Mol Biol Rep (2013) 40:6987–6995 DOI 10.1007/s11033-013-2818-6
Expression and purification of ecdysteroid-regulated protein from Chinese mitten crab Eriocheir sinensis in E. coli Chongbo He • Panhai Chen • Xianggang Gao Lei Gao • Le Li
•
Received: 8 October 2012 / Accepted: 17 October 2013 / Published online: 1 November 2013 Ó Springer Science+Business Media Dordrecht 2013
Abstract The glutathione S-transferase (GST) fusion protein system is widely used for high-level expression and efficient purification of recombinant proteins from bacteria. The goal of this study was to clone, efficiently express and purify the ecdysteroid-regulated protein (ERP) in the form of a GST fusion protein. The mature peptide-coding cDNA fragment was extracted from Chinese mitten crap (Eriocheir sinensis), and then after using PCR to obtain the open reading frame, a recombinant plasmid designated pGEX4T-1_ERP was successfully generated and showed to efficiently express the ERP fusion protein as determined by SDS-PAGE. The resulting expressed protein was successfully purified by a combination of affinity and conventional chromatographic methods. After purification, the recombinant protein showed the expected size of 41 kDa on SDSPAGE gels which was further confirmed by mass spectrometry and western blotting. Purification of recombinant protein was achieved by fast protein liquid chromatography. About 2.4 mg/l recombinant protein with purity more than 80 % was obtained. Keywords Chinese mitten crap (Eriocheir sinensis) Ecdysteroid-regulated protein Glutathione S-transferase Fusion expression E. coli
C. He (&) X. Gao L. Gao Key Lab of Marine Fishery Molecular Biology, Liaoning Ocean and Fisheries Science Research Institute, Dalian 116023, China e-mail: [email protected] C. He P. Chen L. Li College of Life Science, Liaoning Normal University, Dalian 116081, China P. Chen Wuxi Biortus Biosciences, Jiangyin 214437, China
Introduction Chinese mitten crab (Eriocheir sinensis) (Henri Milne Edwards 1854) is a unique species of crab that is native to China. It is a catadromous crustacean with a life span of *2 years. The crab enters the reproductive season in its second year and dies shortly after completing reproduction [1–5]. The crap grows by periodic molting, which is controlled by the molt-inhibiting hormone and ecdysteroid [6]. Ecdysteroid plays an important role in blood glucose regulation and regulates several important physiological processes including growth and reproduction [7]. So recently, the ecdysteroid-regulated gene which controlled the ecdysteroid has been widely noted, Cho found that the ecdysteroid-regulated gene cascades have important roles in oogenesis in insects [8–12]. And in 2001, Hepperle and Hartfelder [13] detected ecdysteroid-regulated gene expression during a critical phase of caste development in the honey bee. Then shock experiments revealed that in the honey bee ovary the 29 kDa/PI 4.6 ecdysteroid-regulated protein (ERP) belongs to the class of small heat shock proteins. And Lee [14] found that ERP was also an important element of crustacean metamorphosis and the ecdysis cascade reaction. Its expression is suppressed when the ecdysteroid level is high, and it is expressed when the ecdysteroid is deficient. And ERP was also found that it had relationship with the disease of Chinese mitten crab. The sexual precosity and diseases, caused by bacteria, viruses, or rickettsia-like organisms have been reported in cultured Chinese mitten crab populations since the development of intensive aquaculture in early 1980s [15, 16]. Precocious crabs mature and die early at a small size that leads to catastrophic losses for farmers and seriously restricts the development of crab aquaculture [17]. The molecular mechanisms underlying Chinese mitten crab sexual precosity remain unclear [18].
123
6988
In this present study, ERP from Eriocheir sinensis was studied in a prokaryotic expression system. The resulting ERP fusion protein was purified to initiate further characterization of the protein.
Materials and methods RNA extraction Eriocheir sinensis were collected from a farm in Suzhou, Jiangsu Province, China. The hepatopancreas of each E. sinensis were then collected using a syringe, transferred to a tube and stored at -80 °C. Total RNA was isolated using the TRIzol RNA Isolation kit (Invitrogen), according to the manufacturer’s protocol. The amount and purity of RNA from each sample was determined by NanoDrop spectrophotometer (Thermo). For all RNA samples, A260/ A280 and A260/A230 ratios were in the range 2.0–2.1 and 1.9–2.0, respectively. Reverse-transcriptase-mediated PCR (RT-PCR) and cDNA cloning Random primers and RevertAid M-Mulv Reverse Transcriptase System (Fermentas) were used to perform firststrand cDNA. Synthesis was initiated from 1 lg of total RNA, following manufacturer’s instructions. To minimize sample treatment disparity, all RNA samples were reversetranscribed simultaneously. Sequence analysis The 141 predicted amino acid sequence of the ecdysteroidregulated gene was obtained through simple modular architecture research tool (SMART) (http://www.smart.embl heidelbergde/). The three-dimensional structure of ecdysteroid-regulated gene was predicted through SWISS-MODEL program (http://swissmodel.expasy.org/workspace/). Multiple sequence alignment of ERP was carried out with ClustalW (http://www.ebi.ac.uk/clustalw/). Phylogenetic tree was constructed with MEGA 4 based on the result of amino acid sequence alignment. Construction of expression vector Generation of the linear DNA by PCR amplification Primers were generated to encode an N-terminal glutathione S-transferase-tag (GST) containing a TEV cleavage site for expression using plasmid pGEX-4T-1. Primer sequences were adjusted such that each oligonucleotide had a calculated melting temperature of 50–60 °C.
