World J Microbiol Biotechnol (2014) 30:2943–2952 DOI 10.1007/s11274-014-1722-0
ORIGINAL PAPER
Expression and functional analysis of a glycoside hydrolase family 45 endoglucanase from Rhizopus stolonifer Bin Tang • Yingying Zhang • Yaping Yang Zhewei Song • Xianglin Li
•
Received: 6 July 2013 / Accepted: 11 August 2014 / Published online: 28 August 2014 Ó Springer Science+Business Media Dordrecht 2014
Abstract A novel endoglucanase gene was cloned from Rhizopus stolonifer and expressed in Escherichia coli, the gene product EG II (45 kDa) was assigned to Glycoside Hydrolase Family 45 (GH45), and its specific activity on phosphoric acid-swollen cellulose (PASC) was 48 IU/mg. To solve the problem of substrate accumulation in the cellulose hydrolysis and enhance the catalytic efficiency of endoglucanase, the eg2 gene was modified by site directed mutagenesis. Mutations generated by overlapping PCR have been proven to increase its catalytic activity on carboxymenthyl cellulose, microcrystalline cellulose (Avicel) and PASC, among which the mutant EG II-E containing all 6 mutations (N39S, V136D, T251G, D255G, P256S and E260D) peaked 121 IU/mg on PASC. The bioinformatic analysis showed that 2 key catalytic residues (D136 and D260) moved closer with the opening of a loop after mutagenesis, and a tunnel was formed by structural transformation. This structure was conducive for the substrate to access the active centre, and D136 played an indispensable role in the substrate recognition. Keywords Endoglucanase Rhizopus stolonifer Structure–function Mutagenesis
B. Tang (&) Y. Zhang Y. Yang Z. Song X. Li College of Biochemical Engineering, Anhui Polytechnic University, Wuhu 241000, China e-mail: [email protected] B. Tang Y. Zhang Y. Yang Z. Song X. Li Engineering Technology Research Center of Microbial Fermentation, Anhui Polytechnic University, Wuhu 241000, China
Introduction Endoglucanases catalyze the hydrolysis of the cellulose to yield cello-oligosaccharides by facilitating the random cleavage of the internal b-1,4-D-glycosidic linkages within amorphous regions of cellulose chains (Tomme et al. 1995). Generally, there are three components of endoglucanase, the cellulose-binding domain (CBD), the catalytic domain (CD) and a linker with different length (Be´guin and Aubert 1994). CBD is composed of various carbohydrate-binding modules (CBM) which are very essential for the recognition and incorporation of the cellulase with substrates (Batista et al. 2011). CD is substrate-specific, and can play a catalytic role independently (Warner et al. 2013). Generally, there is a cleft or groove on the surface of endoglucanases, which allows the binding of several sugar units on polymeric substrates simultaneously (Davies and Henrissat 1995). Endoglucanases are classified into different glycoside hydrolase families (GHs) based on amino acid sequence similarity (Cantarel et al. 2009). Proteins of GH45, reported as endoglucanases, have been found in bacteria, fungi and animals (Liu et al. 2010). GH45 endoglucanases act by inverting the anomeric configuration (Schou et al. 1993) and have been widely used in industrial manufacturing because of their high activities (Hirvonen and Papageorgiou 2003; Azevedo et al. 2000). Proteins of this family share a common six-stranded b-barrel structure with long interconnecting loops (Schu¨lein 2000). Endoglucanases have been extensively studied because of their role in the cellulose degradation, and their application to a wide range of industrial fields such as food, textile, bioethanol, brewery and pulp (Bhat 2000; Miettinen-Oinonen et al. 2004). The GH45 endoglucanases have a dispersing effect on solid cellulose without hydrolyzing them. They are the main endoglucanases used in the textile
123
2944
and detergent industries because of their high defibrillation activities (Shimonaka et al. 2006). One of the bottlenecks to widespread biorefining application is the enzymatic hydrolysis of the cellulosic material into sugars. Sitedirected mutagenesis and directed evolution by random mutation are used to improve the catalytic efficiency of endoglucanases (Damude et al. 1995; Wang et al. 2005; du Plessis et al. 2010). In addition, the catalytic mechanism of endoglucanase is one of the hot topics, although it has not been fully clarified. In order to enhance the catalytic ability of endoglucanases, herein this paper, mutation of the catalytic domain of a GH45 endoglucanase EG II, together with the corresponding structure and effects on the enzymatic activity were studied, from which the preliminary structure–function relationship was investigated.
World J Microbiol Biotechnol (2014) 30:2943–2952
ProtScale (http://web.expasy.org/cgi-bin/protscale/protscale.pl) and TMHMM 2.0 (http://www.cbs.dtu.dk/services/TMHMM/) were used for prediction of the hydrophobicity and transmembrane region, respectively. The SignalP 4.0 (http://www.cbs.dtu. dk/services/SignalP/) was applied to predict the signal peptide sequence of EG II. The key functional sites of EG II were predicted by using the PROSITE (http://prosite.expasy.org/) and the CDD database (http://www.ncbi.nlm.nih.gov/Structure/cdd/ wrpsb.cgi). Homology alignment of the primary structure between EG II and other endoglucanases was carried out in the PDB database using the BLAST program, together with the MegAlign and the ClustalX 1.8 program. The tertiary structure of EG II was predicted by the Phyre 0.2 (http://www.sbg.bio.ic. ac.uk/*phyre/index.cgi). The RasMol 2.6 was used to show the structure of proteins intuitively (Sayle and Milner-White 1995). The Discovery Studio 2.5 was used to define the sphere of receptor and the docking of ligands into the active site by CHARMm (Brooks et al. 1983).
Materials and methods Endoglucanase gene extraction The coding sequence of endoglucanase was amplified from the cDNA template of Rhizopus stolonifer var. Reflexus TP-02 by cDNA library construction method. Anchor primer was used to guide the synthesis of the first-strand cDNA under the function of reverse transcriptase. A pair of specific primers eg2-F (50 CCGGAATTCATGAAGTTTAT TACTATTACGTC30 ) and eg2-R (50 CCCAAGCTTTTAT TT TCTTGAACAACCTGTC30 ) with EcoRI and HindIII sites (underlined), respectively, was used directly to amplify the cDNA sequence that encodes the mature EG II. The Taq DNA polymerase used in PCR was purchased from Sangon (Shanghai, China). PCR was performed under the following conditions: an initial denaturation at 95 °C for 5 min; 30 cycles of denaturation at 94 °C for 30 s, annealing at 56 °C for 30 s, and extension at 72 °C for 75 s, plus an extra elongation at 72 °C for 10 min. Then the target PCR product was agarose gel-purified and digested with EcoRI and HindIII. The resulting cDNA fragment was inserted into pET28a vector digested with the same restriction enzymes, followed by the transformation into Escherichia coli DH5a and BL21 separately. The recombinant E. coli was screened by CMC Congo red plate screening method (Teather and Wood 1982). The recombinant expression vector containing the correct insert, named as pET28a-eg2, was confirmed by restriction enzyme analysis and DNA sequencing. Bioinformatics analysis of EG II Physicochemical properties of the EG II were identified by using the Protparam (http://web.expasy.org/protparam/). The
123
