of the enzyme over prolonged incubations at high temperatures. Melting profiles were determined for both the wild-type and the recombinant AspATSs as a function of temperature by measuring the change in circular dichroic spectra. The temperature was continuously raised from 25 to 100°C over a period of 20 min and the ellipticity was recorded at 220 nm (Fig. 5). The enzymes conserved more than 85% of their secondary structure at 90°C but they started to precipitate at temperatures above 100°C. Therefore, under these experimental conditions, i.e., in the absence of denaturants which shift the fusion curve to lower temperatures, an exact melting temperature cannot be calculated, but it is thought that it is higher than 100°C for both enzymes. After prolonged incubations at high temperatures, AspATSs is eventually irreversibly inactivated. The inactivation may be accounted for by several mechanisms such as irreversible conformational changes, aggregation and oxidation [20]. To estimate the stability of AspATSs, both the recombinant and the wild type enzymes were incubated at different temperatures ranging from 94 to 103°C and then assayed under standard conditions at 60°C. The constants of the first-
TABLE I
Purification of recombinant AspA TSs Purification step Crude extract Immunoaffinity
Activity
Protein
Spec. Act.
Volume (ml)
I.U./ml
total I.U.
mg/ml
total mg
I.U./mg
Yield (%)
30 60
20.6 9.3
618 558
12.90 0.10
387.0 6.0
1.6 93.0
100 90
210
order kinetics of irreversible inactivation (k i) were calculated by plotting the logarithms of the residual activity against time. A further elaboration of these data allowed a rapid comparison between the properties of wild-type and recombinant AspATSs. Fig. 6 shows that the Arrhenius
0.6
[Absl
0.5
0.4
A 1
2
3
4
j
0.3
5
0.2
6
4-- 66k
Ol
4..- 4 6 . 5 k 0 200
29k
i 260
J 320
i 380
~ 440
i 500
i 560
620
Wavelength, nm Fig. 3. UV-visible absorption spectra of recombinant AspATSs. Curve 1, pyridoxal form of the enzyme (0.37 mg/ml) in 5 mM potassium-phosphate (pH 7.5); curve 2, pyridoxamine form obtained by addition of 1.3 mM L-Cysteine sulphinate (final concentration).
B
TABLE II
Physical and biochemical properties of AspATSs expressed in E. coli and AspA TSs
1
2
3
4
5 4.3
1160 (1992) 206-212 © 1992 Elsevier Science Publishers B.V. All rights reserved 0167-4838/92/$05.00
BBAPRO 34333
Expression of a hyperthermophilic aspartate aminotransferase in Escherichia coli M.I. Arnone a L. Birolo a, M.V. Cubellis a G. Nitti b, G. Marino a,c and G. Sannia a a Dipartimento di Chimica Organica e Biologica, Universit?l di Napoli, Napoli (Italy), b Farmitalia Carlo Erba, Centro Ricerche, Biotecnologie, Nerviano (Italy) and c Department of Biochemistry, Imperial College of Science and Technology, London (UK) (Received 21 April 1992)
Key words: Aspartate aminotransferase; Archaebacteria; Hyperthermophilia; Thermostability; Expression; Protein purification; ( S. solfataricus ); ( E. coli )
The gene for an archaebacterial hyperthermophilic enzyme, aspartate aminotransferase from Sulfolobus solfataricus (AspATSs), was expressed in Escherichia coli and the enzyme purified to homogeneity. A suitable expression vector and host strain were selected and culture conditions were optimized so that 6-7 mg of pure enzyme per litre of culture were obtained repeatedly. The recombinant enzyme and the authentic AspATSs are indistinguishable: in fact, they have the same molecular weight, estimated by means of SDS-PAGE and gel filtration, the same g m values for 2-oxo-glutarate and cysteine sulphinate and the same UV-visible spectra. Moreover, recombinant AspATSs is thermophilic and thermostable just as the enzyme extracted from Sulfolobus solfataricus. The protocol described may be used to produce thermostable archaebacterial enzymes in mesophilic hosts.
