1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54
YFSIM3431_proof ■ 13 May 2015 ■ 1/7
Fish & Shellfish Immunology xxx (2015) 1e7
Contents lists available at ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Short communication
Q2
Expression and function analysis of two naturally truncated MyD88 variants in the Pacific oyster Crassostrea gigas
Q1
Fengjiao Xu a, b, 1, Yang Zhang a, 1, Jun Li a, Yuehuan Zhang a, Zhiming Xiang a, Ziniu Yu a, * a
Key Laboratory of Tropical Marine Bio-resources and Ecology, South China Sea Institute of Oceanology, Chinese Academy of Sciences, Guangzhou 510301, China b Graduate School of Chinese Academy of Sciences, Beijing 100049, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 16 February 2015 Received in revised form 20 April 2015 Accepted 27 April 2015 Available online xxx
Myeloid differentiation factor 88 (MyD88) is the classic signaling adaptor that mediates Toll/interleukin1 receptor (TIR/IL-1R) dependent activation of nuclear factor-kappa B (NF-kB). In this study, two naturally truncated MyD88 members were identified from the Pacific oyster (Crassostrea gigas), namely CgMyD88T1 and CgMyD88-T2. The full-length cDNA of CgMyD88-T1, CgMyD88-T2 are 976 bp and 1038 bp in length, containing an ORF of 552 bp and 555 bp, respectively. The two ORF encode a putative protein of 183 and 184 amino acids, respectively, with a calculated molecular weight of about 21 and 22 kDa. When compared to complete MyD88 paralogues, we found that both CgMyD88-T1 and CgMyD88-T2 contain only TIR domain but lack DD (Death Domain), which share 90.8% of similarity and 71.7% of identity with each other. Phylogenetic tree demonstrated that CgMyD88-T1 and CgMyD88-T2 clustered together and belonged to mollusk branch. Meanwhile, genomic arrangement analysis displayed that the two truncated MyD88s were distributed in tandem in one scaffold, revealing that they may originate from one truncated MyD88s ancestor recently. Expression profile showed that both of CgMyD88 variants were ubiquitously expressed in all tested tissues with highest expression in the gills and hemocytes, respectively. Both truncated CgMyD88 mRNAs were significantly up-regulated in hemocytes under HKLM (heat-killed Listeria monocytogenes) and HKVA (heat-killed Vibrio alginolyticus) challenge. Moreover, either CgMyD88-T1 or CgMyD88-T2 were able to inhibit MyD88 activated Rel/NF-kB activity in HEK293 cell, demonstrating their negative role in regulating MyD88-mediated immune signaling. © 2015 Elsevier Ltd. All rights reserved.
Keywords: Crassostrea gigas Truncated Myd88 variants Rel/NF-kB TIR domain
1. Introduction In the innate immune system, Toll-like receptors (TLRs) are one of germline-encoded pattern-recognition receptors (PRRs) that could recognize pathogen-associated molecular patterns (PAMPs) to initiate immune response of host [1]. Once bound with PAMPs, the intracellular TIR domain of TLRs would recruit several downstream signaling adaptors through TIR dimerization and activate nuclear factor-kB(NF-kB) consequently [2]. Among these adaptors, MyD88 is one of the curial and conserved signaling proteins that mediates activation of most of all TLRs except forTLR3 [3,4]. In the mammals, the typical Myd88 contains three domains, including the
* Corresponding author. South China Sea Institute of Oceanology, Chinese Academy of Sciences, 164 West Xingang Road, Guangzhou 510301, China. Tel./ fax: þ86 20 8910 2507. E-mail address: [email protected] (Z. Yu). 1 These authors contributed equally to this work.
N-terminal death domain (DD), one short intermediate domain (ID) and the C-terminal TIR domain [5]. Through the DD, MyD88, IRAK4 can be recruited and phosphorylated, leading to the activation of TRAF6-TAK1-NF-kB signaling pathway and induction of various inflammatory cytokines [4]. Similarly, inCrassostrea gigas, MyD88 also is involved in TLR signaling and plays an important role in infection-induced hemocytes activation and increase of cytokines TNF mRNA [6], highlighting the crucial function of Myd88 in the innate immune. In the aspect of post-translation regulation, alternative splicing is one of the basic means to increase the biodiversity of proteins in organisms by which one gene sequence codes for multi-variants of proteins [7,8]. The different variants often display dominant negative effect due to the lack of key domain, such as a dominant negative Protein Kinase A mutation [9]. one splicing variant of Myd88 was found to down-regulate TLR signaling with a deletion of the complete ID [10].
http://dx.doi.org/10.1016/j.fsi.2015.04.034 1050-4648/© 2015 Elsevier Ltd. All rights reserved.