Mutagenesis of EG II Mutation sites were selected according to the results from bioinformatic analysis as described previously. All the mutations were generated using the PCR overlap extension method with pET28a-eg2 as the template (Ho et al. 1989). All overlapping PCR primers, listed in Table 1, were synthesized by Sangon (Shanghai, China). Primers A1 and B2 were used in every PCR reaction as upstream primers and downstream primers respectively. Other five groups of primers were designed to introduce the desired mutations. High fidelity Pfu DNA polymerase, purchased from Sangon (Shanghai, China), was chosen for the overlapping PCR. Conditions of this PCR were as previously described except the number of cycles, which was 22–25 cycles. All resulting PCR products were cloned into pET28a using the unique EcoR I and Hind III sites and transformed into E.coli BL21, followed by screening of the transformants by a CMC-Na medium. Composition of this medium was as follows: CMC-Na 1.5 %, (NH4)2SO4 0.3 %, KH2PO4 0.1 %, MgSO4 0.05 %, and Agar 2 %. Protein expression The recombinant E. coli BL21 harboring eg2 was grown in the LB medium, with kanamycin at a concentration of 50 lg/mL. It was incubated at 37 °C until an OD of 0.8 at 600 nm was obtained, and this culture was induced by 1 mM IPTG. The culture fluid was withdrawn at 3, 6, 9, 12, 18, 21 and 24 h after induction, and it was centrifuged at 4,193g for 10 min. Supernatant was discarded and the precipitate was resuspended in 1 mL citrate buffer (0.05 M, pH 5.0). This mixture was lysed by repeated
World J Microbiol Biotechnol (2014) 30:2943–2952 Table 1 The sequences of primers for overlapping PCR
Mutations
N39S V136D
2945
Primers
Sequences (50 –30 )
A1
AAATAATTTTGTTTAACTTTAAGAAGG
27
B2
ACCCCTCAAGACCCGTTTAG
20
A2
CCACTCCAGTCCTTACCACC
20
B1
AAGGACTGGAGTGGCCCTAC
20
A3
CAATCCCAATAACGAGTAGTGAC
23
Size (bp)
B3
ACTCGTTATTGGGATTGTTGTC
22
T251G
A4
GGTCGCCTCCCTTGATAGC
19
B4
AGGCTATCAAGGGAGGCGAC
20
D255G
A5
GGCTTGAAGAACCTAGGTCG
20
P256S
B5
ACCTAGGTTCTTCAAGCCTCG
21
E260D
A6
GTCTGCAAGTTGAGTCGAGG
20
B6
AGCCTCGACTCAACTTGCAG
20
freezing and thawing and centrifuged again at 4,193g for 30 min. Supernatant was taken out for determination of the activity on cellulose substrates. Enzymatic assays Endoglucanase samples (1 mL) were incubated with 1 mL of 1 % (w/v) sodium carboxymethylcellulose (CMC) in sodium acetate buffer (0.1 M, pH4.8) at 50 °C for 30 min. Inactivated enzyme solution was used as a control group. The reduced sugars were measured according to the DNS method (Miller et al. 1960). Furthermore, activity on Avicel and PASC was determined with 0.5 % (w/v) Avicel or 2 % (w/v) PASC (purchased from Sinopharm Chemical Reagent Co., Ltd), 50 °C for 60 min, to study the substrate specificity of family 45 endoglucanase (Vlasenko et al. 2010). One unit of endoglucanase (EC 3.2.1.4 cellulase, CMCase or ß-1,4-endoglucanase) activity was defined as the amount of enzyme which produces 1 lmol glucose every minute. SDS-PAGE analysis The zymotic fluid was removed and centrifuged at 21 h after the induction training, and the lower precipitate was suspended with citrate buffer (0.05 M, pH 5.0) afterwards. Recombinant proteins within the cell were released by cell rupturing and analyzed by 12 % sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE). Proteins in the gel were stained with Coomassie Brilliant blue R-250 and then washed in 10 % methanol for 2–4 h. The gel was visualized and photographed on a UV–visible transilluminator. Purification and adsorption studies EG II and its mutant were purified from the fermentation broth concentration by affinity chromatography on a Ni-
chelating column (Franken et al. 2000). Protein concentration was determined in the absorption at 280 nm. Specific activity of the pure enzyme on CMC, Avicel and PASC was determined with 5 % (w/v) CMC or 2 % (w/v) Avicel or 10 % (m/v) PASC, 0.05–5 mg/L enzyme, 0.5 g/ L bovine serum albumin (BSA), 0.1 M sodium acetate, pH 4.8, 50 °C, 30–60 min. The data of activity was expressed in units per milligram of the pure enzyme. The adsorption of enzyme to Avicel was studied by incubating samples with 2 % (m/v) Avicel for 5 h at 4 °C (Medve et al. 1998), while the enzyme/substrate ratio was 0.25 lmol/g and the sampling time was varied between 2 min and 5 h. Avicel with the bound enzymes was separated by filtering the incubation samples through a millex with 0.22 lm pore size. The filtrate was immediately analyzed by HPLC to measure hydrolysis products. Adsorption was expressed as enzyme bound per gram residual substrate that was calculated from the original substrate concentration based on the hydrolysis data. To study the processivity of enzymes, we adopted an indirect method by comparing the ratio of the soluble reducing sugars to the insoluble one (Irwin et al. 1998).
Results Cloning, expression and characterization of the gene eg2 In this study we obtained a novel endoglucanase gene eg2 from R. stolonifer var. Reflexus TP-02, which was cloned in pET28a expression vector and transformed into E. coli BL21 strain for recombinant protein production. The endoglucanase activity of recombinant protein was studied, and the maximum endoglucanase activity of EG II encoded by eg2 was 1.527 IU/mL on PASC observed at 21 h during the induction process. The novel gene eg2 was deposited
123
2946
Fig. 1 Amino acid sequence alighment of CBM1. ADC83999 (Trichoderma reesei), AAU05379 (Trichoderma parceramosum), and ABF56208 (Trichoderma koningii) are chosen, and all the
World J Microbiol Biotechnol (2014) 30:2943–2952
sequences are indicated by their Genbank codes. Identical amino acid residues are highlighted in grey. Thirteen conserved residues are boxed
Fig. 2 Amino acid sequence alighment of GH45 domain. 1L8F (Melanocarpus albomyces), 1HD5 (Humicola insolens), and 4ENG (Humicola insolens) are chosen for multiple sequence alignment. Sequences are indicated by their PDB codes. The identical amino acid residues in four endoglucanases are in a grey background. Two catalytic residues and other important residues, strictly conserved among the GH45 family members, are boxed
into the GenBank (Accession number to the nucleotide sequence database is JX315341). The length of this gene is 954 bp, containing an open reading frame (ORF) which encodes for a 317 amino acid protein, EG II. Protein analyses by Protparam showed the formula of EG II is C1472H2308N420O482S23, with its theoretical isoelectric point being 8.78. From ProtScale and TMHMM 2.0 analyses, it was predicted that EG II is a globular protein with good solubility. Protein BLAST (Basic Local Alignment Search Tool) results from PROSITE and CDD databases demonstrated that EG II belongs to Glycoside Hydrolase Family 45 (GH45), containing a fungal cellulose binding domain CBM1 (Carbohydrate Binding Module family 1) and two GH45 domains. SignalP 4.0 tool predicted an unambiguous signal peptide cleavage site between A23 and A24, which was in agreement with the N-terminal sequence alignment of the GH45 fungal endoglucanases. Selection of mutation sites Candidate residues for mutation were chosen according to the structural and functional analysis of EG II. Sequence
123
alignment of the homologous CBM1 domains revealed that an Asn substitutes for a Ser which is conserved in the trichoderma species at position 39 (Fig. 1), which is one of the residues forming the flat and hydrophilic surface of the molecule crucial for carbohydrate binding (Kraulis et al. 1989). Results of the homology alignment of GH45 domains showed two mutations of the highly conserved Asp to a Val at position 136 of EG II, and another to a Glu at position 260 (Fig. 2). These two conserved Asp were found at similar positions in the active site of many endoglucanases. The former can affect enzymatic function as the basis of catalytic residues, while the latter principally participates in the catalytic process (Valjakka and Rouvinen 2003). Furthermore, the 251–256 ordered loop was supposed to increase the hydrophobicity of the environment around the acidic group which acts as the catalytic active center, thus to prevent the entry of various nucleophiles into the active site except water molecules (Hirvonen and Papageorgiou 2003). On the other hand, three mutations of conversed residues were found in this loop. In a summary, all the mutation sites were N39, V136, T251, D255, P256 and E260.