123
Mol Biol Rep (2013) 40:6987–6995
Two gene specific primers, forward primer (50 -GAAAA CCTGTATTTTCAGGGCATGCGCGGACTTGTACTTCT C-30 ) and reverse primer (50 -GCTTTGTTAGCAGCCGGAT CTCATTATACGATGGTTACCGGA-30 ) were designed to clone the open reading frame (ORF) of the ecdysteroidregulated gene (GenBank Acc. No. GU444004). Two gene specific primers, forward primer (50 -GCCCT GAAAATACAGGTTTTCATCCGATTTTGGAGGATGGT CGCCA-30 ) and reverse primer (50 -TGAGATCCGGCTG CTAACAAAGCTGACTGACTGACGATCTGCCT-30 ) were designed to clone the pGEX-4T-1 vector (Fig. 6). The two PCR products were treated with DpnI at 37 °C for 1 h and then purified with the gel purification kit (TIANGEN). In vivo recombination The PCR product contains the selectable gene flanked by two homology arms. Homologous recombination between the homology arms and the target regions integrates the selectable gene [19]. To create the desired recombinant plasmids, linearized vector and insert were combined in a transformation reaction. 1 ll of the cleaned, linearized pGEX-4T-1 vector and 3 ll of the cleaned, linearized insert were added to the 50 ll of Top 10 competent cells (Invitrogen). Transformants of Top 10 cells were grown overnight on agar plates with 100 mg/ml Ampicillin. Four colonies per construct were picked manually for growth in liquid culture. Incubation and shaking of the cultures overnight at 37 °C (250 rpm) was done and a subsequent miniprep of DNA from the resulting culture was performed (Fig. 1). Expression of recombinant fusion protein The recombinant plasmid was transformed into BL21 competent cells (invitrogen). Transformants of BL21 cells were grown overnight on agar plates with 100 mg/ml Ampicillin. The cells were cultured in 200 ml LB medium (tryptone 10 g/l, yeast extract 5 g/l, and NaCl 10 g/l) supplemented with 100 mg/ml Ampicillin followed by a 100-fold dilution into LB Ampicillin medium and allowed to grow for 4 h at 37 °C. These cultures were then induced by the addition of 0.1 mM IPTG for 16 h at 16 °C (Fig. 7). After centrifugation at 10,0009g for 30 min at 4 °C, the cell pellet was immediately frozen at -80 °C until further processing. Purification of recombinant fusion protein The frozen cell paste was dissolved in ice-cold buffer (19 PBS, 5 mM DTT, pH 7.5) and then disrupted with a microfluidics high pressure homogenizer. The lysate was
Mol Biol Rep (2013) 40:6987–6995
6989
Fig. 1 a Design of the oligonucleotides and generation of the linear targeting DNA and the linear vector. b The linear vector is mixed with a target DNA molecule. After homologous recombination occurs in the host strain, the recombinant product containing the DNA of interest is obtained. Amplification and cloning of the DNA of interest is thus carried out in a single in vivo step
centrifuged at 20,000 rpm for 30 min and the supernatant was loaded onto a binding buffer pre-equilibrated GST FF 5 ml column. The flow-through was collected, after samples were loaded onto the column and 40 column volumes of binding buffer was used to wash the column. Then the protein was eluted with 10 mM reduced-glutathione (Fig. 8). The elution buffer was replaced with binding buffer (50 mM Tris 8.0, 100 mM NaCl and 5 % Glycerol), and then loaded onto a binding buffer pre-equilibrated Mono Q 10/100 GL column then eluted using a gradient volume of 30 CV and an increasing ionic strength up to 0.5 M NaCl (Fig. 9). Final purity of the GST fusion protein was more than 80 % based on SDS-PAGE (Fig. 9, lanes 7–9). Typical yields were 2 mg of purified protein per liter of bacterial culture. Mass spectrometry analysis The sample of purified protein was analyzed by 6200 Series Time-of Flight LC/MSD mass spectrometry (Agilent Technologies) (Fig. 10).
Results Sequence analysis Full-length cDNA cloning and sequence features of ecdysteroid-regulated gene in Eriocheir sinensis The full-length cDNA sequence and deduced amino acid sequences of ecdysteroid-regulated gene (GenBank Acc. No. GU444004) were shown in Fig. 2. The cDNA sequence contained 117 bp of 50 -untranslated region (50 UTR), 426 bp of ORF coding for 141 amino acids, and 841 bp of 30 -UTR, which included the polyadenylation signal (AATAAA) and a 31 bp of poly (A) tail (Fig. 2). Nucleotides were numbered from the first base at the 50 end. Amino acids, shown in one letter abbreviations, were numbered from the initiating methionine. The signal peptide was underlined and the mature peptide was enclosed in the black pane. Six conserved cysteines in the mature peptide amino acid sequence were presenting in shadow
123
6990
bold letter (C). The stop codon was marked by an asterisk and the polyadenylation signal AATAAA is enclosed in the black ellipse. The sequence was submitted to GenBank under accession number GU444004.
Mol Biol Rep (2013) 40:6987–6995
homology in amino acid with ERP in Litopenaeus vanname (ABD65303) and Bombyx mori (NP_001134647) (Fig. 4). Phylogenetic analysis of ERP in Eriocheir sinensis
We adopted SWISS-MODEL [20–22] to predict tertiary structure of ERP in E. sinensis. Simulation structure of the amino acid residue was range from the 16th to the 141th. In the ERP, we derived the amino acid sequence structure was mainly b-folding (Fig. 3).
A phylogenetic tree was constructed by the NJ method to analyze the genetic relationship between ERP in Chinese mitten crap (E. sinensis) and the others. It classified ERP into nine distinct groups, as shown in Fig. 6. Analysis showed that the phylogenetic tree was mainly composed of three branches. The phylogenetic analysis results were able to correlate the traditional taxonomic conception (Fig. 5).