Please cite this article in press as: F. Xu, et al., Expression and function analysis of two naturally truncated MyD88 variants in the Pacific oyster Crassostrea gigas, Fish & Shellfish Immunology (2015), http://dx.doi.org/10.1016/j.fsi.2015.04.034
55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
YFSIM3431_proof ■ 13 May 2015 ■ 2/7
2
F. Xu et al. / Fish & Shellfish Immunology xxx (2015) 1e7
Intriguingly, two MyD88 variant have been found by means of whole genome scanning in the Pacific oyster (http://www.oysterdb. com/), demonstrating two truncated forms due to the lack of DD domains. Significantly, these two variants are encoded by genome naturally rather than originated form alternative splicing. Therefore, our study aim to address the following questions: (1) how the two Myd88 variants originate? (2) What's their possible function in innate immune? Considering the central role of TLR signal pathway in host defense, understanding the novel regulatory mechanism may get new insight into complexity of oyster innate immune system. 2. Material and method 2.1. Gene discovery and cloning of CgMyD88 variants The homologs of MyD88s were found by BLAST the Pacific oyster genome (http://www.oysterdb.com/) as full-length MyD88 (AGY49099) as a query. Based on the predicted gene sequence, the primers (Table 1) were designed to amplify either the full-length cDNA or fragments of these MyD88s. To amplify the full-length CgMyD88 variants, RACE was carried out using the BD SMART RACE cDNA Amplification kit (Clontech, USA). All PCR products were cloned into the pMD19-T vector (TaKaRa, Japan) and sequenced using an ABI 3730 DNA sequencer (Applied Biosystems, USA). 2.2. Bioinformatics analysis of the sequences Alignment of amino acids sequences of Myd88 were performed using MegAlign software. The identity and similarity between these amino acid sequences was calculated using MatGAT2.02 software [11]. A phylogenetic tree was constructed using MEGA 5.1 software package with the neighbor-joining method. The protein domains were analyzed using SMART (http://smart.embl-heidelberg.de/). 2.3. Oysters, tissue collection and bacterial challenge Healthy C. gigas (two-year-old, shell height at 10.00 ± 0.05 cm) were collect from Qingdao, Shandong Province, China. The oyster
were fed twice daily with the marine algae in tanks with circulating seawater at 24 ± 1 C, for two weeks acclimation before experiments. For the tissue distribution analysis, equal amounts of tissues (gill, mantle, adductor muscle, heart, digestive gland, gonads and hemocytes) from three oysters were collected. For the in vivo bacterial challenge, 200 oysters were randomly divided into challenged and control group, respectively. Each treatment contained three samples and each sample included five individuals. Oysters were challenged by injecting with 100 ml of heat-killed Listeria monocytogenes (HKLM) or heat-killed Vibrio alginolyticus (HKVA; suspended in 0.1 M PBS at a concentration of 1 108 cell/ml) into adductor muscle. In the control group, the oysters were injected with equal volume of PBS. Hemolymph from five randomly sampled individuals in each group was harvested and mixed together as one sample at different time points (3, 6, 12, 24 h after challenge). 2.4. RNA isolation and real-time quantitative PCR Total RNA were extracted with TRIzol reagent (Invitrogen, USA) following the manufacturer's instructions. The quality of the RNA samples were assessed via a Biophotometer examined at 260/ 280 nm and an electrophoresis using a 1.0% agarose gel. To perform reverse transcription, total RNAs were firstly treated with DNase I (Invitrogen, CA, USA) to remove genomic DNA. Then, RNA was reverse-transcribed using the Super Script III first-strand cDNA synthesis kit with random primers (Invitrogen, USA). The expression patterns of CgMyD88-T1 and CgMyD88-T2 were determined by quantitative real-time PCR (qPCR) and normalized with reference gene geneglyceraldehyde-3-phosphate dehydrogenase (GAPDH). All primers used in this study are listed in Table 1. The qPCR was performed using a Light-Cycler 480II System (Roche, USA) with a 20 mL volume that contained 10 mL 2 Master Mix, 1 mL each of the forward and reverse primers (10 mM), 1 mL 1:10-diluted cDNA, and 7 mL PCR-grade water. The real-time PCR program was designed as follows: 95 C for 10 s; followed by 45 cycles of 95 C for 15 s, 55 C for 15 s and 72 C for 10 s. Dissociation curve analysis of was performed at the end of each PCR reaction to confirm the specificity of the amplification products. Each reaction was
Table 1 Sequences of designed primers used in this study. Primer
Sequence(5'to 30 )
Comment
CgMyD88-T1F CgMyD88-T1R CgMyD88-T1EcoRIF CgMyD88-T1XhoI R CgMyD88-T2F CgMyD88-T2R CgMyD88-T2EcoRI F CgMyD88-T2XhoI R GAPDH-F GAPDH-R Q CgMyD88-T1F Q CgMyD88-T1R Q CgMyD88-T2F Q CgMyD88-T2R Nested Universal Primer CgMyD88-T1 5'race1 CgMyD88-T1 5'race2 CgMyD88-T1 3'race1 CgMyD88-T1 3'race2 CgMyD88-T2 50 race1 CgMyD88-T2 50 race2 CgMyD88-T2 3'race1 CgMyD88-T2 30 race2
TGGTTTCACTTTAGTTGTTGGAT ACGTAATGCCACTGTTCTAAGA CGGAATTCATGGGTGCATATGACTAC ATCTCGAGTTATGCAACGGATGCTTT GCTTAACATCATTGGAGGTGT GCCTTATGCTACAGTTGCTCT CGGAATTCATGGACAATTTTGAATACGA ATCTCGAGTTATGCTACAGTTGCTCTC CTTTCCGCGTACCAGTTCCA GCTGCTTCGCTTGTCTCCAC ACCTCCCCTCCCTACAACCTCAGACT CCTGGTGACATGGAATGGGCAACT TTCAAAGATTATTCCCGACCAAA TATGCTACAGTTGCTCTCATTCTC AAGCAGTGGTATCAACGCAGAGT TTGTCATCACAATTACAGAAGGCAGAATT GAATAATTTTTCTACTCCGAGCACCTGG CACCAGGTGCTCGGAGTAGAAAAATTAT GAGCTGAGAGTCTTTGTTTGGGACAGG CCTCAGTACCATCAAGTCGAATGGGTAT GGATTCCGCCGAAATTACAACTAAAA CGTTCAAAGATTATTCCCGACCAAAG ACAAACTTTTTCGCCACTGCGTAGAG
ORF pCMV-N Flag vector ORF pCMV-N Flag vector Real Time PCR of GAPDH Real Time PCR of CgMyD88-T1 Real Time PCR of CgMyD88-T2 Race adaptor 5'race 3'race 5'race 3'race
Please cite this article in press as: F. Xu, et al., Expression and function analysis of two naturally truncated MyD88 variants in the Pacific oyster Crassostrea gigas, Fish & Shellfish Immunology (2015), http://dx.doi.org/10.1016/j.fsi.2015.04.034
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
YFSIM3431_proof ■ 13 May 2015 ■ 3/7
F. Xu et al. / Fish & Shellfish Immunology xxx (2015) 1e7
performed in triplicates. The relative expression level of CgMyD88 variants were calculated based on the 2DDCt Method [12].