World J Microbiol Biotechnol (2014) 30:2943–2952
2947
Fig. 3 Predicted GH45 domain structure of EG II (a) and its mutant EG II-E (b). Mutagenesis of V136D and E260D reduce the distance between them, and change the structure of active domain at the same time. Moreover, modifications of the loop also change the space position of
those 2 catalytic residues. C. Superimposed molecules of EG II (blue) and EG II-E (indigo). Mutation sites of EG II are green, the corresponding sites of EG II-E are yellow. D. The surface of two superimposed molecules and the yellow one is EG II. (Color figure online)
Structural analysis of GH45 domains
shown far apart from each other, with the 251–256 loop located in the middle. Structure of the mutant showed that D136 and D260 were closer after mutagenesis, and the loop was found on the other side of the active site. The superimposed proteins were generated, and the main-chain ˚. RMSD is 5.428 A
Tertiary structure of the GH45 domains between EG II and its mutant EG II-E were predicted, and the latter contained six mutations (N39S, V136D, T251G, D255G, P256S and E260D). The template for homology modeling was 1L8f ˚ (endoglucanase from Melanocarpus albomyces at 1.8 A resolution), which had 42 % identity with EG II. The modeled structures revealed that these mutations changed the structure of GH45 domain obviously. All these residues were shown in ball-and-stick model, and highlighted in different colors accordingly (Fig. 3). The C-alpha trace of the protein was shown in blue ribbons. Six-stranded bbarrel domain was found in the GH45 domain of EG II. Two catalysis residues of EG II (V136 and E260) were
Docking ligands into the active site of EG II We defined the active center of EG II and delimited the sphere of center as a receptor, then docked the ligands into the active site. Cellopentaose was chosen as a ligand to participate in the process of binding with EG II. The result was shown in Fig. 4. Stereo view of EG II-cellopentose complex (Fig. 4a) and the mutant EG II-E-cellopentose
123
2948
123
World J Microbiol Biotechnol (2014) 30:2943–2952
World J Microbiol Biotechnol (2014) 30:2943–2952
2949
b Fig. 4 Structure of GH45 domains-cellopentose complex. A. Stereo
view of EG II-cellopentose complex. B. The binding sites of cellopentose, hydrogen bonds are indicated with dashed lines. C. Stereo view of the mutant EG II-E-cellopentose complex. The entrance of the tunnel into the active centre of EG II-E is labeled with yellow dotted circle. D. Residues binding with cellopentose in the entrance of tunnel. E. The exit of the tunnel is labeled with yellow dotted circle. F. Residues binding with cellopentose in the exit of tunnel. (Color figure online)
complex (Fig. 4c, e) indicated that ligand binding mode produced a distinct approach to the receptor after mutagenesis. A tunnel formed from structural adjustment caused by the mutated residues was found in EG II-E. The entrance of this tunnel into the active centre (Fig. 4c) and the exit (Fig. 4e) were labeled with yellow dotted circle. The relationship between receptor and ligand was displayed by hydrogen bonds indicating with dashed lines. W135, C137, Q139, K147, N214 and S242 of EG II participated in binding with cellopentose (Fig. 4b) while the residues involved in EG II-E were Y134, D136, C137, C138, Q139, K159, G161, N214, S227 and D241 at both ends of the tunnel (Fig. 4d, f). It was indicated that V136D mutation of EG II exhibited the strongest interaction with cellopentose, confirming the indispensable role of D136 in the ligand recognition. Mutagenesis and expression of recombinant endoglucanases EG II-E containing all six mutation sites was generated as mentioned above, and the mutant was successfully expressed in E. coli screening by the selected medium. The total protein yield of EG II-E was 158 mg/L, which was similar with that of EG II (165 mg/L). Recombinant proteins of EG II and the mutant EG II-E were assayed to compare their hydrolysis activities on various cellulose substrates. There was a significant increase in specificity activity of the mutant EG II-E comparing with the wild type EG II. The specific activity on CMC, Avicel and PASC of pure EG II was 21, 2, and 48 IU/mg, respectively, while the corresponding data of pure EG II-E was 42, 3, and 121 IU/mg. The data showed that substrate specificity of those enzymes was much higher on PASC than on CMC, and the lowest was on Avicel. To further check expression of EG II and EG II-E in E. coli BL21, the zymotic samples were separated by SDS-PAGE with control groups (uninduced samples). The band at position 45 kDa was observed in the sample of recombinants E. coli induced by IPTG (Fig. 5). Adsorption to Avicel The adsorption to cellulose was studied at 50 °C by incubating the purified endoglucanase with Avicel. Enzyme
Fig. 5 SDS-PAGE analysis of recombinant E. coli. Lane M, protein marker (Sangon); Lane 1, total protein in IPTG-induced E. coli BL21/ pET28a-eg2; Lane 2, total protein in uninduced E. coli BL21/ pET28a-eg2; Lane 3, total protein in IPTG-induced E. coli BL21/ pET28a-eg2-e; Lane 4, total protein in IPTG-induced E. coli BL21/ pET28a
adsorption and the production of soluble sugars were shown in Fig. 6. The adsorption behavior of two enzymes was similar with a quickly starting and a smooth deceleration. However, the mutant EG II-E showed a slightly higher rate of the original adsorption with Avicel EG II. In addition, the ratios of soluble/insoluble reducing sugars released by EG II and EG II-E were calculated. The soluble/insoluble ratio of EG II was 1.8 while the ratio of EG II-E was 3.2.
Discussion The GH45 endoglucanases have a broad substrate specificities for b-1,3/1,4-glucans. So far, numerous fungal GH45 endoglucanases have been purified and characterized. In previous studies, Phanerochaete chrysosporium PcCel45A has been confirmed with apparent hydrolytic activity toward various substrates (Igarashi et al. 2008). The specific activities of PcCel45A for lichenan and barley b-glucan are higher than those for PASC and CMC. Moreover, 3 GH45 endoglucanases, RCE1, RCE2, and RCE3 from Rhizopus oryzae, show much higher activities against soluble cellulose than against crystallization cellulose (Moriya et al. 2003). In this paper, EG II and EG IIE showed hydrolytic activity toward amorphous cellulose as is the case for the known GH45 endoglucanases. Unlike
123
2950
World J Microbiol Biotechnol (2014) 30:2943–2952
0.2
0.3
0.2 0.1 0.1
0
0.0 0
100 200 Time (min)
300
B Bound enzyme (µmol/g Avicel)
Sugars produced (g/L)
0.4
0.6 0.5
0.2
0.4 0.3 0.1 0.2
Sugars produced (g/L)
Bound enzyme (µmol/g Avicel)
A
0.1 0
0.0 0
100 200 Time (min)
300
Fig. 6 Adsorption of EG II (a) and EG II-E (b) to Avicel. The concentration of bound enzyme is shown in solid line, and the corresponding consistency of soluble sugars is shown in dotted line
PcCel45A, EG II and EG II-E have a higher specific activity on PASC than on CMC, which might be caused by the different structures. CBM domains are important to recognize, coact and boost the incorporation of the cellulase with the substrate (Batista et al. 2011). The S39 of CBM1 was reported to participate in forming the hydrophilic surface of cellulase crucial for carbohydrate binding as described previously (Kraulis et al. 1989). The adsorption rate of EG II-E (containing N39S) raised faster in the first 5 min of incubation with Avicel than EG II. This residue site may improve the adsorption rate to influence the function of CBM1, but the mechanism is not unclear. CD domains of endoglucanases are submitted to the substrates by CBM domain that is absorbed on the surface of cellulose to defiber the structure of crystallization cellulose (Carrard et al. 2000). However, the interaction mechanism between CD domains and substrates is still ambiguous. It is widely believed that CD domains have a large groove on the surface to allow long chain cellulose to enter into the active center (Shi et al. 2012). Lots of polar residues on the surface of CD domain participate in the process of attracting the electron cloud of glycosidic bonds,
123
and then pull the bonds. Nevertheless, residues participated in the reaction are too many and are unevenly distributed, which may lead to an inhomogeneous force and thus may not accurately pull the glycosidic bonds. Accumulation of substrates in the groove of CD domain may bring out a traffic jam, reducing hydrolytic efficiency of cellulase on cellulose surface (Ramos et al. 1993). There is a cleft complemented with substrates such as cellopentose on the surface of GH45 domain, which is the CD domain of EG II. Polar groups and some charged/polar residues such as Asn may attract substrates via hydrogen bonds, and aromatic amino acids such as Trp are also involved in this process. Studies of many different proteincarbohydrate interactions imply a stacking interaction between the sugar rings and the side chains of aromatic residues such as Tyr, Phe and Trp (Elgavish and Shaanan 1997; Linder et al. 1999). Mutagenesis of the key residues in the active center was achieved to overcome the stacking interaction of the substrates. Structure of GH45 domain was substantially modified because of the mutagenesis, and a special tunnel was formed with the opening of mutation loops that cover part of the cleft. This topology is just found in cellobiohydrolases, and the active center inside the tunnel allows enzymes to release the product while remaining firmly bound to the polysaccharide chain, thereby creating the conditions for processivity (Davies and Henrissat 1995). Our study on the ratios of soluble/insoluble sugars released by native and mutant EG II revealed that the processivity was effectively improved after mutagenesis, while the mutant had a higher specificity activity on cellulose substrates. It is noteworthy that the processivity is probably a key factor for the efficient enzymatic degradation of insoluble microcrystalline cellulose. The binding mode of EG II with substrates was changed when the tunnel formed, which might avoid the substrate accumulation and keep the substrates interacting with more residues to break glycosidic bonds. A series of polar residues participated in the process of drawing the long chain of cellulose molecules into the tunnel and the process of releasing oligosaccharides with unequal length. All the polar groups revolved around D136, which might play an indispensable role in the ligand recognition. D136 interacted with cellopentose O26 and O20 through two strong hydrogen bonds in the entrance and exit of the tunnel (Fig. 4d, f). It is particularly noteworthy that the efficiency of cellulase in the degradation process of cellulose would increase by the tunnel connected with the active center. In general, CBM1 and GH45 domain play a pivotal role in endoglucanase activity of R. stolonifer var. reflexus TP02. However, the detailed mechanism for endoglucanase catalysis of GH45 domain is still unclarified and needs further studies. In this paper, a tunnel was formed in the
World J Microbiol Biotechnol (2014) 30:2943–2952
mutant EG II-E with all six mutations, which was responsible for substrate to enter the active center accurately and continuously, thus successfully avoided the traffic jam. This mutant exhibited a significant specific activity for cellulose substrates (CMC, Avicel and PASC), especially the specificity on PASC. Currently, preliminary studies concerning the influence of structural modifications on the function of EG II by structural modification have been completed preliminary, which may provide important insights into further investigation on the mechanism of the cellulose hydrolysis process. Our future research will focus on the detailed roles of those residues during cellulose degradation process and the corresponding mechanism. Acknowledgments This work was financially supported by the National Natural Science Foundation of China (No. 30270135).