Multiple sequence alignment of ERP
Construction of expression vectors
Multiple sequence alignment of ERP was carried out with ClustalW. The ERP in E. sinensis was 34.4 and 25.8 %
In this present study, we used a new method, homologous recombination, to construct the expression vector [23]. In
The tertiary structure of ERP in Eriocheir sinensis
Fig. 2 Nucleotide sequence (above) and deduced amino acid sequence (below) of ecdysteroid-regulated gene
123
Mol Biol Rep (2013) 40:6987–6995
6991
almost equally distributed in the pellet and supernatant (Fig. 8, lanes 2–5). To avoid the tedious denaturing and refolding process, only the supernatant (Fig. 8, lane 5) was loaded onto a binding buffer pre-equilibrated GST FF 5 ml column. After collected the flow-through (Fig. 8, lane 6) and washed with binding buffer (Fig. 8, lane 7), the protein was eluted with 10 mM reduced-glutathione and most of the recombinant proteins of approximately 41 kDa were eluted from the GST FF 5 ml column (Fig. 8, lane 8). After the ion exchange column, compared with the elution fraction (Fig. 9, lane 2), we have got rid of the impurity proteins of approximately 27 kDa (Fig. 9, lanes 3–6), and obtained the purity protein of 41 kDa (Fig. 9, lanes 7–9). Mass spectrometry analysis
Fig. 3 Predicted three-dimensional structure of ecdysteroid-regulated protein by SWISS-MODEL program
contrast to conventional cloning strategies, recombinogenic engineering can be carried out at virtually any chosen position on a given target DNA molecule (which can be small or large). Any type of modification, including sequence deletions, substitutions, and insertions can be carried out via homologous recombination. Because homologous recombination is a precise process of high fidelity, recombinogenic engineering generates DNA clones efficiently and with high precision. Primers were generated to encode an N-terminal GST-tag containing a TEV cleavage site for expression using plasmids pGEX-4T-1. Four gene specific primers were designed to generate the linear DNA. The linearized insert products (Fig. 6a) and the linearized vector products (Fig. 6b) were obtained and run on 1.0 % agarose gel (Fig. 6). Expression and purification of the recombinant fusion protein The GST fusion system is known to lead to high expression levels and allows a simple and efficient one-step purification of the fusion protein. We therefore decided to investigate the production of GST-ERP in E. coli. After transformation into the expression host E. coli BL21, the over-expression fusion protein was induced by IPTG that could be detected by SDS-PAGE. Compared with the un-induced protein (Fig. 7, lane 2), this construction (pGEX-4T-1_ERP) produced a recombinant protein of *41 kDa (Fig. 7, lane 3). After disrupted with a microfluidics high pressure homogenizer, we found that the recombinant protein was
As shown in Fig. 10, the actual molecular mass of GSTESP determined by Time-of Flight LC/MSD mass spectrometry was 41,593.27 Da, which matched the calculated molecular weight of GST-ERP.
Discussion Ecdysteroid is related to the ecdysis, development and regular activity of larva. A high level of ecdysteroid can effectively promote the ecdysis and the early development of gonadal, but once the concentration of ecdysteroid is decline, the time of ecdysis also will be delayed. The problems of precocious puberty and ecdysis incomplete are related to the ecdysis process of crustaceans, so understand the ecdysis mechanisms of Chinese mitten crab (E. sinensis) may help to improve the yield. While research interest concerning Chinese mitten crab has increased during recent years [16, 24–26], ERP has received little attention. In this present study, we report the expressing and purifying the ERP from Chinese mitten crab (E. sinensis). The mRNA expression of ERP gene has been reported in ten tissues and the temporal expression in hepatopancreas of four phases by real-time RT-PCR [27]. ERP gene mRNA transcripts could be detected in all examined tissues, and are highly expressed in hepatopancreas than that of other tissues. Among the four phases, the gene expression at premolt is the highest, down-regulated during inter-molt, upregulated at post-molt, and continues to increase in hardshell phase. The mRNA expression pattern of ERP gene confirmed that the hepatopancreas is a sensitive indicator for ecdysis phase in various crustaceans, and ERP gene would be involved in the process of crustacean molting. This present study is the first time to research the ERP, and this study presents a simple, flexible, and remarkably
123
6992
Mol Biol Rep (2013) 40:6987–6995
Fig. 4 Multiple sequence alignment of the ecdysteroidregulated protein with homologues from eight other organisms
Fig. 5 Phylogenetic tree of amino acid sequences in four vertebrates and 22 invertebrates using the neighbour-joining method. The numbers in the phylogram nodes indicate percent bootstrap support for the phylogeny. The bar at the bottom indicates 35 % amino acid divergence in sequences
efficient strategy for DNA cloning of the gene. The technique is based on the homologous recombination method. We have cloned the ORF of E. sinensis cDNA into a pGEX4T-1 vector. Expression of the recombinant fusion protein
123
was achieved by using GST fusion technology. However, the disadvantages of using this fusion technology are that the protein was expressed mostly in the form of inclusion bodies and the GST tag is difficult to cleavage. Therefore,
Mol Biol Rep (2013) 40:6987–6995
Fig. 6 Amplification of the linearized DNA. a 426 bp of linearized insert fragment. b 4,900 bp of linearized vector fragment
Fig. 7 Expression of pGEX-4T-1_ERP in E. coli. Lane 1 low molecular weight. Lane 2 samples from un-induced. Lane 3 0.1 mM IPTG 2 h-induced E. coli cultures
we performed the purification in the form of a GST fusion protein. To our knowledge, this is the first report describing the purification of ERP. The fusion protein was further confirmed by SDS-PAGE, western blotting and mass spectrometry. Thus, the present study provides us with a useful tool to obtain large amounts of ERP, which
6993
Fig. 8 Purification of recombinant pGEX-4T-1_ERP after GSTrap FF 5 ml column. Lanes 1, 9 low molecular weight. Lane 2 pGEX-4T1_ERP, T. Lane 3 pGEX-4T-1_ERP, N. Lane 4 pGEX-4T-1_ERP, S. Lane 5 pGEX-4T-1_ERP by GSTrap FF 5 ml column, load. Lane 6 pGEX-4T-1_ERP by GSTrap FF 5 ml column, flow-through. Lane 7 pGEX-4T-1_ERP by GSTrap FF 5 ml column, wash fraction by lysis buffer. Lane 8 pGEX-4T-1_ERP by GSTrap FF 5 ml column, elution fraction by 10 mM reduced-glutathione
Fig. 9 Purification of recombinant pGEX-4T-1_ERP after Mono Q GL 10/100 column. Lane 1 low molecular weight. Lane 2 pGEX-4T1_ERP by mono Q GL 10/100, load. Lane 3 pGEX-4T-1_ERP by mono Q GL 10/100, flow-through. Lanes 4–9 pGEX-4T-1_ERP by Mono Q GL 10/100, elution fraction A1, A2, A3, D6, E1, E4, respectively
could be utilized as a highly purified biological reagent for structural, biochemical, biological, and clinical investigations.
123
6994 Fig. 10 Time-of Flight LC/ MSD mass spectrometry analysis of GST-ERP
Mol Biol Rep (2013) 40:6987–6995
x10 5 + Scan (7.449-7.674 min, 15 Scans) 03201201 Esr after GST FF.d Subtract Deconvoluted (Isotope Width=12.6) 4.5
41593.27
4 3.5 3 2.5 2 1.5 1 0.5 0
38222.51
38000
39217.95
39000
40426.24
40000
42847.33
41000
42000
43000
43950.00
44000
44986.41
45000
Counts vs. Deconvoluted Mass (amu)
Acknowledgments This work was supported by the National Ocean Public Welfare Scientific Research Project (No. 201305001), China Agriculture Research System (CARS-50-Z04) and Liaoning scientific research program of ocean and fisheries department (No. 200801). Thank the Biortus which offers me a great environment to do my research. Also thank Guoping Xiao, James Groarke and the colleagues in Biortus for excellent technical assistance.