Table 2 Similarity and identity analysis. The shaded area shows the similarity and nonshaded area shows the identity.
2.5. Plasmid construction, cell culture and transfection To examine the effect of CgMyD88 variants on NF-kB transcriptional activity, eukaryotic expression plasmid of CgMyD88-T1 and CgMyD88-T2 were constructed. Complete ORF of CgMyD88 variants were amplified and inserted respectively into pCMV-NFlag (Invitrogen, USA). The primers for the above expression vectors are listed in Table 1. All the resulting colonies were confirmed by sequencing with ABI 3730 DNA sequencer. The HEK293T cells were cultured in Dulbecco's modified Eagle's medium (DMEM, Gibco) containing 10% fetal bovine serum (FBS, Gibco BRL) and antibiotics (100 mg/L streptomycin and 105 U/L penicillin, Gibco) in a humidified incubator under 5% CO2 at 37 C. Transient transfection was performed using Lipofectamine 2000 (Invitrogen) according to the manufacturer's directions. 24 h prior to transfection, HEK293T cells were seeded on 48-well plates (105 cells/well), and transiently co-transfected with NF-kB reporter vectors (100 ng/well), pRL-TK vectors (20 ng/well) and targeted recombined vectors (100, 200, 300, 400 or 500 ng/well). The NF-kB reporter vector [13] and pCMV-N-Flag- CgMyD88 recombined vector [6] were previously constructed in our laboratory, and the Renilla luciferase pRL-Tk vector (Promega) was used as an internal control. The cells were transfected in serum-free culture medium for 4e6 h. Then, the medium was replaced with complete DMEM. 2.6. Dual-luciferase reporter assay and statistical analysis For the dual-luciferase reporter assays, the cells were lysed at 48 h post-transfection and measured using a luciferase reporter assay system (Promega, USA). Each experiment was performed in triplicate and repeated at least three times at different times and under similar conditions. To eliminate the influence of the differences in transfection efficiency, the relative luciferase values were calculated by normalized the firefly luciferase activity on basis of activity of the Renilla luciferase activity. The experimental results are expressed as fold stimulation changes relative to the empty vector control. All results are shown as the mean ± SD. The significance of data was examined using one-way ANOVA followed by the Tukey multiple comparison tests using the SPSS software package. 3. Result 3.1. cDNA cloning and characterization of CgMyD88-T1and CgMyD88s-2 The full length of CgMyD88-T1 and CgMyD88-T2 (GenBank accession No. KP222301and KP222302) cDNA and predicted amino acid sequences are shown in Fig. 1S. They contain a 552 bp or a 555 bp ORF, encoding 183 or 184 amino acid residues, respectively. SMART analysis showed that both of the CgMyD88 variants only contain a TIR domain, lacking of the typical C-terminal DD domain. Multiple sequence alignments revealed that the TIR domains of vertebrate share 47.4e88.4% of identity, and that of invertebrates share only 13.6e37.3% of identity (Table 2). The deduced amino acid sequences of truncated CgMyD88s share 19.8e26.3% identity with their homologs from other species. Genomic arrangement shows that CgMyD88 variants are located in tandem in the same scaffold. In addition, the genomic structure analysis demonstrated that both of them contain three exons and two introns, which is obviously inconsistent with the full-length form of CgMyD88 consisted of six exons and five introns
3
1. H.sapiens 2. M.musculus 3. X.laevis 4. D.rerio 5. B.floridae 6. C.farreri 7. CgMyD88 8. CgMyD88-T1 9. CgMyD88-T2 10. hydra
1
2
96.3 81.1 84.7 71.6 44.4 46.2 45.8 46.3 50.0
88.4 67.9 66.3 81.1 84.7 81.2 71.1 67.0 43.2 43.6 48.2 44.6 46.3 45.9 46.8 45.7 51.6 54.7
3
4
5
6
7
71.1 50.8 26.4 27.3 69.5 50.3 25.5 28.3 64.5 47.4 23.2 26.5 50.5 24.9 26.1 68.0 23.7 25.8 42.8 44.4 37.3 44.6 44.2 61.5 46.8 44.8 47.9 43.8 48.4 45.9 45.5 41.8 50.5 50.5 33.1 35.5
8
9
10
24.2 24.2 23.2 26.3 23.3 26.0 24.8
20.3 19.8 20.5 22.3 21.6 24.4 20.6 71.7
25.0 26.0 26.5 25.0 24.1 17.9 19.1 16.7 13.6
90.8 39.3 38.0