References Azevedo H, Bishop D, Cavaco-Paulo A (2000) Effects of agitation level on the adsorption, desorption, and activities on cotton fabrics of full length and core domains of EGV (Humicola insolens) and CenA (Cellulomonas fimi). Enzyme Microb Technol 27:325–329 Batista PR, de Souza Costa MG, Pascutti PG, Bisch PM, de Souza W (2011) High temperatures enhance cooperative motions between CBM and catalytic domains of a thermostable cellulase: mechanism insights from essential dynamics. Phys Chem Chem Phys 13:13709–13720 Be´guin P, Aubert JP (1994) The biological degradation of cellulose. FEMS Microbiol Rev 13:25–58 Bhat MK (2000) Cellulases and related enzymes in biotechnology. Biotechnol Adv 18:355–383 Brooks BR, Bruccoleri RE, Olafson BD, States DJ, Swaminathan S, Karplus M (1983) CHARMM: a program for macromolecular energy, minimization, and dynamics calculations. J Comput Chem 4:187–217 Cantarel BL, Coutinho PM, Rancurel C, Bernard T, Lombard V, Henrissat B (2009) The carbohydrate-active enzymes database (CAZy): an expert resource for glycogenomics. Nucleic Acids Res 37:D233–D238 Carrard G, Koivula A, So¨derlund H, Be´guin P (2000) Cellulosebinding domains promote hydrolysis of different sites on crystalline cellulose. Proc Natl Acad Sci USA 97:10342–10347 Damude HG, Withers SG, Kilburn DG, Miller RC Jr, Warren RA (1995) Site-directed mutation of the putative catalytic residues of endoglucanase CenA from Cellulomonas fimi. Biochemistry 34:2220–2224 Davies G, Henrissat B (1995) Structures and mechanisms of glycosyl hydrolases. Structure 3:853–859 du Plessis L, Rose SH, van Zyl WH (2010) Exploring improved endoglucanase expression in Saccharomyces cerevisiae strains. Appl Microbiol Biotechnol 86:1503–1511 Elgavish S, Shaanan B (1997) Lectin-carbohydrate interactions: different folds, common recognition principles. Trends Biochem Sci 22:462–467 Franken KL, Hiemstra HS, van Meijgaarden KE, Subronto Y, den Hartigh J, Ottenhoff TH, Drijfhout JW (2000) Purification of histagged protein by immobilized chelate affinity chromatography: the benefits from the use of organic solvent. Protein Expr Purif 18:95–99
2951 Ho SN, Hunt HD, Horton RM, Pullen JK, Pease LR (1989) Sitedirected mutagenesis by overlap extension using the polymerase chain resction. Gene 77:51–59 Igarashi K, Ishida T, Hori C, Samejima M (2008) Characterization of an endoglucanase belonging to a new subfamily of glycoside hydrolase family 45 of the basidiomycete Phanerochaete chrysosporium. Appl Environ Microbiol 74:5628–5634 Irwin D, Shin D, Zhang S, Barr BK, Sakon J, Karplus A, Wilson DB (1998) Roles of the catalytic domain and two cellulose binding domains of Thermomonospora fusca E4 in cellulose hydrolysis. J Bacteriol 180:1709–1714 Kraulis PJ, Clore GM, Nilges M, Jones TA, Pettersson G, Knowles J, Gronenborn AM (1989) Determination of the three-dimensional solution structure of the C-terminal domain of cellobiohydrolase I from Trichoderma reesi. A study using nuclear magnetic resonance and hybrid distance geometry-dynamical simulated annealing. Biochemistry 28:7241–7257 Linder M, Nevanen T, Teeri TT (1999) Design of a pH-dependent cellulose-binding domain. FEBS Lett 447:13–16 Liu G, Wei X, Qin Y, Qu Y (2010) Characterization of the endoglucanase and glucomannanase activities of a glycoside hydrolase family 45 protein from Penicillium decumbens 114-2. J Gen Appl Microbiol 56:223–229 Medve J, Lee D, Tjerneld F (1998) Ion-exchange chromatographic purification and quantitative analysis of Trichoderma reesei cellulases cellobiohydrolase I, II and endoglucanase II by fast protein liquid chromatography. J Chromatogr A 808:153–165 Miettinen-Oinonen A, Londesborough J, Joutsjoki V, Lantto R, Vehmaanpera¨ J, Biotecd PL (2004) Three cellulases from Melanocarpus albomyces for textile treatment at neutral pH. Enzyme Microb Technol 34:332–341 Miller GL, Blum R, Glennon WE, Burton AL (1960) Measurement of carboxymethylcellulase activity. Anal Biochem 1:127–132 Moriya T, Murashima K, Nakane A, Yanai K, Sumida N, Koga J, Murakami T, Kono T (2003) Molecular Cloning of Endo-betaD-1,4-Glucanase Genes, rce1, rce2 and rce3, from Rhizopus oryzae. J Bacteriol 185:1749–1756 Nakazawa H, Okada K, Onodera T, Oqasawara W, Okada H, Morikawa Y (2009) Directed evolution of endoglucanase III (Cel12A) from Trichoderma reesei. Appl Microbiol Biotechnol 83:649–657 Ramos LP, Breuil C, Saddler JN (1993) The use of enzyme recycling and the influence of sugar accumulation on cellulose hydrolysis by Trichoderma cellulases. Enzyme Microb Tech 15:19–25 Sayle RA, Milner-White EJ (1995) Rasmol: biomolecular graphics for all. Trends Biochem Sci 20:374 Schou C, Rasmussen G, Kaltoft MB, Henrissat B, Schu¨lein M (1993) Sterochemistry, specificity and kinetics of the hydrolysis of reduced cellodextrins by nine cellulases. Eur J Biochem 217:947–953 Schu¨lein M (2000) Protein engineering of cellulases. Biochim Biophys Acta 1543:239–252 Shi H, Yin X, Wu M, Tang C, Zhang H, Li J (2012) Cloning and bioinformatics analysis of an endoglucanase gene (Aucel12A) from Aspergillus usamii and its functional expression in Pichia pastoris. J Ind Microbiol Biotechnol 39:347–357 Shimonaka A, Koga J, Baba Y, Nishimura T, Murashima K, Kubota H, Kono T (2006) Specific characteristics of family 45 endoglucanases from Mucorales in the use of textiles and laundry. Biosci Biotechnol Biochem 70:1013–1016 Teather RM, Wood PJ (1982) Use of congo red-polysaccharide interactions in enumeration and characterization of cellulolytic bacteria from the bovine rumen. Appl Environ Microbiol 43:4777–4780 Tomme P, Warren RAJ, Gilkes NR (1995) Cellulose hydrolysis by bacteria and fungi. Adv Microb Physiol 37:1–81
123
2952 Valjakka J, Rouvinen J (2003) Structure of 20 K endoglucanase from Melanocarpus albomyces at 1.8 A resolution. Acta Crystallogr D Biol Crystallogr 59:765–768 Vlasenko E, Schu¨lein M, Cherry J, Xu F (2010) Substrate specificity of family 5, 6, 7, 9, 12, and 45 endoglucanases. Bioresour Technol 101:2405–2411 Wang T, Liu X, Yu Q, Zhang X, Qu Y, Gao P, Wang T (2005) Directed evolution for engineering pH profile of endoglucanaseIII from Trichoderma reesei. Biomol Eng 22:89–94
123
World J Microbiol Biotechnol (2014) 30:2943–2952 Warner CD, Camci-Unal G, Pohl NLB, Ford C, Reilly PJ (2013) Substrate binding by the catalytic domain and carbohydrate binding module of ruminococcus flavefaciens FD-1 xyloglucanase/endoglucanase. Ind Eng Chem Res 52:30–36
ORIGINAL PAPER
Expression and functional analysis of a glycoside hydrolase family 45 endoglucanase from Rhizopus stolonifer Bin Tang • Yingying Zhang • Yaping Yang Zhewei Song • Xianglin Li
•
Received: 6 July 2013 / Accepted: 11 August 2014 / Published online: 28 August 2014 Ó Springer Science+Business Media Dordrecht 2014
Abstract A novel endoglucanase gene was cloned from Rhizopus stolonifer and expressed in Escherichia coli, the gene product EG II (45 kDa) was assigned to Glycoside Hydrolase Family 45 (GH45), and its specific activity on phosphoric acid-swollen cellulose (PASC) was 48 IU/mg. To solve the problem of substrate accumulation in the cellulose hydrolysis and enhance the catalytic efficiency of endoglucanase, the eg2 gene was modified by site directed mutagenesis. Mutations generated by overlapping PCR have been proven to increase its catalytic activity on carboxymenthyl cellulose, microcrystalline cellulose (Avicel) and PASC, among which the mutant EG II-E containing all 6 mutations (N39S, V136D, T251G, D255G, P256S and E260D) peaked 121 IU/mg on PASC. The bioinformatic analysis showed that 2 key catalytic residues (D136 and D260) moved closer with the opening of a loop after mutagenesis, and a tunnel was formed by structural transformation. This structure was conducive for the substrate to access the active centre, and D136 played an indispensable role in the substrate recognition. Keywords Endoglucanase Rhizopus stolonifer Structure–function Mutagenesis