References 1. Wang HZ, Wang HJ, Liang XM, Cui YD (2006) Stocking models of Chinese mitten crab (Eriocheir japonica sinensis) in Yangtze lakes. Aquaculture 255:456–465 2. Rudnick DA, Hieb K, Grimmer KF, Resh VH (2003) Patterns and processes of biological invasion: the Chinese mitten crab in San Francisco Bay. Basic Appl Ecol 4:249–262 3. Sui L, Wille M, Cheng Y, Sorgeloos P (2007) The effect of dietary n-3 HUFA levels and DHA/EPA ratios on growth, survival and osmotic stress tolerance of Chinese mitten crab Eriocheir sinensis larvae. Aquaculture 273:139–150 4. Herborg LM, Bentley MG, Clare AS, Last KS (2006) Mating behaviour and chemical communication in the invasive Chinese mitten crab Eriocheir sinensis. J Exp Mar Biol Ecol 329:1–10 5. Torres G, Charmantier-Daures M, Chifflet S, Anger K (2007) Effects of long-term exposure to different salinities on the location and activity of Na?–K?–ATPase in the gills of juvenile mitten crab, Eriocheir sinensis. Comp Biochem Physiol A 147:460–465 6. Keller R (1992) Crustacean neuropeptides structures, functions and comparative aspects. Experieutia 48:439–448 7. Burtis KC, Thummel CS, Jones CW (1990) The Drosophila 74EF early puff contains E74, a complex ecdysone-inducible gene that encodes two ets-related proteins. Cell 61:85–99 8. Cho WL, Kapitskaya MZ, Raikhel AS (1995) Mosquito ecdysteroid receptor: analysis of the cDNA and expression during vitellogenesis. Insect Biochem Mol Biol 25:19–27 9. Deng WM, Bownes M (1997) Two signaling pathways specify localized expression of the broad-complex in Drosophila eggshell patterning and morphogenesis. Development 124:4639–4647 10. Buszczak M, Freeman MR, Carlson JR, Bender M, Cooley L, Segraves WA (1999) Ecdysone response genes govern egg chamber development during mid-oogenesis in Drosophila. Development 126:4581–4589
123
11. Kozlova T, Thummel CS (2000) Steroid regulation of postembryonic development and reproduction in Drosophila. Trends Endocrinol Metab 11:276–280 12. Sun G, Zhu J, Li C, Tu Z, Raikhel AS (2002) E74, an ecdysone inducible early gene, is involved in the ecdysteroid gene regulatory hierarchy during mosquito vitellogenesis. Mol Cell Endocrinol 190:147–157 13. Hepperle C, Hartfelder K (2001) Differentially expressed regulatory genes in honey bee caste development. Naturwissenschaften 88:113–116 14. Lee KJ, Elton TS, Bej AK, Watts SA, Watson RD (1995) Molecular cloning of a cDNA encoding putative molt-inhibiting hormone from the blue crab, Callinectes sapidus. Biochem. Biophys. Res Comm 209:1126–1131 15. Li X, Lei Y, Gao X, Ma C, Dong S (2007) Calcium carbonate supersaturation and precipitation in Chinese mitten crab (Eriocheir japonica sinensis) larval ponds in China: mass mortality, crystal form analysis, and safety saturation index. Aquaculture 272:361–369 16. Jiang H, Yin Y, Zhang X, Hu S, Wang Q (2009) Chasing relationships between nutrition and reproduction: a comparative transcriptome analysis of hepatopancreas and testis from Eriocheir sinensis. Comp Biochem Physiol D 4:227–234 17. Wen XB, Chen LQ, Zhou ZL, Ai CX, Deng GY (2002) Reproduction response of Chinese mitten-handed crab (Eriocheir sinensis) fed different sources of dietary lipid. Comp Biochem Physiol A 131:675–681 18. Kalinina MV, Vinnikova NA, Semen’kova EG (2008) Gonadogenesis and color characteristics of ovaries in Japanese mitten crab Eriocheir japonicus. Ontogenez 39:58–65 19. Zhang Y, Buchholz F, Muyrers JPP, Stewart AF (1998) A new logic for DNA engineering using recombination in Escherichia coli. Nat Genet 20:123–128 20. Arnold K, Bordoli L, Kopp J, Schwede T (2006) The structure SWISS-MODEL workspace: a web-based environment for protein homology modelling. Bioinformatics 22:195–201 21. Kiefer F, Arnold K, Ku¨nzli M, Bordoli L, Schwede T (2009) The SWISS-MODEL repository and associated resources. Nucleic Acids Res 37:387–392 22. Peitsch MC (1995) Protein modeling by E-mail bio/technology. Nat Biotechnol 13:658–660 23. Smith DB, Johnson KS (1988) Single-step purification of polypeptides expressed in Escherichia coli as fusions with glutathione S-transferase. Gene (Amst.) 67:31–40
Mol Biol Rep (2013) 40:6987–6995 24. Wang Q, Fang DA, Sun JL, Wang Y, Wang J, Liu LH (2012) Characterization of the vasa gene in the Chinese mitten crab Eriocheir sinensis: a germ line molecular marker. J Insect Physiol 58:960–965 25. Wang Q, Chen L, Wang Y, Li W, He L, Jiang H (2012) Expression characteristics of two ubiquitin/ribosomal fusion protein genes in the developing testis, accessory gonad and ovary of Chinese mitten crab, Eriocheir sinensis. Mol Biol Rep 39:6683–6692
6995 26. Li W, Jin X, He L, Wang Y, Chen L, Jiang H, Wang Q (2011) Molecular cloning, characterization and expression analysis of macrophage migration inhibitory protein (MIF) in Chinese mitten crab, Eriocheir sinensis. Fish Shellfish Immunol 30: 324–329 27. Jiang H (2011) Transcriptome analysis and reproduction related genes cloning, expression pattern in Chinese mitten crab [D]. Shanghai: East China Normal University
123
Expression and purification of ecdysteroid-regulated protein from Chinese mitten crab Eriocheir sinensis in E. coli Chongbo He • Panhai Chen • Xianggang Gao Lei Gao • Le Li
•
Received: 8 October 2012 / Accepted: 17 October 2013 / Published online: 1 November 2013 Ó Springer Science+Business Media Dordrecht 2013