(Fig. 1). The SMART program predicted that both truncated CgMyD88s reserve only one conserved TIR domain. Further alignments of TIR domain showed that three conserved boxes (box 1, box2 and box3) in vertebrate diversified in invertebrate except for bivalve box1 (YDAFVIYN P) (Fig. 2). Phylogenic analysis showed that CgMyD88 variants clustered together and then grouped with other mollusk MyD88, including previously reported complete CgMyd88 (Fig. 3). 3.2. The effect of CgMyD88 variants on activity of Rel/NF-kB To assess the effects of two CgMyD88Ts on NF-kB signaling, the co-transfection assay was performed in the HEK293 cell line. The results showed that both CgMyD88-T1 and CgMyD88-T2 could suppress the NF-kB activation. Compared to transactivation of CgMyD88, CgMyD88-T1 and -2 can suppress its activity down to 12.4% and 16.4% of the original level, respectively. Meanwhile, such inhibitory effects display a dose-dependent manner, with the effects increasing over the transfection dose of expression vector (Fig. 4). 3.3. Tissue distribution of CgMyD88s and response to microbial challenge Tissue distribution demonstrated that both CgMyD88-T1 and CgMyD88-T2 were constitutively expressed in various tissues with high expression in the gill and hemocytes, respectively (Fig. 5). The temporal expression patterns of CgMyD88-T1and CgMyD88-T2 in hemocytes under bacterial challenge were also assessed (Fig. 6). The expression level of CgMyD88-T1 mRNA increased over 8-fold in 6 h and gradually decreased after 12 h of post HKLM challenge, while the peak of CgMyD88-T2 did not occur until 24 h. In contrast, HKVA infection can induce a stronger response, which reached over 60 folds at 6 h post-challenge. 4. Discussion The conserved role of MyD88 in TLR signaling transduction has been confirmed ranging from mammals to mollusks, including human [14], rat [4], Xenopus [15], fish [16], Drosophila [17], Chlamys farreri [18],etc. Unexpectedly, we found two novel truncated forms of Myd88 lacking DD domain, CgMyD88-T1 and CgMyD88-T2. Both CgMyD88Ts contain the conserved TIR domain, which has previously been proved to be required for mediating TLR/MyD88 heterodimerization to activate the followed signaling transduction [19]. Moreover, the comparisonof mRNA sequences and genome showed that CgMyD88 variants were encoded in the genome rather than generated from alternative splicing at mRNA level. Alternative splicing (AS) can produce multiple transcript isoforms from a single
Please cite this article in press as: F. Xu, et al., Expression and function analysis of two naturally truncated MyD88 variants in the Pacific oyster Crassostrea gigas, Fish & Shellfish Immunology (2015), http://dx.doi.org/10.1016/j.fsi.2015.04.034
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
YFSIM3431_proof ■ 13 May 2015 ■ 4/7
4
F. Xu et al. / Fish & Shellfish Immunology xxx (2015) 1e7
Fig. 1. Comparison of gene loci, gene structures and functional domains between complete CgMyD88 and the truncated CgMyD88s. The boxes of different colors in the scaffolds indicate different genes. The red and green boxes indicate the ORF and UTR regions, respectively. TS: Transporter; UN: unknown gene; DEATH: Death Domain; TIR:Toll/IL1receptor domain. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
Fig. 2. Multiple alignment analysis of the TIR domain of the truncated CgMyD88s and other known MyD88 proteins. Box 1, box 2 and box 3 are in red. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
gene thus leading to transcriptome and proteome diversity in an organism [20,21]. However, alternative splicing is not the only mechanism of generating protein diversity. Another way in parallel is duplication of genes followed by substitutions, insertions, deletions, etc [22]. Gene duplication plays a leading role in the generation of novel gene function [23]. Under the driving force of adaptive evolution, vast majority of duplicated genes are deleted or degrade into pseudogenes [24,25]. More rarely, some new copies acquire novel functions and contribute to organism complexity and adaptability [26]. Here, the two copies of CgMyD88Ts surviving strict selection make a difference for oyster. They can skip the complex regulation of AS and be directly transcribed into specific mRNA. For invertebrate it seems wise to encode directly in the genome in case of unnecessary errors in the process of AS [27].