B. Tang (&) Y. Zhang Y. Yang Z. Song X. Li College of Biochemical Engineering, Anhui Polytechnic University, Wuhu 241000, China e-mail: [email protected] B. Tang Y. Zhang Y. Yang Z. Song X. Li Engineering Technology Research Center of Microbial Fermentation, Anhui Polytechnic University, Wuhu 241000, China
Introduction Endoglucanases catalyze the hydrolysis of the cellulose to yield cello-oligosaccharides by facilitating the random cleavage of the internal b-1,4-D-glycosidic linkages within amorphous regions of cellulose chains (Tomme et al. 1995). Generally, there are three components of endoglucanase, the cellulose-binding domain (CBD), the catalytic domain (CD) and a linker with different length (Be´guin and Aubert 1994). CBD is composed of various carbohydrate-binding modules (CBM) which are very essential for the recognition and incorporation of the cellulase with substrates (Batista et al. 2011). CD is substrate-specific, and can play a catalytic role independently (Warner et al. 2013). Generally, there is a cleft or groove on the surface of endoglucanases, which allows the binding of several sugar units on polymeric substrates simultaneously (Davies and Henrissat 1995). Endoglucanases are classified into different glycoside hydrolase families (GHs) based on amino acid sequence similarity (Cantarel et al. 2009). Proteins of GH45, reported as endoglucanases, have been found in bacteria, fungi and animals (Liu et al. 2010). GH45 endoglucanases act by inverting the anomeric configuration (Schou et al. 1993) and have been widely used in industrial manufacturing because of their high activities (Hirvonen and Papageorgiou 2003; Azevedo et al. 2000). Proteins of this family share a common six-stranded b-barrel structure with long interconnecting loops (Schu¨lein 2000). Endoglucanases have been extensively studied because of their role in the cellulose degradation, and their application to a wide range of industrial fields such as food, textile, bioethanol, brewery and pulp (Bhat 2000; Miettinen-Oinonen et al. 2004). The GH45 endoglucanases have a dispersing effect on solid cellulose without hydrolyzing them. They are the main endoglucanases used in the textile
123
2944
and detergent industries because of their high defibrillation activities (Shimonaka et al. 2006). One of the bottlenecks to widespread biorefining application is the enzymatic hydrolysis of the cellulosic material into sugars. Sitedirected mutagenesis and directed evolution by random mutation are used to improve the catalytic efficiency of endoglucanases (Damude et al. 1995; Wang et al. 2005; du Plessis et al. 2010). In addition, the catalytic mechanism of endoglucanase is one of the hot topics, although it has not been fully clarified. In order to enhance the catalytic ability of endoglucanases, herein this paper, mutation of the catalytic domain of a GH45 endoglucanase EG II, together with the corresponding structure and effects on the enzymatic activity were studied, from which the preliminary structure–function relationship was investigated.
World J Microbiol Biotechnol (2014) 30:2943–2952
ProtScale (http://web.expasy.org/cgi-bin/protscale/protscale.pl) and TMHMM 2.0 (http://www.cbs.dtu.dk/services/TMHMM/) were used for prediction of the hydrophobicity and transmembrane region, respectively. The SignalP 4.0 (http://www.cbs.dtu. dk/services/SignalP/) was applied to predict the signal peptide sequence of EG II. The key functional sites of EG II were predicted by using the PROSITE (http://prosite.expasy.org/) and the CDD database (http://www.ncbi.nlm.nih.gov/Structure/cdd/ wrpsb.cgi). Homology alignment of the primary structure between EG II and other endoglucanases was carried out in the PDB database using the BLAST program, together with the MegAlign and the ClustalX 1.8 program. The tertiary structure of EG II was predicted by the Phyre 0.2 (http://www.sbg.bio.ic. ac.uk/*phyre/index.cgi). The RasMol 2.6 was used to show the structure of proteins intuitively (Sayle and Milner-White 1995). The Discovery Studio 2.5 was used to define the sphere of receptor and the docking of ligands into the active site by CHARMm (Brooks et al. 1983).
Materials and methods Endoglucanase gene extraction The coding sequence of endoglucanase was amplified from the cDNA template of Rhizopus stolonifer var. Reflexus TP-02 by cDNA library construction method. Anchor primer was used to guide the synthesis of the first-strand cDNA under the function of reverse transcriptase. A pair of specific primers eg2-F (50 CCGGAATTCATGAAGTTTAT TACTATTACGTC30 ) and eg2-R (50 CCCAAGCTTTTAT TT TCTTGAACAACCTGTC30 ) with EcoRI and HindIII sites (underlined), respectively, was used directly to amplify the cDNA sequence that encodes the mature EG II. The Taq DNA polymerase used in PCR was purchased from Sangon (Shanghai, China). PCR was performed under the following conditions: an initial denaturation at 95 °C for 5 min; 30 cycles of denaturation at 94 °C for 30 s, annealing at 56 °C for 30 s, and extension at 72 °C for 75 s, plus an extra elongation at 72 °C for 10 min. Then the target PCR product was agarose gel-purified and digested with EcoRI and HindIII. The resulting cDNA fragment was inserted into pET28a vector digested with the same restriction enzymes, followed by the transformation into Escherichia coli DH5a and BL21 separately. The recombinant E. coli was screened by CMC Congo red plate screening method (Teather and Wood 1982). The recombinant expression vector containing the correct insert, named as pET28a-eg2, was confirmed by restriction enzyme analysis and DNA sequencing. Bioinformatics analysis of EG II Physicochemical properties of the EG II were identified by using the Protparam (http://web.expasy.org/protparam/). The
123
Mutagenesis of EG II Mutation sites were selected according to the results from bioinformatic analysis as described previously. All the mutations were generated using the PCR overlap extension method with pET28a-eg2 as the template (Ho et al. 1989). All overlapping PCR primers, listed in Table 1, were synthesized by Sangon (Shanghai, China). Primers A1 and B2 were used in every PCR reaction as upstream primers and downstream primers respectively. Other five groups of primers were designed to introduce the desired mutations. High fidelity Pfu DNA polymerase, purchased from Sangon (Shanghai, China), was chosen for the overlapping PCR. Conditions of this PCR were as previously described except the number of cycles, which was 22–25 cycles. All resulting PCR products were cloned into pET28a using the unique EcoR I and Hind III sites and transformed into E.coli BL21, followed by screening of the transformants by a CMC-Na medium. Composition of this medium was as follows: CMC-Na 1.5 %, (NH4)2SO4 0.3 %, KH2PO4 0.1 %, MgSO4 0.05 %, and Agar 2 %. Protein expression The recombinant E. coli BL21 harboring eg2 was grown in the LB medium, with kanamycin at a concentration of 50 lg/mL. It was incubated at 37 °C until an OD of 0.8 at 600 nm was obtained, and this culture was induced by 1 mM IPTG. The culture fluid was withdrawn at 3, 6, 9, 12, 18, 21 and 24 h after induction, and it was centrifuged at 4,193g for 10 min. Supernatant was discarded and the precipitate was resuspended in 1 mL citrate buffer (0.05 M, pH 5.0). This mixture was lysed by repeated