Introduction Aspartate aminotransferase (AspAT, EC 2.6.1.1) is a pyridoxal 5'-phosphate-dependent enzyme which catalyzes the reversible transfer of an amino group from aspartic acid to 2-oxo-glutarate. The functioning of this enzyme can be studied using spectroscopic techniques with pyridoxal 5'-phosphate as a natural internal report probe and for this reason AspAT was considered a useful model to study enzymatic catalysis. So far, many data concerning the primary and tridimensional structure and the catalytic mechanism of several mesophilic AspATs have been collected [1,2]. Recently, AspAT has been purified from two thermophilic microorganisms, the Bacillus species (YM-2) [3,4] and a thermoacidophilic archaebacterium, Sulfolobus solfataricus [5]. AspAT from S. solfataricus (AspATSs) is a useful model to study the adaptation of
Correspondence to: G. Sannia, Dipartimento di Chimica Organica e Biologica, Universit~ di Napoli, Via Mezzocannone 16, 80134 Napoli, Italy. Abbreviations: AspAT, aspartate aminotransferase; AspATSs, aspartate aminotransferase from Sulfolobus solfataricus; CSA, cysteine sulphinate; IPTG, isopropyl fl-o-thiogalactoside; PMP, pyridoxamine 5'-phosphate.
transaminases to very high temperatures, since it has an optimum temperature for activity at 100°C and an apparent melting temperature above 100°C [6]. No special features, except for the absence of cysteines, were detected in the primary structure of the protein [7] which could account for the hyperthermophilicity observed. AspATSs, although evolutionarily distant from eubacterial and eukaryotic AspATs, shares many structural and functional analogies with its mesophilic counterparts [6-9]. The definition of the tridimensional structure will be very useful to understand the properties of AspATSs, but for this purpose it is necessary to purify the protein into a homogeneous form and large amounts are required. This project relies on the availability of large quantities of biomass and it is severely limited by the difficulty of growing cultures of an acidothermophilic archaebacterium which lives in extreme conditions (87°C, pH 3.5) [10]. It is not possible to overcome this problem by simply inserting the gene encoding AspATSs into a mesophilic eubacterial host since the archaebaeterial regulative signals are different from the eubacterial ones [11]. Since most thermophilic enzymes have been isolated from archaebacteria it is useful to device a general protocol to produce thermostable proteins in suitable mesophilic hosts. This paper describes how AspATSs was expressed and conveniently purified from Escherichia
coli.
207
Experimental Procedures Plasmid construction The plasmid pKK-AAT was constructed ligating a double stranded oligonucleotide obtained by annealing two synthetic oligonucleotides, AGCTTCCATGGTCTCGCTACTAGACTI'TAACGGAAATATGTCACAAGTFACTGGAGAGACTACCTI'ATFGTATAAGGAAATTGCTAGAAACGTAGAAAAGACTAAG G and GATCC CTrAGTCTITI'CTACGTITCTAGCAATITCCTTATACAATAAGGTAGTCTCTCCAGTAACTFGTGACATATITCCGTI'AAAGTCTAGTAGCGAGACCATGGA (kindly provided by Dr. S. De Biase, Beckman, Italy) and a fragment Dde I-Nco I (1100 bp) obtained from pllG22, into the expression vector pKK233-2 (Pharmacia) linearized with NcoI and dephosphorylated, p l l G 2 2 is a recombinant plasmid containing the complete sequence of the AspATSs gene and its flanking regions [7]. pTrc-AAT was obtained ligating an NcoI fragment (1200 bp) rescued from pKK-AAT into pTrc99A (Pharmacia) linearized with NcoI and dephosphorylated. All DNA manipulations were carried out using standard procedures [12]. Bacterial cultures and enzyme purification E. coli strain JM105 (supE, endA, sbcB15, hsdR4 rpsL thi, A(lac-proAB), / F ' [traD36, proAB +, lacI q, lacZ M15]) (Pharmacia) was transformed with pKKAAT and grown overnight in M-9 minimal medium [12] containing 1 /zg/ml thiamine, 25/zg/ml streptomycin, 100/zg/ml ampicillin. E. coli strain RB791 (W3110 laclqL8) (kindly provided by Dr. R. Ziliotto, Farmitalia Carlo Erba, Italy) was transformed either with pKK-AAT or with pTrcA_AT and grown overnight in Super Broth medium [13] containing 100 /zg/ml ampicillin. 0.2 ml of the overnight cultures was diluted in 10 ml PYG medium [14] containing 100 /~g/ml ampicillin, 0.1% 2-oxoglutarate, 0.01% pyridoxine and incubated at 37°C with .constant shaking. The growth of JM105 transformed with pKK-AAT and of RB791 transformed either with pKK-AAT or with pTrc-AAT was monitored at 600 nm. Isopropyl /3-D-thiogalactoside (IPTG, 1 mM final concentration) was added to different cell densities as indicated in Fig. 1, to induce the expression of recombinant AspATSs. Cells were collected by centrifugation and lysed as described by Sambrook et al. [12], adding 2-oxoglutarate and pyridoxamine 5'-phosphate (PMP) to the extraction buffer (2 mM and 0.1 mM final concentration, respectively). The soluble fraction of the extract of cell pellets was heated at 75°C for 10 min and centrifuged (12000 x g, 10 min, 4°C). Thermostable recombinant AspATSs activity was assayed at 60°C [5]