CgMyD88 multialignment and phylogenetic analysis showed that highest identity (71.7%) or relationship was shared between two truncated forms, suggesting that the two new duplicates may originate from one common ancestor. Moreover, genome arrangement demonstrated that gene loci of the two CgMyD88Ts are located in tandem in the same scaffold. Therefore, based on these lines of evidences, it is reasonable to infer that two truncated genes may be originated from one recent gene tandem duplication event of their ancestor. As we expected, CgMyD88-T1 and CgMyD88-T2 tend to perform as negative domains of CgMyD88 on the NF-kB activity in HEK293T cell line. It is worth noting that when a small quantity of truncated CgMyD88s were transfected alone, they tended to lightly active the NF-kB, but once the dose increased, it reversely inhibited the NF-kB
Please cite this article in press as: F. Xu, et al., Expression and function analysis of two naturally truncated MyD88 variants in the Pacific oyster Crassostrea gigas, Fish & Shellfish Immunology (2015), http://dx.doi.org/10.1016/j.fsi.2015.04.034
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
YFSIM3431_proof ■ 13 May 2015 ■ 5/7
F. Xu et al. / Fish & Shellfish Immunology xxx (2015) 1e7
Fig. 3. Phylogenetic tree of 18 MyD88s. The number at each node indicates the percentage of bootstrapping after 1000 replications. The bar (0.1) shows genetic distance, and GenBank accession numbers are as follows: Homo sapiens (NP002459), Mus musculus (NP034981), Gallus gallus (NP001026133), Danio rerio (NP997979), Takifugu rubripes (NP00110666), Branchiostoma belcheri (ABQ32299), Chlamys farreri (ABB76627), CgMyD88(AGY49099), Drosophila melanogaster (NP610479), Anopheles gambiaee (XP314167), Aedes aegypti (XP314167) and Culex quinquefasciatus (XP001868621).
5
activation (the result did not show). The most likely explanation is that the foreign invader, here is the transfected recombinant plasmid, tends to cause an immunologic overreaction at first stage [28], and then the overreaction, as a result, covered up the real function of the CgMyD88 variants. Additionally, when cotransfected with CgMyD88, CgMyD88Ts can dramatically restrain the NF-kB activation which was triggered by CgMyD88. CgMyD88Ts can inhibit endogenous NF-kB activation and competitively suppress the full CgMyD88-dependent NF-kB activation. It was also consistent with deletion mutants of CgMyD88 (CgMyD88-TIR) in our previous study, where CgMyD88-TIR blocked the CgTLR1-triggered activation of NF-kB [6]. Such inhibitions may be caused by dominant negative effect of truncated CgMyD88. Further, we first looked into the structure of Myddosome complex, which is composed of 6 MyD88, 4 IRAK4 and 4 IRAK2 death domain (DD) [29]. CgMyD88 variants can participate in the formation of Myddosome complex through binding with other TIR domaincontaining proteins, such as TLR or Myd88, but can not recruit downstream signaling protein IRAK4 due to its lack of DD domain. As a result, Myddosome cannot form a functional signaling complex, and TLR signaling pathway is blocked therewith. To assess the possible functions of MyD88Ts in oyster immune response, their expression profile has been examined. Both MyD88Ts displayed a constitutive expression in all detected tissues, which is consistent with its homologs in other mollusk, such as C. farreri [30], Ruditapes philippinarum [31]. CgMyD88Ts were expressed at highest level in the gills and hemocytes,
Fig. 4. Effects of CgMyD88-T1and CgMyD88-T2 expressions on the activity of NF-kB reporter gene. (A) CgMyD88-T1inhibited CgMyD88 triggered NF-kB activation. CgMyD88-T1 was transiently co-transfected with 100 ng CgMyD88into HEK293 cells. (B) CgMyD88-T2 inhibited CgMyD88 triggered NF-kB activation. CgMyD88-T2 was transiently co-transfected with 100 ng CgMyD88 into HEK293 cells. Luciferase activities were tested at 48 h post transfection. Significant differences are indicated by different letters (p < 0.05).
Fig. 5. Relative expression levels of (A) CgMyD88-T1 and (B) CgMyD88-T2 in different tissues: hemocytes, heart, gill, mantle, adductor muscle, digestive gland and gonads. Each bar represents the mean of the normalized expression levels of replicates (N ¼ 3).
Please cite this article in press as: F. Xu, et al., Expression and function analysis of two naturally truncated MyD88 variants in the Pacific oyster Crassostrea gigas, Fish & Shellfish Immunology (2015), http://dx.doi.org/10.1016/j.fsi.2015.04.034
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
YFSIM3431_proof ■ 13 May 2015 ■ 6/7
6
F. Xu et al. / Fish & Shellfish Immunology xxx (2015) 1e7
Fig. 6. Expression profiles of CgMyD88 variants mRNA in hemocytes under Listeria monocytogenes (HKLM) or heat-killed Vibrio alginolyticus (HKVA) challenge. (A) Temporal expression pattern of CgMyD88-T1 in hemocytes under challenge with HKLM and HKVA; (B) Temporal expression pattern of CgMyD88-T2 in hemocytes under challenge with HKLM and HKVA. Each bar represents the mean of normalized expression levels of 3 replications. Significant differences were indicated by an asterisk (** represent p < 0.01).
demonstrating that their expression profile has diversified after gene duplication. Moreover, under bacterial infection, CgMyD88-T1 and CgMyD88-T2 showed a complementary expression pattern in hemocytes, in which CgMyD88-T1 mRNA was rapidly up-regulated and peaked at 6 h after bacterial challenge, but CgMyD88-T2was up-regulated until 24 h post-challenge. Thus, these results suggested that both CgMyD88Ts not only participated in the innate immune, but also played distinct role in host defense against bacteria. Inflammatory response is vital and necessary to eliminate invaded pathogens, while excessive cytokine production will be harmful or even fatal to the host itself [32]. Therefore, the host has evolved a negative feedback mechanism to keep immune balance. In human, the splice variant of MyD88 without the ID can behave as a dominant-negative inhibitor of IL-1 and LPS-Induced NF-kB Activation [10]. In oysters, instead of alternative splicing, nature truncated CgMyD88s also can act as negative regulators to inhibit NF-kB activation, displaying complexity of oyster innate immune and diversified immune regulation in different species. In conclusion, we reported a novel mechanism of regulating NFkB activation in the Pacific oyster. Two naturally truncated CgMyD88s without DD domain were identified, which may be originated from one tandem duplication in a ancient gene locus. Over-expression of CgMyD88-T1 or CgMyD88-T2 can suppress either endogenous NF-kB activity or CgMyD88-dependent NF-kB activation. Moreover, both of them could be significantly induced in response to bacterial infection, highlighting their crucial functions in immune balance in oysters.