Abstract The glutathione S-transferase (GST) fusion protein system is widely used for high-level expression and efficient purification of recombinant proteins from bacteria. The goal of this study was to clone, efficiently express and purify the ecdysteroid-regulated protein (ERP) in the form of a GST fusion protein. The mature peptide-coding cDNA fragment was extracted from Chinese mitten crap (Eriocheir sinensis), and then after using PCR to obtain the open reading frame, a recombinant plasmid designated pGEX4T-1_ERP was successfully generated and showed to efficiently express the ERP fusion protein as determined by SDS-PAGE. The resulting expressed protein was successfully purified by a combination of affinity and conventional chromatographic methods. After purification, the recombinant protein showed the expected size of 41 kDa on SDSPAGE gels which was further confirmed by mass spectrometry and western blotting. Purification of recombinant protein was achieved by fast protein liquid chromatography. About 2.4 mg/l recombinant protein with purity more than 80 % was obtained. Keywords Chinese mitten crap (Eriocheir sinensis) Ecdysteroid-regulated protein Glutathione S-transferase Fusion expression E. coli
C. He (&) X. Gao L. Gao Key Lab of Marine Fishery Molecular Biology, Liaoning Ocean and Fisheries Science Research Institute, Dalian 116023, China e-mail: [email protected] C. He P. Chen L. Li College of Life Science, Liaoning Normal University, Dalian 116081, China P. Chen Wuxi Biortus Biosciences, Jiangyin 214437, China
Introduction Chinese mitten crab (Eriocheir sinensis) (Henri Milne Edwards 1854) is a unique species of crab that is native to China. It is a catadromous crustacean with a life span of *2 years. The crab enters the reproductive season in its second year and dies shortly after completing reproduction [1–5]. The crap grows by periodic molting, which is controlled by the molt-inhibiting hormone and ecdysteroid [6]. Ecdysteroid plays an important role in blood glucose regulation and regulates several important physiological processes including growth and reproduction [7]. So recently, the ecdysteroid-regulated gene which controlled the ecdysteroid has been widely noted, Cho found that the ecdysteroid-regulated gene cascades have important roles in oogenesis in insects [8–12]. And in 2001, Hepperle and Hartfelder [13] detected ecdysteroid-regulated gene expression during a critical phase of caste development in the honey bee. Then shock experiments revealed that in the honey bee ovary the 29 kDa/PI 4.6 ecdysteroid-regulated protein (ERP) belongs to the class of small heat shock proteins. And Lee [14] found that ERP was also an important element of crustacean metamorphosis and the ecdysis cascade reaction. Its expression is suppressed when the ecdysteroid level is high, and it is expressed when the ecdysteroid is deficient. And ERP was also found that it had relationship with the disease of Chinese mitten crab. The sexual precosity and diseases, caused by bacteria, viruses, or rickettsia-like organisms have been reported in cultured Chinese mitten crab populations since the development of intensive aquaculture in early 1980s [15, 16]. Precocious crabs mature and die early at a small size that leads to catastrophic losses for farmers and seriously restricts the development of crab aquaculture [17]. The molecular mechanisms underlying Chinese mitten crab sexual precosity remain unclear [18].
123
6988
In this present study, ERP from Eriocheir sinensis was studied in a prokaryotic expression system. The resulting ERP fusion protein was purified to initiate further characterization of the protein.
Materials and methods RNA extraction Eriocheir sinensis were collected from a farm in Suzhou, Jiangsu Province, China. The hepatopancreas of each E. sinensis were then collected using a syringe, transferred to a tube and stored at -80 °C. Total RNA was isolated using the TRIzol RNA Isolation kit (Invitrogen), according to the manufacturer’s protocol. The amount and purity of RNA from each sample was determined by NanoDrop spectrophotometer (Thermo). For all RNA samples, A260/ A280 and A260/A230 ratios were in the range 2.0–2.1 and 1.9–2.0, respectively. Reverse-transcriptase-mediated PCR (RT-PCR) and cDNA cloning Random primers and RevertAid M-Mulv Reverse Transcriptase System (Fermentas) were used to perform firststrand cDNA. Synthesis was initiated from 1 lg of total RNA, following manufacturer’s instructions. To minimize sample treatment disparity, all RNA samples were reversetranscribed simultaneously. Sequence analysis The 141 predicted amino acid sequence of the ecdysteroidregulated gene was obtained through simple modular architecture research tool (SMART) (http://www.smart.embl heidelbergde/). The three-dimensional structure of ecdysteroid-regulated gene was predicted through SWISS-MODEL program (http://swissmodel.expasy.org/workspace/). Multiple sequence alignment of ERP was carried out with ClustalW (http://www.ebi.ac.uk/clustalw/). Phylogenetic tree was constructed with MEGA 4 based on the result of amino acid sequence alignment. Construction of expression vector Generation of the linear DNA by PCR amplification Primers were generated to encode an N-terminal glutathione S-transferase-tag (GST) containing a TEV cleavage site for expression using plasmid pGEX-4T-1. Primer sequences were adjusted such that each oligonucleotide had a calculated melting temperature of 50–60 °C.