World J Microbiol Biotechnol (2014) 30:2943–2952 Table 1 The sequences of primers for overlapping PCR
Mutations
N39S V136D
2945
Primers
Sequences (50 –30 )
A1
AAATAATTTTGTTTAACTTTAAGAAGG
27
B2
ACCCCTCAAGACCCGTTTAG
20
A2
CCACTCCAGTCCTTACCACC
20
B1
AAGGACTGGAGTGGCCCTAC
20
A3
CAATCCCAATAACGAGTAGTGAC
23
Size (bp)
B3
ACTCGTTATTGGGATTGTTGTC
22
T251G
A4
GGTCGCCTCCCTTGATAGC
19
B4
AGGCTATCAAGGGAGGCGAC
20
D255G
A5
GGCTTGAAGAACCTAGGTCG
20
P256S
B5
ACCTAGGTTCTTCAAGCCTCG
21
E260D
A6
GTCTGCAAGTTGAGTCGAGG
20
B6
AGCCTCGACTCAACTTGCAG
20
freezing and thawing and centrifuged again at 4,193g for 30 min. Supernatant was taken out for determination of the activity on cellulose substrates. Enzymatic assays Endoglucanase samples (1 mL) were incubated with 1 mL of 1 % (w/v) sodium carboxymethylcellulose (CMC) in sodium acetate buffer (0.1 M, pH4.8) at 50 °C for 30 min. Inactivated enzyme solution was used as a control group. The reduced sugars were measured according to the DNS method (Miller et al. 1960). Furthermore, activity on Avicel and PASC was determined with 0.5 % (w/v) Avicel or 2 % (w/v) PASC (purchased from Sinopharm Chemical Reagent Co., Ltd), 50 °C for 60 min, to study the substrate specificity of family 45 endoglucanase (Vlasenko et al. 2010). One unit of endoglucanase (EC 3.2.1.4 cellulase, CMCase or ß-1,4-endoglucanase) activity was defined as the amount of enzyme which produces 1 lmol glucose every minute. SDS-PAGE analysis The zymotic fluid was removed and centrifuged at 21 h after the induction training, and the lower precipitate was suspended with citrate buffer (0.05 M, pH 5.0) afterwards. Recombinant proteins within the cell were released by cell rupturing and analyzed by 12 % sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE). Proteins in the gel were stained with Coomassie Brilliant blue R-250 and then washed in 10 % methanol for 2–4 h. The gel was visualized and photographed on a UV–visible transilluminator. Purification and adsorption studies EG II and its mutant were purified from the fermentation broth concentration by affinity chromatography on a Ni-
chelating column (Franken et al. 2000). Protein concentration was determined in the absorption at 280 nm. Specific activity of the pure enzyme on CMC, Avicel and PASC was determined with 5 % (w/v) CMC or 2 % (w/v) Avicel or 10 % (m/v) PASC, 0.05–5 mg/L enzyme, 0.5 g/ L bovine serum albumin (BSA), 0.1 M sodium acetate, pH 4.8, 50 °C, 30–60 min. The data of activity was expressed in units per milligram of the pure enzyme. The adsorption of enzyme to Avicel was studied by incubating samples with 2 % (m/v) Avicel for 5 h at 4 °C (Medve et al. 1998), while the enzyme/substrate ratio was 0.25 lmol/g and the sampling time was varied between 2 min and 5 h. Avicel with the bound enzymes was separated by filtering the incubation samples through a millex with 0.22 lm pore size. The filtrate was immediately analyzed by HPLC to measure hydrolysis products. Adsorption was expressed as enzyme bound per gram residual substrate that was calculated from the original substrate concentration based on the hydrolysis data. To study the processivity of enzymes, we adopted an indirect method by comparing the ratio of the soluble reducing sugars to the insoluble one (Irwin et al. 1998).
Results Cloning, expression and characterization of the gene eg2 In this study we obtained a novel endoglucanase gene eg2 from R. stolonifer var. Reflexus TP-02, which was cloned in pET28a expression vector and transformed into E. coli BL21 strain for recombinant protein production. The endoglucanase activity of recombinant protein was studied, and the maximum endoglucanase activity of EG II encoded by eg2 was 1.527 IU/mL on PASC observed at 21 h during the induction process. The novel gene eg2 was deposited
123
2946
Fig. 1 Amino acid sequence alighment of CBM1. ADC83999 (Trichoderma reesei), AAU05379 (Trichoderma parceramosum), and ABF56208 (Trichoderma koningii) are chosen, and all the
World J Microbiol Biotechnol (2014) 30:2943–2952
sequences are indicated by their Genbank codes. Identical amino acid residues are highlighted in grey. Thirteen conserved residues are boxed
Fig. 2 Amino acid sequence alighment of GH45 domain. 1L8F (Melanocarpus albomyces), 1HD5 (Humicola insolens), and 4ENG (Humicola insolens) are chosen for multiple sequence alignment. Sequences are indicated by their PDB codes. The identical amino acid residues in four endoglucanases are in a grey background. Two catalytic residues and other important residues, strictly conserved among the GH45 family members, are boxed
into the GenBank (Accession number to the nucleotide sequence database is JX315341). The length of this gene is 954 bp, containing an open reading frame (ORF) which encodes for a 317 amino acid protein, EG II. Protein analyses by Protparam showed the formula of EG II is C1472H2308N420O482S23, with its theoretical isoelectric point being 8.78. From ProtScale and TMHMM 2.0 analyses, it was predicted that EG II is a globular protein with good solubility. Protein BLAST (Basic Local Alignment Search Tool) results from PROSITE and CDD databases demonstrated that EG II belongs to Glycoside Hydrolase Family 45 (GH45), containing a fungal cellulose binding domain CBM1 (Carbohydrate Binding Module family 1) and two GH45 domains. SignalP 4.0 tool predicted an unambiguous signal peptide cleavage site between A23 and A24, which was in agreement with the N-terminal sequence alignment of the GH45 fungal endoglucanases. Selection of mutation sites Candidate residues for mutation were chosen according to the structural and functional analysis of EG II. Sequence
123
alignment of the homologous CBM1 domains revealed that an Asn substitutes for a Ser which is conserved in the trichoderma species at position 39 (Fig. 1), which is one of the residues forming the flat and hydrophilic surface of the molecule crucial for carbohydrate binding (Kraulis et al. 1989). Results of the homology alignment of GH45 domains showed two mutations of the highly conserved Asp to a Val at position 136 of EG II, and another to a Glu at position 260 (Fig. 2). These two conserved Asp were found at similar positions in the active site of many endoglucanases. The former can affect enzymatic function as the basis of catalytic residues, while the latter principally participates in the catalytic process (Valjakka and Rouvinen 2003). Furthermore, the 251–256 ordered loop was supposed to increase the hydrophobicity of the environment around the acidic group which acts as the catalytic active center, thus to prevent the entry of various nucleophiles into the active site except water molecules (Hirvonen and Papageorgiou 2003). On the other hand, three mutations of conversed residues were found in this loop. In a summary, all the mutation sites were N39, V136, T251, D255, P256 and E260.