Acknowledgments This work was supported by the Joint Funds of NSFC-Guangdong of China (U1201215), the National Science Foundation of China (No. 41176150) and Program of the Pearl River Young Talents of Science and Technology in Guangzhou of China (2013J2200095).
Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.fsi.2015.04.034.
References [1] F. Leulier, B. Lemaitre, Toll-like receptorsdtaking an evolutionary approach, Nat Rev Genet 9 (2008) 165e178. [2] P.G. Motshwene, M.C. Moncrieffe, J.G. Grossmann, C. Kao, M. Ayaluru, A.M. Sandercock, et al., An oligomeric signaling platform formed by the Tolllike receptor signal transducers MyD88 and IRAK-4, J Biological Chem 284 (2009) 25404e25411. [3] S. Dimicoli, Y. Wei, C. Bueso-Ramos, H. Yang, C. DiNardo, Y. Jia, et al., Overexpression of the toll-like receptor (TLR) signaling adaptor MYD88, but lack of genetic mutation, in myelodysplastic syndromes, PloS one 8 (2013) e71120. [4] S. Janssens, R. Beyaert, A universal role for MyD88 in TLR/IL-1R-mediated signaling, Trends Biochem Sci 27 (2002) 474e482. [5] K. Burns, F. Martinon, C. Esslinger, H. Pahl, P. Schneider, J.-L. Bodmer, et al., MyD88, an adapter protein involved in interleukin-1 signaling, J Biological Chem 273 (1998) 12203e12209. [6] Y. Zhang, X. He, F. Yu, Z. Xiang, J. Li, K.L. Thorpe, et al., Characteristic and functional analysis of toll-like receptors (TLRs) in the lophotrocozoan, Crassostrea gigas, reveals ancient origin of TLR-mediated innate immunity, PloS one 8 (2013) e76464. [7] N.L. Barbosa-Morais, M. Irimia, Q. Pan, H.Y. Xiong, S. Gueroussov, L.J. Lee, et al., The evolutionary landscape of alternative splicing in vertebrate species, Science 338 (2012) 1587e1593. [8] A. Poltorak, X. He, I. Smirnova, M.Y. Liu, C. Van Huffel, X. Du, et al., Defective LPS signaling in C3H/HeJ and C57BL/10ScCr mice: mutations in Tlr4 gene, Science 282 (1998) 2085e2088. [9] B.S. Willis, C.M. Niswender, T. Su, P.S. Amieux, G.S. McKnight, Cell-type specific expression of a dominant negative PKA mutation in mice, PloS one 6 (2011) e18772. [10] S. Janssens, K. Burns, J. Tschopp, R. Beyaert, Regulation of interleukin-1-and lipopolysaccharide-induced NF-kB activation by alternative splicing of MyD88, Curr Biol 12 (2002) 467e471. [11] J.J. Campanella, L. Bitincka, J. Smalley, MatGAT: an application that generates similarity/identity matrices using protein or DNA sequences, BMC Bioinforma 4 (2003) 29. [12] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using real-time quantitative PCR and the 2 DDCT method, methods 25 (2001) 402e408. [13] Y. Zhang, X. He, Z. Yu, Two homologues of inhibitor of NF-kappa B (IkB) are involved in the immune defense of the Pacific oyster, Crassostrea gigas, Fish shellfish Immunol 30 (2011) 1354e1361. [14] D. Hultmark, Macrophage differentiation marker MyD88 is a member of the Toll/IL-1 receptor family, Biochem biophysical Res Commun 199 (1994) 144e146. [15] C. Prothmann, N.J. Armstrong, R.A. Rupp, The Toll/IL-1 receptor binding protein MyD88 is required for Xenopus axis formation, Mech Dev 97 (2000) 85e92. [16] T. Takano, H. Kondo, I. Hirono, T. Saito-Taki, M. Endo, T. Aoki, Identification and characterization of a myeloid differentiation factor 88 (MyD88) cDNA and gene in Japanese flounder, Paralichthys olivaceus, Dev Comp Immunol 30 (2006) 807e816. [17] T. Horng, R. Medzhitov, Drosophila MyD88 is an adapter in the Toll signaling pathway, Proc Natl Acad Sci U. S. A 98 (2001) 12654e12658. [18] L. Qiu, L. Song, W. Xu, D. Ni, Y. Yu, Molecular cloning and expression of a Toll receptor gene homologue from Zhikong Scallop, Chlamys farreri, Fish shellfish Immunol 22 (2007) 451e466.