123
Mol Biol Rep (2013) 40:6987–6995
Two gene specific primers, forward primer (50 -GAAAA CCTGTATTTTCAGGGCATGCGCGGACTTGTACTTCT C-30 ) and reverse primer (50 -GCTTTGTTAGCAGCCGGAT CTCATTATACGATGGTTACCGGA-30 ) were designed to clone the open reading frame (ORF) of the ecdysteroidregulated gene (GenBank Acc. No. GU444004). Two gene specific primers, forward primer (50 -GCCCT GAAAATACAGGTTTTCATCCGATTTTGGAGGATGGT CGCCA-30 ) and reverse primer (50 -TGAGATCCGGCTG CTAACAAAGCTGACTGACTGACGATCTGCCT-30 ) were designed to clone the pGEX-4T-1 vector (Fig. 6). The two PCR products were treated with DpnI at 37 °C for 1 h and then purified with the gel purification kit (TIANGEN). In vivo recombination The PCR product contains the selectable gene flanked by two homology arms. Homologous recombination between the homology arms and the target regions integrates the selectable gene [19]. To create the desired recombinant plasmids, linearized vector and insert were combined in a transformation reaction. 1 ll of the cleaned, linearized pGEX-4T-1 vector and 3 ll of the cleaned, linearized insert were added to the 50 ll of Top 10 competent cells (Invitrogen). Transformants of Top 10 cells were grown overnight on agar plates with 100 mg/ml Ampicillin. Four colonies per construct were picked manually for growth in liquid culture. Incubation and shaking of the cultures overnight at 37 °C (250 rpm) was done and a subsequent miniprep of DNA from the resulting culture was performed (Fig. 1). Expression of recombinant fusion protein The recombinant plasmid was transformed into BL21 competent cells (invitrogen). Transformants of BL21 cells were grown overnight on agar plates with 100 mg/ml Ampicillin. The cells were cultured in 200 ml LB medium (tryptone 10 g/l, yeast extract 5 g/l, and NaCl 10 g/l) supplemented with 100 mg/ml Ampicillin followed by a 100-fold dilution into LB Ampicillin medium and allowed to grow for 4 h at 37 °C. These cultures were then induced by the addition of 0.1 mM IPTG for 16 h at 16 °C (Fig. 7). After centrifugation at 10,0009g for 30 min at 4 °C, the cell pellet was immediately frozen at -80 °C until further processing. Purification of recombinant fusion protein The frozen cell paste was dissolved in ice-cold buffer (19 PBS, 5 mM DTT, pH 7.5) and then disrupted with a microfluidics high pressure homogenizer. The lysate was
Mol Biol Rep (2013) 40:6987–6995
6989
Fig. 1 a Design of the oligonucleotides and generation of the linear targeting DNA and the linear vector. b The linear vector is mixed with a target DNA molecule. After homologous recombination occurs in the host strain, the recombinant product containing the DNA of interest is obtained. Amplification and cloning of the DNA of interest is thus carried out in a single in vivo step
centrifuged at 20,000 rpm for 30 min and the supernatant was loaded onto a binding buffer pre-equilibrated GST FF 5 ml column. The flow-through was collected, after samples were loaded onto the column and 40 column volumes of binding buffer was used to wash the column. Then the protein was eluted with 10 mM reduced-glutathione (Fig. 8). The elution buffer was replaced with binding buffer (50 mM Tris 8.0, 100 mM NaCl and 5 % Glycerol), and then loaded onto a binding buffer pre-equilibrated Mono Q 10/100 GL column then eluted using a gradient volume of 30 CV and an increasing ionic strength up to 0.5 M NaCl (Fig. 9). Final purity of the GST fusion protein was more than 80 % based on SDS-PAGE (Fig. 9, lanes 7–9). Typical yields were 2 mg of purified protein per liter of bacterial culture. Mass spectrometry analysis The sample of purified protein was analyzed by 6200 Series Time-of Flight LC/MSD mass spectrometry (Agilent Technologies) (Fig. 10).
Results Sequence analysis Full-length cDNA cloning and sequence features of ecdysteroid-regulated gene in Eriocheir sinensis The full-length cDNA sequence and deduced amino acid sequences of ecdysteroid-regulated gene (GenBank Acc. No. GU444004) were shown in Fig. 2. The cDNA sequence contained 117 bp of 50 -untranslated region (50 UTR), 426 bp of ORF coding for 141 amino acids, and 841 bp of 30 -UTR, which included the polyadenylation signal (AATAAA) and a 31 bp of poly (A) tail (Fig. 2). Nucleotides were numbered from the first base at the 50 end. Amino acids, shown in one letter abbreviations, were numbered from the initiating methionine. The signal peptide was underlined and the mature peptide was enclosed in the black pane. Six conserved cysteines in the mature peptide amino acid sequence were presenting in shadow
123
6990
bold letter (C). The stop codon was marked by an asterisk and the polyadenylation signal AATAAA is enclosed in the black ellipse. The sequence was submitted to GenBank under accession number GU444004.
Mol Biol Rep (2013) 40:6987–6995
homology in amino acid with ERP in Litopenaeus vanname (ABD65303) and Bombyx mori (NP_001134647) (Fig. 4). Phylogenetic analysis of ERP in Eriocheir sinensis
We adopted SWISS-MODEL [20–22] to predict tertiary structure of ERP in E. sinensis. Simulation structure of the amino acid residue was range from the 16th to the 141th. In the ERP, we derived the amino acid sequence structure was mainly b-folding (Fig. 3).
A phylogenetic tree was constructed by the NJ method to analyze the genetic relationship between ERP in Chinese mitten crap (E. sinensis) and the others. It classified ERP into nine distinct groups, as shown in Fig. 6. Analysis showed that the phylogenetic tree was mainly composed of three branches. The phylogenetic analysis results were able to correlate the traditional taxonomic conception (Fig. 5).