World J Microbiol Biotechnol (2014) 30:2943–2952
2947
Fig. 3 Predicted GH45 domain structure of EG II (a) and its mutant EG II-E (b). Mutagenesis of V136D and E260D reduce the distance between them, and change the structure of active domain at the same time. Moreover, modifications of the loop also change the space position of
those 2 catalytic residues. C. Superimposed molecules of EG II (blue) and EG II-E (indigo). Mutation sites of EG II are green, the corresponding sites of EG II-E are yellow. D. The surface of two superimposed molecules and the yellow one is EG II. (Color figure online)
Structural analysis of GH45 domains
shown far apart from each other, with the 251–256 loop located in the middle. Structure of the mutant showed that D136 and D260 were closer after mutagenesis, and the loop was found on the other side of the active site. The superimposed proteins were generated, and the main-chain ˚. RMSD is 5.428 A
Tertiary structure of the GH45 domains between EG II and its mutant EG II-E were predicted, and the latter contained six mutations (N39S, V136D, T251G, D255G, P256S and E260D). The template for homology modeling was 1L8f ˚ (endoglucanase from Melanocarpus albomyces at 1.8 A resolution), which had 42 % identity with EG II. The modeled structures revealed that these mutations changed the structure of GH45 domain obviously. All these residues were shown in ball-and-stick model, and highlighted in different colors accordingly (Fig. 3). The C-alpha trace of the protein was shown in blue ribbons. Six-stranded bbarrel domain was found in the GH45 domain of EG II. Two catalysis residues of EG II (V136 and E260) were
Docking ligands into the active site of EG II We defined the active center of EG II and delimited the sphere of center as a receptor, then docked the ligands into the active site. Cellopentaose was chosen as a ligand to participate in the process of binding with EG II. The result was shown in Fig. 4. Stereo view of EG II-cellopentose complex (Fig. 4a) and the mutant EG II-E-cellopentose
123
2948
123
World J Microbiol Biotechnol (2014) 30:2943–2952
World J Microbiol Biotechnol (2014) 30:2943–2952
2949
b Fig. 4 Structure of GH45 domains-cellopentose complex. A. Stereo
view of EG II-cellopentose complex. B. The binding sites of cellopentose, hydrogen bonds are indicated with dashed lines. C. Stereo view of the mutant EG II-E-cellopentose complex. The entrance of the tunnel into the active centre of EG II-E is labeled with yellow dotted circle. D. Residues binding with cellopentose in the entrance of tunnel. E. The exit of the tunnel is labeled with yellow dotted circle. F. Residues binding with cellopentose in the exit of tunnel. (Color figure online)
complex (Fig. 4c, e) indicated that ligand binding mode produced a distinct approach to the receptor after mutagenesis. A tunnel formed from structural adjustment caused by the mutated residues was found in EG II-E. The entrance of this tunnel into the active centre (Fig. 4c) and the exit (Fig. 4e) were labeled with yellow dotted circle. The relationship between receptor and ligand was displayed by hydrogen bonds indicating with dashed lines. W135, C137, Q139, K147, N214 and S242 of EG II participated in binding with cellopentose (Fig. 4b) while the residues involved in EG II-E were Y134, D136, C137, C138, Q139, K159, G161, N214, S227 and D241 at both ends of the tunnel (Fig. 4d, f). It was indicated that V136D mutation of EG II exhibited the strongest interaction with cellopentose, confirming the indispensable role of D136 in the ligand recognition. Mutagenesis and expression of recombinant endoglucanases EG II-E containing all six mutation sites was generated as mentioned above, and the mutant was successfully expressed in E. coli screening by the selected medium. The total protein yield of EG II-E was 158 mg/L, which was similar with that of EG II (165 mg/L). Recombinant proteins of EG II and the mutant EG II-E were assayed to compare their hydrolysis activities on various cellulose substrates. There was a significant increase in specificity activity of the mutant EG II-E comparing with the wild type EG II. The specific activity on CMC, Avicel and PASC of pure EG II was 21, 2, and 48 IU/mg, respectively, while the corresponding data of pure EG II-E was 42, 3, and 121 IU/mg. The data showed that substrate specificity of those enzymes was much higher on PASC than on CMC, and the lowest was on Avicel. To further check expression of EG II and EG II-E in E. coli BL21, the zymotic samples were separated by SDS-PAGE with control groups (uninduced samples). The band at position 45 kDa was observed in the sample of recombinants E. coli induced by IPTG (Fig. 5). Adsorption to Avicel The adsorption to cellulose was studied at 50 °C by incubating the purified endoglucanase with Avicel. Enzyme
Fig. 5 SDS-PAGE analysis of recombinant E. coli. Lane M, protein marker (Sangon); Lane 1, total protein in IPTG-induced E. coli BL21/ pET28a-eg2; Lane 2, total protein in uninduced E. coli BL21/ pET28a-eg2; Lane 3, total protein in IPTG-induced E. coli BL21/ pET28a-eg2-e; Lane 4, total protein in IPTG-induced E. coli BL21/ pET28a
adsorption and the production of soluble sugars were shown in Fig. 6. The adsorption behavior of two enzymes was similar with a quickly starting and a smooth deceleration. However, the mutant EG II-E showed a slightly higher rate of the original adsorption with Avicel EG II. In addition, the ratios of soluble/insoluble reducing sugars released by EG II and EG II-E were calculated. The soluble/insoluble ratio of EG II was 1.8 while the ratio of EG II-E was 3.2.
Discussion The GH45 endoglucanases have a broad substrate specificities for b-1,3/1,4-glucans. So far, numerous fungal GH45 endoglucanases have been purified and characterized. In previous studies, Phanerochaete chrysosporium PcCel45A has been confirmed with apparent hydrolytic activity toward various substrates (Igarashi et al. 2008). The specific activities of PcCel45A for lichenan and barley b-glucan are higher than those for PASC and CMC. Moreover, 3 GH45 endoglucanases, RCE1, RCE2, and RCE3 from Rhizopus oryzae, show much higher activities against soluble cellulose than against crystallization cellulose (Moriya et al. 2003). In this paper, EG II and EG IIE showed hydrolytic activity toward amorphous cellulose as is the case for the known GH45 endoglucanases. Unlike
123
2950
World J Microbiol Biotechnol (2014) 30:2943–2952
0.2
0.3
0.2 0.1 0.1
0
0.0 0
100 200 Time (min)
300
B Bound enzyme (µmol/g Avicel)
Sugars produced (g/L)
0.4
0.6 0.5
0.2
0.4 0.3 0.1 0.2
Sugars produced (g/L)
Bound enzyme (µmol/g Avicel)
A
0.1 0
0.0 0
100 200 Time (min)
300
Fig. 6 Adsorption of EG II (a) and EG II-E (b) to Avicel. The concentration of bound enzyme is shown in solid line, and the corresponding consistency of soluble sugars is shown in dotted line
PcCel45A, EG II and EG II-E have a higher specific activity on PASC than on CMC, which might be caused by the different structures. CBM domains are important to recognize, coact and boost the incorporation of the cellulase with the substrate (Batista et al. 2011). The S39 of CBM1 was reported to participate in forming the hydrophilic surface of cellulase crucial for carbohydrate binding as described previously (Kraulis et al. 1989). The adsorption rate of EG II-E (containing N39S) raised faster in the first 5 min of incubation with Avicel than EG II. This residue site may improve the adsorption rate to influence the function of CBM1, but the mechanism is not unclear. CD domains of endoglucanases are submitted to the substrates by CBM domain that is absorbed on the surface of cellulose to defiber the structure of crystallization cellulose (Carrard et al. 2000). However, the interaction mechanism between CD domains and substrates is still ambiguous. It is widely believed that CD domains have a large groove on the surface to allow long chain cellulose to enter into the active center (Shi et al. 2012). Lots of polar residues on the surface of CD domain participate in the process of attracting the electron cloud of glycosidic bonds,
123
and then pull the bonds. Nevertheless, residues participated in the reaction are too many and are unevenly distributed, which may lead to an inhomogeneous force and thus may not accurately pull the glycosidic bonds. Accumulation of substrates in the groove of CD domain may bring out a traffic jam, reducing hydrolytic efficiency of cellulase on cellulose surface (Ramos et al. 1993). There is a cleft complemented with substrates such as cellopentose on the surface of GH45 domain, which is the CD domain of EG II. Polar groups and some charged/polar residues such as Asn may attract substrates via hydrogen bonds, and aromatic amino acids such as Trp are also involved in this process. Studies of many different proteincarbohydrate interactions imply a stacking interaction between the sugar rings and the side chains of aromatic residues such as Tyr, Phe and Trp (Elgavish and Shaanan 1997; Linder et al. 1999). Mutagenesis of the key residues in the active center was achieved to overcome the stacking interaction of the substrates. Structure of GH45 domain was substantially modified because of the mutagenesis, and a special tunnel was formed with the opening of mutation loops that cover part of the cleft. This topology is just found in cellobiohydrolases, and the active center inside the tunnel allows enzymes to release the product while remaining firmly bound to the polysaccharide chain, thereby creating the conditions for processivity (Davies and Henrissat 1995). Our study on the ratios of soluble/insoluble sugars released by native and mutant EG II revealed that the processivity was effectively improved after mutagenesis, while the mutant had a higher specificity activity on cellulose substrates. It is noteworthy that the processivity is probably a key factor for the efficient enzymatic degradation of insoluble microcrystalline cellulose. The binding mode of EG II with substrates was changed when the tunnel formed, which might avoid the substrate accumulation and keep the substrates interacting with more residues to break glycosidic bonds. A series of polar residues participated in the process of drawing the long chain of cellulose molecules into the tunnel and the process of releasing oligosaccharides with unequal length. All the polar groups revolved around D136, which might play an indispensable role in the ligand recognition. D136 interacted with cellopentose O26 and O20 through two strong hydrogen bonds in the entrance and exit of the tunnel (Fig. 4d, f). It is particularly noteworthy that the efficiency of cellulase in the degradation process of cellulose would increase by the tunnel connected with the active center. In general, CBM1 and GH45 domain play a pivotal role in endoglucanase activity of R. stolonifer var. reflexus TP02. However, the detailed mechanism for endoglucanase catalysis of GH45 domain is still unclarified and needs further studies. In this paper, a tunnel was formed in the
World J Microbiol Biotechnol (2014) 30:2943–2952
mutant EG II-E with all six mutations, which was responsible for substrate to enter the active center accurately and continuously, thus successfully avoided the traffic jam. This mutant exhibited a significant specific activity for cellulose substrates (CMC, Avicel and PASC), especially the specificity on PASC. Currently, preliminary studies concerning the influence of structural modifications on the function of EG II by structural modification have been completed preliminary, which may provide important insights into further investigation on the mechanism of the cellulose hydrolysis process. Our future research will focus on the detailed roles of those residues during cellulose degradation process and the corresponding mechanism. Acknowledgments This work was financially supported by the National Natural Science Foundation of China (No. 30270135).