Please cite this article in press as: F. Xu, et al., Expression and function analysis of two naturally truncated MyD88 variants in the Pacific oyster Crassostrea gigas, Fish & Shellfish Immunology (2015), http://dx.doi.org/10.1016/j.fsi.2015.04.034
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15
YFSIM3431_proof ■ 13 May 2015 ■ 7/7
F. Xu et al. / Fish & Shellfish Immunology xxx (2015) 1e7 [19] H. Wesche, W.J. Henzel, W. Shillinglaw, S. Li, Z. Cao, MyD88: an adapter that recruits IRAK to the IL-1 receptor complex, Immunity 7 (1997) 837e847. [20] P.M. Harrison, A. Kumar, N. Lang, M. Snyder, M. Gerstein, A question of size: the eukaryotic proteome and the problems in defining it, Nucleic acids Res 30 (2002) 1083e1090. [21] B. Modrek, C. Lee, A genomic view of alternative splicing, Nat Genet 30 (2002) 13e19. [22] F.D. Ciccarelli, C. von Mering, M. Suyama, E.D. Harrington, E. Izaurralde, P. Bork, Complex genomic rearrangements lead to novel primate gene function, Genome Res 15 (2005) 343e351. [23] J. Urbain, Gene duplication and the evolution of proteins, Revue francaise d'etudes cliniques biologiques 14 (1969) 735e740. [24] J.H. Nadeau, D. Sankoff, Comparable rates of gene loss and functional divergence after genome duplications early in vertebrate evolution, Genetics 147 (1997) 1259e1266. [25] W.H. Li, Z. Gu, H. Wang, A. Nekrutenko, Evolutionary analyses of the human genome, Nature 409 (2001) 847e849.
7
[26] J. Yang, R. Lusk, W.H. Li, Organismal complexity, protein complexity, and gene duplicability, Proc Natl Acad Sci U. S. A 100 (2003) 15661e15665. [27] J. Xie, Differential evolution of signal-responsive RNA elements and upstream factors that control alternative splicing. Cellular and molecular life sciences, CMLS 71 (2014) 4347e4360. [28] M. Gleeson, R.L. Clancy, A.W. Cripps, Mucosal immune response in a case of sudden infant death syndrome, Pediatr Res 33 (1993) 554e556. [29] S.-C. Lin, Y.-C. Lo, H. Wu, Helical assembly in the MyD88eIRAK4eIRAK2 complex in TLR/IL-1R signalling, Nature 465 (2010) 885e890. [30] L. Qiu, L. Song, Y. Yu, W. Xu, D. Ni, Q. Zhang, Identification and characterization of a myeloid differentiation factor 88 (MyD88) cDNA from Zhikong scallop Chlamys farreri, Fish shellfish Immunol 23 (2007) 614e623. [31] Y. Lee, I. Whang, N. Umasuthan, M. De Zoysa, C. Oh, D.-H. Kang, et al., Characterization of a novel molluscan MyD88 family protein from manila clam, Ruditapes philippinarum, Fish shellfish Immunol 31 (2011) 887e893. [32] R.L. Danner, R. Elin, J. Hosseini, R. Wesley, J. Reilly, J. Parillo, Endotoxemia in human septic shock, CHEST J 99 (1991) 169e175.
Please cite this article in press as: F. Xu, et al., Expression and function analysis of two naturally truncated MyD88 variants in the Pacific oyster Crassostrea gigas, Fish & Shellfish Immunology (2015), http://dx.doi.org/10.1016/j.fsi.2015.04.034
16 17 18 19 20 21 22 23 24 25 26 27 28 29 30
YFSIM3431_proof ■ 13 May 2015 ■ 1/7
Fish & Shellfish Immunology xxx (2015) 1e7
Contents lists available at ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Short communication
Q2
Expression and function analysis of two naturally truncated MyD88 variants in the Pacific oyster Crassostrea gigas
Q1
Fengjiao Xu a, b, 1, Yang Zhang a, 1, Jun Li a, Yuehuan Zhang a, Zhiming Xiang a, Ziniu Yu a, * a
Key Laboratory of Tropical Marine Bio-resources and Ecology, South China Sea Institute of Oceanology, Chinese Academy of Sciences, Guangzhou 510301, China b Graduate School of Chinese Academy of Sciences, Beijing 100049, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 16 February 2015 Received in revised form 20 April 2015 Accepted 27 April 2015 Available online xxx
Myeloid differentiation factor 88 (MyD88) is the classic signaling adaptor that mediates Toll/interleukin1 receptor (TIR/IL-1R) dependent activation of nuclear factor-kappa B (NF-kB). In this study, two naturally truncated MyD88 members were identified from the Pacific oyster (Crassostrea gigas), namely CgMyD88T1 and CgMyD88-T2. The full-length cDNA of CgMyD88-T1, CgMyD88-T2 are 976 bp and 1038 bp in length, containing an ORF of 552 bp and 555 bp, respectively. The two ORF encode a putative protein of 183 and 184 amino acids, respectively, with a calculated molecular weight of about 21 and 22 kDa. When compared to complete MyD88 paralogues, we found that both CgMyD88-T1 and CgMyD88-T2 contain only TIR domain but lack DD (Death Domain), which share 90.8% of similarity and 71.7% of identity with each other. Phylogenetic tree demonstrated that CgMyD88-T1 and CgMyD88-T2 clustered together and belonged to mollusk branch. Meanwhile, genomic arrangement analysis displayed that the two truncated MyD88s were distributed in tandem in one scaffold, revealing that they may originate from one truncated MyD88s ancestor recently. Expression profile showed that both of CgMyD88 variants were ubiquitously expressed in all tested tissues with highest expression in the gills and hemocytes, respectively. Both truncated CgMyD88 mRNAs were significantly up-regulated in hemocytes under HKLM (heat-killed Listeria monocytogenes) and HKVA (heat-killed Vibrio alginolyticus) challenge. Moreover, either CgMyD88-T1 or CgMyD88-T2 were able to inhibit MyD88 activated Rel/NF-kB activity in HEK293 cell, demonstrating their negative role in regulating MyD88-mediated immune signaling. © 2015 Elsevier Ltd. All rights reserved.