Multiple sequence alignment of ERP
Construction of expression vectors
Multiple sequence alignment of ERP was carried out with ClustalW. The ERP in E. sinensis was 34.4 and 25.8 %
In this present study, we used a new method, homologous recombination, to construct the expression vector [23]. In
The tertiary structure of ERP in Eriocheir sinensis
Fig. 2 Nucleotide sequence (above) and deduced amino acid sequence (below) of ecdysteroid-regulated gene
123
Mol Biol Rep (2013) 40:6987–6995
6991
almost equally distributed in the pellet and supernatant (Fig. 8, lanes 2–5). To avoid the tedious denaturing and refolding process, only the supernatant (Fig. 8, lane 5) was loaded onto a binding buffer pre-equilibrated GST FF 5 ml column. After collected the flow-through (Fig. 8, lane 6) and washed with binding buffer (Fig. 8, lane 7), the protein was eluted with 10 mM reduced-glutathione and most of the recombinant proteins of approximately 41 kDa were eluted from the GST FF 5 ml column (Fig. 8, lane 8). After the ion exchange column, compared with the elution fraction (Fig. 9, lane 2), we have got rid of the impurity proteins of approximately 27 kDa (Fig. 9, lanes 3–6), and obtained the purity protein of 41 kDa (Fig. 9, lanes 7–9). Mass spectrometry analysis
Fig. 3 Predicted three-dimensional structure of ecdysteroid-regulated protein by SWISS-MODEL program
contrast to conventional cloning strategies, recombinogenic engineering can be carried out at virtually any chosen position on a given target DNA molecule (which can be small or large). Any type of modification, including sequence deletions, substitutions, and insertions can be carried out via homologous recombination. Because homologous recombination is a precise process of high fidelity, recombinogenic engineering generates DNA clones efficiently and with high precision. Primers were generated to encode an N-terminal GST-tag containing a TEV cleavage site for expression using plasmids pGEX-4T-1. Four gene specific primers were designed to generate the linear DNA. The linearized insert products (Fig. 6a) and the linearized vector products (Fig. 6b) were obtained and run on 1.0 % agarose gel (Fig. 6). Expression and purification of the recombinant fusion protein The GST fusion system is known to lead to high expression levels and allows a simple and efficient one-step purification of the fusion protein. We therefore decided to investigate the production of GST-ERP in E. coli. After transformation into the expression host E. coli BL21, the over-expression fusion protein was induced by IPTG that could be detected by SDS-PAGE. Compared with the un-induced protein (Fig. 7, lane 2), this construction (pGEX-4T-1_ERP) produced a recombinant protein of *41 kDa (Fig. 7, lane 3). After disrupted with a microfluidics high pressure homogenizer, we found that the recombinant protein was
As shown in Fig. 10, the actual molecular mass of GSTESP determined by Time-of Flight LC/MSD mass spectrometry was 41,593.27 Da, which matched the calculated molecular weight of GST-ERP.
Discussion Ecdysteroid is related to the ecdysis, development and regular activity of larva. A high level of ecdysteroid can effectively promote the ecdysis and the early development of gonadal, but once the concentration of ecdysteroid is decline, the time of ecdysis also will be delayed. The problems of precocious puberty and ecdysis incomplete are related to the ecdysis process of crustaceans, so understand the ecdysis mechanisms of Chinese mitten crab (E. sinensis) may help to improve the yield. While research interest concerning Chinese mitten crab has increased during recent years [16, 24–26], ERP has received little attention. In this present study, we report the expressing and purifying the ERP from Chinese mitten crab (E. sinensis). The mRNA expression of ERP gene has been reported in ten tissues and the temporal expression in hepatopancreas of four phases by real-time RT-PCR [27]. ERP gene mRNA transcripts could be detected in all examined tissues, and are highly expressed in hepatopancreas than that of other tissues. Among the four phases, the gene expression at premolt is the highest, down-regulated during inter-molt, upregulated at post-molt, and continues to increase in hardshell phase. The mRNA expression pattern of ERP gene confirmed that the hepatopancreas is a sensitive indicator for ecdysis phase in various crustaceans, and ERP gene would be involved in the process of crustacean molting. This present study is the first time to research the ERP, and this study presents a simple, flexible, and remarkably
123
6992
Mol Biol Rep (2013) 40:6987–6995
Fig. 4 Multiple sequence alignment of the ecdysteroidregulated protein with homologues from eight other organisms
Fig. 5 Phylogenetic tree of amino acid sequences in four vertebrates and 22 invertebrates using the neighbour-joining method. The numbers in the phylogram nodes indicate percent bootstrap support for the phylogeny. The bar at the bottom indicates 35 % amino acid divergence in sequences
efficient strategy for DNA cloning of the gene. The technique is based on the homologous recombination method. We have cloned the ORF of E. sinensis cDNA into a pGEX4T-1 vector. Expression of the recombinant fusion protein
123
was achieved by using GST fusion technology. However, the disadvantages of using this fusion technology are that the protein was expressed mostly in the form of inclusion bodies and the GST tag is difficult to cleavage. Therefore,
Mol Biol Rep (2013) 40:6987–6995
Fig. 6 Amplification of the linearized DNA. a 426 bp of linearized insert fragment. b 4,900 bp of linearized vector fragment
Fig. 7 Expression of pGEX-4T-1_ERP in E. coli. Lane 1 low molecular weight. Lane 2 samples from un-induced. Lane 3 0.1 mM IPTG 2 h-induced E. coli cultures
we performed the purification in the form of a GST fusion protein. To our knowledge, this is the first report describing the purification of ERP. The fusion protein was further confirmed by SDS-PAGE, western blotting and mass spectrometry. Thus, the present study provides us with a useful tool to obtain large amounts of ERP, which
6993
Fig. 8 Purification of recombinant pGEX-4T-1_ERP after GSTrap FF 5 ml column. Lanes 1, 9 low molecular weight. Lane 2 pGEX-4T1_ERP, T. Lane 3 pGEX-4T-1_ERP, N. Lane 4 pGEX-4T-1_ERP, S. Lane 5 pGEX-4T-1_ERP by GSTrap FF 5 ml column, load. Lane 6 pGEX-4T-1_ERP by GSTrap FF 5 ml column, flow-through. Lane 7 pGEX-4T-1_ERP by GSTrap FF 5 ml column, wash fraction by lysis buffer. Lane 8 pGEX-4T-1_ERP by GSTrap FF 5 ml column, elution fraction by 10 mM reduced-glutathione
Fig. 9 Purification of recombinant pGEX-4T-1_ERP after Mono Q GL 10/100 column. Lane 1 low molecular weight. Lane 2 pGEX-4T1_ERP by mono Q GL 10/100, load. Lane 3 pGEX-4T-1_ERP by mono Q GL 10/100, flow-through. Lanes 4–9 pGEX-4T-1_ERP by Mono Q GL 10/100, elution fraction A1, A2, A3, D6, E1, E4, respectively
could be utilized as a highly purified biological reagent for structural, biochemical, biological, and clinical investigations.
123
6994 Fig. 10 Time-of Flight LC/ MSD mass spectrometry analysis of GST-ERP
Mol Biol Rep (2013) 40:6987–6995
x10 5 + Scan (7.449-7.674 min, 15 Scans) 03201201 Esr after GST FF.d Subtract Deconvoluted (Isotope Width=12.6) 4.5
41593.27
4 3.5 3 2.5 2 1.5 1 0.5 0
38222.51
38000
39217.95
39000
40426.24
40000
42847.33
41000
42000
43000
43950.00
44000
44986.41
45000
Counts vs. Deconvoluted Mass (amu)
Acknowledgments This work was supported by the National Ocean Public Welfare Scientific Research Project (No. 201305001), China Agriculture Research System (CARS-50-Z04) and Liaoning scientific research program of ocean and fisheries department (No. 200801). Thank the Biortus which offers me a great environment to do my research. Also thank Guoping Xiao, James Groarke and the colleagues in Biortus for excellent technical assistance.