in the clear supernatants. Large-scale production of recombinant AspATSs was obtained inoculating 1 litre PYG medium containing 100/zg/ml ampicillin with 20 ml of an overnight culture of RB791 transformed with pKK-AAT. Cells were grown at 37°C with shaking; IPTG (1 mM final concentration) was added when A600 nm reached 4.5 and the incubation continued for 16 h. The pellet of 1 litre culture of RB791 transformed with pKK-AAT was lysed as indicated above and the soluble fraction of the extract was dyalized against 0.1 M potassium-phosphate (pH 7.0), 0.1 mM PMP, 2 mM 2-oxo-glutarate and applied to an affinity column of anti-AspATSs antibodies (prepared as described by Marino et al. [5]). The column was washed with 20 mM potassium phosphate (pH 7.0), 2 M KC1 and eluted with 50 mM succinate (pH 3.0), 0.15 M KC1, 0.1 mM PMP, 2 mM 2-oxo-glutarate. Cells of S. solfataricus (Ss) strain MT4 were kindly supplied by Dr. Agata Gambacorta (Servizio batteri Termofili, Istituto per la Chimica di Molecole di Interesse Biologico, CNR, Napoli). AspATSs extracted from S. solfataricus was purified as previously described by Marino et al. [5] using as the final chromatographic step fractionation on an affinity column of anti-AspATSs antibodies.
Protein analysis SDS-PAGE was performed as described by Weber et al. [15] on a 12.5% acrylamide gel. Analytical isoelectric focusing in the pH range 4.07.5 was performed on a polyacrylamide gel slab using a Multiphor apparatus from LKB, following the manufacturer's instructions. The pH gradient was measured directly on the gel using a surface pH electrode. The activity of aspartate aminotransferase was detected on the gel at 60°C using the method described by Yagi et al. [16]. The NH2-terminal sequence of thermostable AspAT expressed in E. coli was determined by automated Edman degradation. An Applied Biosystems 470A gas-phase sequencer equipped with an on-line 120A phenylthiohydantoin amino-acid analyzer and a 900A data module was used following the manufacturer's instructions. Gel filtration was performed on a Superose 12 PC 3.2/30 column using a Smart system (Pharmacia LKB). The flow rate of the eluent, 50 mM sodium-phosphate (pH 7.0), 0.15 M NaCI was 40 p.l/min. The enzymatic activity of AspATSs was measured as previously described [5] by monitoring the rate of increase of absorbance at 412 nm due to the addition of the enzyme to a reaction mixture (2 ml) containing 2 mM 2-oxo-glutarate and 13 mM L-cysteine sulphinate (CSA) in 50 mM Tris-HC1 (pH 8.5), 0.1 mM EDTA and 0.15 mM 5,5'-dithiobis(2-nitrobenzoic acid). To
208 determine the K m values, the concentrations of 2-oxoglutarate and CSA were varied in the assay mixture. CD measurements were performed on cells of path length 1 mm using a JASCO J-500A automatic recording spectropolarimeter equipped with a Lauda RCS thermostate. The experiments were carried out in 5 mM potassium phosphate (pH 7.5) at a concentration of 0.2 mg purified transaminases per ml and the temperature of the sample was directly monitored in the cell by a hand-made thermister sensor. UV-visible absorption spectra and kinetic measurements were performed using a Beckman diode array spectrophotometer model DU7500. Protein concentration was determined using the Bio-Rad Protein Assay System [17]. Results
Production and purification of recombinant AspATSs The aim of this work was to produce and purify an archaebacterial thermostable enzyme from E. coil with high yields and in a homogeneous form. This paper describes how this was achieved in the case of AspATSs. Wild-type AspATSs was purified from S. solfataricus and its main physico-chemical properties, including the N-terminal sequence, were determined [5,6]. When the purified protein is analyzed using electrofocusing, three main subforms are observed whose nature is still unclear (Fig. 2B). Moreover, although the purification protocol for wild-type AspAT from S. solfataricus includes, besides others, a fractionation on specific antibodies coupled to Sepharose, it yields a product which is not homogeneous. In fact, SDS-PAGE reveals the presence of minor contaminants (Fig. 2A) which can be eliminated by reverse-phase HPLC. Due to the difficulties in obtaining AspATSs in a highly homogeneous form and to the difficulties in growing S. solfataricus, it was decided to try to produce the enzyme in E. coli. In a first attempt, the gene coding for AspATSs and its 5'-flanking region (200 bp) were ligated into pEMBL18 and inserted into E. coli HB101. The transformed strain did not produce any protein that was immunologically or functionally related to AspATSs (data not shown). For this reason, the AspATSs gene was inserted into two plasmids, pKK233-2 or pTrc99A, specially designed to express foreign proteins in E. coli [18,19]. Both plasmids contain the strong trc-promoter and an NcoI cloning site. A double stranded oligonucleotide, with an extention which can be ligated into an NcoI-cleaved site and an extention which can be ligated into a DdeI-cleaved site, was synthesized. This oligonucleotide contains the AUG initiation triplet and the sequence coding for AspATSs from Ser-2 to Thr-31.