References Azevedo H, Bishop D, Cavaco-Paulo A (2000) Effects of agitation level on the adsorption, desorption, and activities on cotton fabrics of full length and core domains of EGV (Humicola insolens) and CenA (Cellulomonas fimi). Enzyme Microb Technol 27:325–329 Batista PR, de Souza Costa MG, Pascutti PG, Bisch PM, de Souza W (2011) High temperatures enhance cooperative motions between CBM and catalytic domains of a thermostable cellulase: mechanism insights from essential dynamics. Phys Chem Chem Phys 13:13709–13720 Be´guin P, Aubert JP (1994) The biological degradation of cellulose. FEMS Microbiol Rev 13:25–58 Bhat MK (2000) Cellulases and related enzymes in biotechnology. Biotechnol Adv 18:355–383 Brooks BR, Bruccoleri RE, Olafson BD, States DJ, Swaminathan S, Karplus M (1983) CHARMM: a program for macromolecular energy, minimization, and dynamics calculations. J Comput Chem 4:187–217 Cantarel BL, Coutinho PM, Rancurel C, Bernard T, Lombard V, Henrissat B (2009) The carbohydrate-active enzymes database (CAZy): an expert resource for glycogenomics. Nucleic Acids Res 37:D233–D238 Carrard G, Koivula A, So¨derlund H, Be´guin P (2000) Cellulosebinding domains promote hydrolysis of different sites on crystalline cellulose. Proc Natl Acad Sci USA 97:10342–10347 Damude HG, Withers SG, Kilburn DG, Miller RC Jr, Warren RA (1995) Site-directed mutation of the putative catalytic residues of endoglucanase CenA from Cellulomonas fimi. Biochemistry 34:2220–2224 Davies G, Henrissat B (1995) Structures and mechanisms of glycosyl hydrolases. Structure 3:853–859 du Plessis L, Rose SH, van Zyl WH (2010) Exploring improved endoglucanase expression in Saccharomyces cerevisiae strains. Appl Microbiol Biotechnol 86:1503–1511 Elgavish S, Shaanan B (1997) Lectin-carbohydrate interactions: different folds, common recognition principles. Trends Biochem Sci 22:462–467 Franken KL, Hiemstra HS, van Meijgaarden KE, Subronto Y, den Hartigh J, Ottenhoff TH, Drijfhout JW (2000) Purification of histagged protein by immobilized chelate affinity chromatography: the benefits from the use of organic solvent. Protein Expr Purif 18:95–99
2951 Ho SN, Hunt HD, Horton RM, Pullen JK, Pease LR (1989) Sitedirected mutagenesis by overlap extension using the polymerase chain resction. Gene 77:51–59 Igarashi K, Ishida T, Hori C, Samejima M (2008) Characterization of an endoglucanase belonging to a new subfamily of glycoside hydrolase family 45 of the basidiomycete Phanerochaete chrysosporium. Appl Environ Microbiol 74:5628–5634 Irwin D, Shin D, Zhang S, Barr BK, Sakon J, Karplus A, Wilson DB (1998) Roles of the catalytic domain and two cellulose binding domains of Thermomonospora fusca E4 in cellulose hydrolysis. J Bacteriol 180:1709–1714 Kraulis PJ, Clore GM, Nilges M, Jones TA, Pettersson G, Knowles J, Gronenborn AM (1989) Determination of the three-dimensional solution structure of the C-terminal domain of cellobiohydrolase I from Trichoderma reesi. A study using nuclear magnetic resonance and hybrid distance geometry-dynamical simulated annealing. Biochemistry 28:7241–7257 Linder M, Nevanen T, Teeri TT (1999) Design of a pH-dependent cellulose-binding domain. FEBS Lett 447:13–16 Liu G, Wei X, Qin Y, Qu Y (2010) Characterization of the endoglucanase and glucomannanase activities of a glycoside hydrolase family 45 protein from Penicillium decumbens 114-2. J Gen Appl Microbiol 56:223–229 Medve J, Lee D, Tjerneld F (1998) Ion-exchange chromatographic purification and quantitative analysis of Trichoderma reesei cellulases cellobiohydrolase I, II and endoglucanase II by fast protein liquid chromatography. J Chromatogr A 808:153–165 Miettinen-Oinonen A, Londesborough J, Joutsjoki V, Lantto R, Vehmaanpera¨ J, Biotecd PL (2004) Three cellulases from Melanocarpus albomyces for textile treatment at neutral pH. Enzyme Microb Technol 34:332–341 Miller GL, Blum R, Glennon WE, Burton AL (1960) Measurement of carboxymethylcellulase activity. Anal Biochem 1:127–132 Moriya T, Murashima K, Nakane A, Yanai K, Sumida N, Koga J, Murakami T, Kono T (2003) Molecular Cloning of Endo-betaD-1,4-Glucanase Genes, rce1, rce2 and rce3, from Rhizopus oryzae. J Bacteriol 185:1749–1756 Nakazawa H, Okada K, Onodera T, Oqasawara W, Okada H, Morikawa Y (2009) Directed evolution of endoglucanase III (Cel12A) from Trichoderma reesei. Appl Microbiol Biotechnol 83:649–657 Ramos LP, Breuil C, Saddler JN (1993) The use of enzyme recycling and the influence of sugar accumulation on cellulose hydrolysis by Trichoderma cellulases. Enzyme Microb Tech 15:19–25 Sayle RA, Milner-White EJ (1995) Rasmol: biomolecular graphics for all. Trends Biochem Sci 20:374 Schou C, Rasmussen G, Kaltoft MB, Henrissat B, Schu¨lein M (1993) Sterochemistry, specificity and kinetics of the hydrolysis of reduced cellodextrins by nine cellulases. Eur J Biochem 217:947–953 Schu¨lein M (2000) Protein engineering of cellulases. Biochim Biophys Acta 1543:239–252 Shi H, Yin X, Wu M, Tang C, Zhang H, Li J (2012) Cloning and bioinformatics analysis of an endoglucanase gene (Aucel12A) from Aspergillus usamii and its functional expression in Pichia pastoris. J Ind Microbiol Biotechnol 39:347–357 Shimonaka A, Koga J, Baba Y, Nishimura T, Murashima K, Kubota H, Kono T (2006) Specific characteristics of family 45 endoglucanases from Mucorales in the use of textiles and laundry. Biosci Biotechnol Biochem 70:1013–1016 Teather RM, Wood PJ (1982) Use of congo red-polysaccharide interactions in enumeration and characterization of cellulolytic bacteria from the bovine rumen. Appl Environ Microbiol 43:4777–4780 Tomme P, Warren RAJ, Gilkes NR (1995) Cellulose hydrolysis by bacteria and fungi. Adv Microb Physiol 37:1–81
123
2952 Valjakka J, Rouvinen J (2003) Structure of 20 K endoglucanase from Melanocarpus albomyces at 1.8 A resolution. Acta Crystallogr D Biol Crystallogr 59:765–768 Vlasenko E, Schu¨lein M, Cherry J, Xu F (2010) Substrate specificity of family 5, 6, 7, 9, 12, and 45 endoglucanases. Bioresour Technol 101:2405–2411 Wang T, Liu X, Yu Q, Zhang X, Qu Y, Gao P, Wang T (2005) Directed evolution for engineering pH profile of endoglucanaseIII from Trichoderma reesei. Biomol Eng 22:89–94
123
World J Microbiol Biotechnol (2014) 30:2943–2952 Warner CD, Camci-Unal G, Pohl NLB, Ford C, Reilly PJ (2013) Substrate binding by the catalytic domain and carbohydrate binding module of ruminococcus flavefaciens FD-1 xyloglucanase/endoglucanase. Ind Eng Chem Res 52:30–36