References 1. Wang HZ, Wang HJ, Liang XM, Cui YD (2006) Stocking models of Chinese mitten crab (Eriocheir japonica sinensis) in Yangtze lakes. Aquaculture 255:456–465 2. Rudnick DA, Hieb K, Grimmer KF, Resh VH (2003) Patterns and processes of biological invasion: the Chinese mitten crab in San Francisco Bay. Basic Appl Ecol 4:249–262 3. Sui L, Wille M, Cheng Y, Sorgeloos P (2007) The effect of dietary n-3 HUFA levels and DHA/EPA ratios on growth, survival and osmotic stress tolerance of Chinese mitten crab Eriocheir sinensis larvae. Aquaculture 273:139–150 4. Herborg LM, Bentley MG, Clare AS, Last KS (2006) Mating behaviour and chemical communication in the invasive Chinese mitten crab Eriocheir sinensis. J Exp Mar Biol Ecol 329:1–10 5. Torres G, Charmantier-Daures M, Chifflet S, Anger K (2007) Effects of long-term exposure to different salinities on the location and activity of Na?–K?–ATPase in the gills of juvenile mitten crab, Eriocheir sinensis. Comp Biochem Physiol A 147:460–465 6. Keller R (1992) Crustacean neuropeptides structures, functions and comparative aspects. Experieutia 48:439–448 7. Burtis KC, Thummel CS, Jones CW (1990) The Drosophila 74EF early puff contains E74, a complex ecdysone-inducible gene that encodes two ets-related proteins. Cell 61:85–99 8. Cho WL, Kapitskaya MZ, Raikhel AS (1995) Mosquito ecdysteroid receptor: analysis of the cDNA and expression during vitellogenesis. Insect Biochem Mol Biol 25:19–27 9. Deng WM, Bownes M (1997) Two signaling pathways specify localized expression of the broad-complex in Drosophila eggshell patterning and morphogenesis. Development 124:4639–4647 10. Buszczak M, Freeman MR, Carlson JR, Bender M, Cooley L, Segraves WA (1999) Ecdysone response genes govern egg chamber development during mid-oogenesis in Drosophila. Development 126:4581–4589
123
11. Kozlova T, Thummel CS (2000) Steroid regulation of postembryonic development and reproduction in Drosophila. Trends Endocrinol Metab 11:276–280 12. Sun G, Zhu J, Li C, Tu Z, Raikhel AS (2002) E74, an ecdysone inducible early gene, is involved in the ecdysteroid gene regulatory hierarchy during mosquito vitellogenesis. Mol Cell Endocrinol 190:147–157 13. Hepperle C, Hartfelder K (2001) Differentially expressed regulatory genes in honey bee caste development. Naturwissenschaften 88:113–116 14. Lee KJ, Elton TS, Bej AK, Watts SA, Watson RD (1995) Molecular cloning of a cDNA encoding putative molt-inhibiting hormone from the blue crab, Callinectes sapidus. Biochem. Biophys. Res Comm 209:1126–1131 15. Li X, Lei Y, Gao X, Ma C, Dong S (2007) Calcium carbonate supersaturation and precipitation in Chinese mitten crab (Eriocheir japonica sinensis) larval ponds in China: mass mortality, crystal form analysis, and safety saturation index. Aquaculture 272:361–369 16. Jiang H, Yin Y, Zhang X, Hu S, Wang Q (2009) Chasing relationships between nutrition and reproduction: a comparative transcriptome analysis of hepatopancreas and testis from Eriocheir sinensis. Comp Biochem Physiol D 4:227–234 17. Wen XB, Chen LQ, Zhou ZL, Ai CX, Deng GY (2002) Reproduction response of Chinese mitten-handed crab (Eriocheir sinensis) fed different sources of dietary lipid. Comp Biochem Physiol A 131:675–681 18. Kalinina MV, Vinnikova NA, Semen’kova EG (2008) Gonadogenesis and color characteristics of ovaries in Japanese mitten crab Eriocheir japonicus. Ontogenez 39:58–65 19. Zhang Y, Buchholz F, Muyrers JPP, Stewart AF (1998) A new logic for DNA engineering using recombination in Escherichia coli. Nat Genet 20:123–128 20. Arnold K, Bordoli L, Kopp J, Schwede T (2006) The structure SWISS-MODEL workspace: a web-based environment for protein homology modelling. Bioinformatics 22:195–201 21. Kiefer F, Arnold K, Ku¨nzli M, Bordoli L, Schwede T (2009) The SWISS-MODEL repository and associated resources. Nucleic Acids Res 37:387–392 22. Peitsch MC (1995) Protein modeling by E-mail bio/technology. Nat Biotechnol 13:658–660 23. Smith DB, Johnson KS (1988) Single-step purification of polypeptides expressed in Escherichia coli as fusions with glutathione S-transferase. Gene (Amst.) 67:31–40
Mol Biol Rep (2013) 40:6987–6995 24. Wang Q, Fang DA, Sun JL, Wang Y, Wang J, Liu LH (2012) Characterization of the vasa gene in the Chinese mitten crab Eriocheir sinensis: a germ line molecular marker. J Insect Physiol 58:960–965 25. Wang Q, Chen L, Wang Y, Li W, He L, Jiang H (2012) Expression characteristics of two ubiquitin/ribosomal fusion protein genes in the developing testis, accessory gonad and ovary of Chinese mitten crab, Eriocheir sinensis. Mol Biol Rep 39:6683–6692
6995 26. Li W, Jin X, He L, Wang Y, Chen L, Jiang H, Wang Q (2011) Molecular cloning, characterization and expression analysis of macrophage migration inhibitory protein (MIF) in Chinese mitten crab, Eriocheir sinensis. Fish Shellfish Immunol 30: 324–329 27. Jiang H (2011) Transcriptome analysis and reproduction related genes cloning, expression pattern in Chinese mitten crab [D]. Shanghai: East China Normal University
123