Activity [IU (1Oral culture)/A,**..] 1
0.8
0.6
0.4
1
° 11 0
2
4
6
8
A 6OOnrn Fig. l. Induction of recombinant AspATSs. The induction of recombinant AspATSs was tested in three vector/host systems under different conditions. The transformed E. coli cells were inoculated into 10 ml PYG medium, incubated at 37°C and the growth was interrupted at different times by cooling in ice. The cells recovered by centrifugation were lysed as described in Experimental Procedures. The values of AspAT activity were determined in the soluble fraction of each extract at 60°C after thermal inactivation (10 min at 75°C) of endogenous E. coli AspAT. Induction with 1 mM IPTG started at different cell densitites (as indicated by arrows): when growth reached 0.6 A6o0 nm (JM105 transformed with pKK-AAT, 0); 1.0 A6oo ,,1 (RB791 transformed with pKK-AAT, +); 1.0 h600 nm (RB791 transformed with pTrc-AAT, O); 4.5 A60onm (RB791 transformed with pKK-AAT, *); 4.5 A60onm (RB791 transformed with pTrc-AAT, x).
A fragment starting from a DdeI site and ending at an NcoI site was generated from a plasmid which carries the complete AspATSs gene, pllG22. This fragment encodes AspATSs from Lys-32 to the carboxyterminal residue Arg-402 and contains an UAG stop codon located 22 bp upstream from the NcoI site. The synthetic oligonucleotide and the fragment obtained from pllG22 were ligated into pKK233-2 generating pKKAAT. The NcoI insert encoding the complete AspAT gene was rescued from pKK-AAT and ligated into pTrc99A to generate pTrc-AAT. E. coli strain JM105 was transformed with pKK-AAT while E. coli strain RB791 was transformed either with pKK-AAT or with pTrc-AAT. Fig. 1 shows the induction of AspAT activity in the transformed E. coli strains by 1 mM IPTG under different conditions. Cell pellets of 10 ml cultures were lysed and the soluble fractions of the extracts were heated at 75°C for 10 min. This treatment completely inactivates the endogenous AspAT in E. coli. Recombinant thermostable AspAT was assayed in the different samples at 60°C. The strain which gives the highest expression of recombinant AspATSs is RB791 transformed with pKK-AAT. Therefore, this strain was chosen for large-scale production of recombinant AspATSs. Cells were grown at 37°C to an A600 nm o f 4.5, induced by addition of IPTG and then grown for a further 16 h. Under these conditions, 1 litre of culture produces about 6-7 mg of
209 active recombinant AspATSs equivalent to 1.7% of the soluble proteins. The soluble fraction of the cell pellet extract was dialysed against 0.1 M potassium phosphate (pH 7.0), 0.1 mM PMP and 2 mM 2-oxo-glutarate and was applied to an affinity column of anti-AspATSs antibodies. The column was washed with 20 mM potassium-phosphate (pH 7.0), 2 M KC1 and eluted with 50 mM succinate (pH 3.0), 0.15 M KCI, 0.1 mM PMP, 2 mM 2-oxo-glutarate. This single chromatographic fractionation is very efficient (Table I), as it produces a 58-fold purification with a yield of 90%. The purified recombinant AspATSs gives a single band on SDSPAGE (Fig. 2A) and a single band on isoelectrofocusing gel electrophoresis (Fig. 2B). Recombinant AspATSs was subjected to automated Edman degradation. The sequence of 21 amino-terminal amino acids is identical to that determined for the wild-type AspATSs [5]. The same analysis shows that the recombinant protein is contaminated (roughly 20%) by a product in which the amino-terminal methionine has not been processed. Preliminary mass electrospray experiments confirm these results and show the main component has a molecular mass of 45 606 Da (full data to be published), close to that predicted from the gene sequence [7]. In a different experiment, the soluble fraction of the extract of RB791 transformed with pKK-AAT was heated at 75°C for 10 min and then centrifuged at 12000 x g for 10 min at 4°C. Using this procedure, a 35-fold purification is obtained with a yield of 100%. Fig. 2 shows that most E. coli thermolabile proteins can be denatured and precipitated by heating. If the clear fraction is analyzed with SDS-PAGE, only minor contaminants of thermostable recombinant AspAT can be detected.
Recombinant AspATSs and wild-type AspATSs are functionally indistinguishable UV-visible absorption and CD spectra of recombinant AspATSs were recorded. The UV spectrum of recombinant AspATSs in the pyridoxal form shows a band due to the absorbance of the coenzyme at 345 nm while this band is shifted at 330 nm in the spectrum of the same enzyme in the pyridoxamine form (Fig. 3). No change in the UV spectrum of recombinant AspATSs in the pyridoxal form could be observed depending on
the pH in the range 4.0 to 8.5. The same behaviour was observed for the enzyme extracted from S. solfataricus
[5]. Table II shows the main physico-chemical and kinetic parameters of recombinant AspATSs compared with those determined for the enzyme extracted from S. solfataricus. They appear identical within the experimental errors, except for the fact that the preparation of the recombinant AspATSs lacks the acidic subforms and, possibly for this reason, shows a higher specific activity. It has been suggested that AspAT from S. solfataricus might undergo a conformational transition which is reflected by a non-linear Arrhenius plot of kcat [8], therefore, the activity of the recombinant AspATSs was assayed at different temperatures ranging from 35 to 90°C. The plots obtained for the wild-type and recombinant enzymes are parallel and both show a break at about 60°C (Fig. 4). Thermostability of recombinant AspATSs was assayed in two ways namely by measuring the melting temperature and the kinetics of inactivation of the enzyme over prolonged incubations at high temperatures. Melting profiles were determined for both the wild-type and the recombinant AspATSs as a function of temperature by measuring the change in circular dichroic spectra. The temperature was continuously raised from 25 to 100°C over a period of 20 min and the ellipticity was recorded at 220 nm (Fig. 5). The enzymes conserved more than 85% of their secondary structure at 90°C but they started to precipitate at temperatures above 100°C. Therefore, under these experimental conditions, i.e., in the absence of denaturants which shift the fusion curve to lower temperatures, an exact melting temperature cannot be calculated, but it is thought that it is higher than 100°C for both enzymes. After prolonged incubations at high temperatures, AspATSs is eventually irreversibly inactivated. The inactivation may be accounted for by several mechanisms such as irreversible conformational changes, aggregation and oxidation [20]. To estimate the stability of AspATSs, both the recombinant and the wild type enzymes were incubated at different temperatures ranging from 94 to 103°C and then assayed under standard conditions at 60°C. The constants of the first-
TABLE I
Purification of recombinant AspA TSs Purification step Crude extract Immunoaffinity
Activity
Protein
Spec. Act.
Volume (ml)
I.U./ml
total I.U.
mg/ml
total mg
I.U./mg
Yield (%)
30 60
20.6 9.3
618 558
12.90 0.10
387.0 6.0
1.6 93.0
100 90
210
order kinetics of irreversible inactivation (k i) were calculated by plotting the logarithms of the residual activity against time. A further elaboration of these data allowed a rapid comparison between the properties of wild-type and recombinant AspATSs. Fig. 6 shows that the Arrhenius
0.6
[Absl
0.5
0.4
A 1
2
3
4
j
0.3
5
0.2
6
4-- 66k
Ol
4..- 4 6 . 5 k 0 200
29k
i 260
J 320
i 380
~ 440
i 500
i 560
620
Wavelength, nm Fig. 3. UV-visible absorption spectra of recombinant AspATSs. Curve 1, pyridoxal form of the enzyme (0.37 mg/ml) in 5 mM potassium-phosphate (pH 7.5); curve 2, pyridoxamine form obtained by addition of 1.3 mM L-Cysteine sulphinate (final concentration).
B
TABLE II
Physical and biochemical properties of AspATSs expressed in E. coli and AspA TSs
1
2
3
4
5 4.3