Keywords: Crassostrea gigas Truncated Myd88 variants Rel/NF-kB TIR domain
1. Introduction In the innate immune system, Toll-like receptors (TLRs) are one of germline-encoded pattern-recognition receptors (PRRs) that could recognize pathogen-associated molecular patterns (PAMPs) to initiate immune response of host [1]. Once bound with PAMPs, the intracellular TIR domain of TLRs would recruit several downstream signaling adaptors through TIR dimerization and activate nuclear factor-kB(NF-kB) consequently [2]. Among these adaptors, MyD88 is one of the curial and conserved signaling proteins that mediates activation of most of all TLRs except forTLR3 [3,4]. In the mammals, the typical Myd88 contains three domains, including the
* Corresponding author. South China Sea Institute of Oceanology, Chinese Academy of Sciences, 164 West Xingang Road, Guangzhou 510301, China. Tel./ fax: þ86 20 8910 2507. E-mail address: [email protected] (Z. Yu). 1 These authors contributed equally to this work.
N-terminal death domain (DD), one short intermediate domain (ID) and the C-terminal TIR domain [5]. Through the DD, MyD88, IRAK4 can be recruited and phosphorylated, leading to the activation of TRAF6-TAK1-NF-kB signaling pathway and induction of various inflammatory cytokines [4]. Similarly, inCrassostrea gigas, MyD88 also is involved in TLR signaling and plays an important role in infection-induced hemocytes activation and increase of cytokines TNF mRNA [6], highlighting the crucial function of Myd88 in the innate immune. In the aspect of post-translation regulation, alternative splicing is one of the basic means to increase the biodiversity of proteins in organisms by which one gene sequence codes for multi-variants of proteins [7,8]. The different variants often display dominant negative effect due to the lack of key domain, such as a dominant negative Protein Kinase A mutation [9]. one splicing variant of Myd88 was found to down-regulate TLR signaling with a deletion of the complete ID [10].
http://dx.doi.org/10.1016/j.fsi.2015.04.034 1050-4648/© 2015 Elsevier Ltd. All rights reserved.
Please cite this article in press as: F. Xu, et al., Expression and function analysis of two naturally truncated MyD88 variants in the Pacific oyster Crassostrea gigas, Fish & Shellfish Immunology (2015), http://dx.doi.org/10.1016/j.fsi.2015.04.034
55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
YFSIM3431_proof ■ 13 May 2015 ■ 2/7
2
F. Xu et al. / Fish & Shellfish Immunology xxx (2015) 1e7
Intriguingly, two MyD88 variant have been found by means of whole genome scanning in the Pacific oyster (http://www.oysterdb. com/), demonstrating two truncated forms due to the lack of DD domains. Significantly, these two variants are encoded by genome naturally rather than originated form alternative splicing. Therefore, our study aim to address the following questions: (1) how the two Myd88 variants originate? (2) What's their possible function in innate immune? Considering the central role of TLR signal pathway in host defense, understanding the novel regulatory mechanism may get new insight into complexity of oyster innate immune system. 2. Material and method 2.1. Gene discovery and cloning of CgMyD88 variants The homologs of MyD88s were found by BLAST the Pacific oyster genome (http://www.oysterdb.com/) as full-length MyD88 (AGY49099) as a query. Based on the predicted gene sequence, the primers (Table 1) were designed to amplify either the full-length cDNA or fragments of these MyD88s. To amplify the full-length CgMyD88 variants, RACE was carried out using the BD SMART RACE cDNA Amplification kit (Clontech, USA). All PCR products were cloned into the pMD19-T vector (TaKaRa, Japan) and sequenced using an ABI 3730 DNA sequencer (Applied Biosystems, USA). 2.2. Bioinformatics analysis of the sequences Alignment of amino acids sequences of Myd88 were performed using MegAlign software. The identity and similarity between these amino acid sequences was calculated using MatGAT2.02 software [11]. A phylogenetic tree was constructed using MEGA 5.1 software package with the neighbor-joining method. The protein domains were analyzed using SMART (http://smart.embl-heidelberg.de/). 2.3. Oysters, tissue collection and bacterial challenge Healthy C. gigas (two-year-old, shell height at 10.00 ± 0.05 cm) were collect from Qingdao, Shandong Province, China. The oyster
were fed twice daily with the marine algae in tanks with circulating seawater at 24 ± 1 C, for two weeks acclimation before experiments. For the tissue distribution analysis, equal amounts of tissues (gill, mantle, adductor muscle, heart, digestive gland, gonads and hemocytes) from three oysters were collected. For the in vivo bacterial challenge, 200 oysters were randomly divided into challenged and control group, respectively. Each treatment contained three samples and each sample included five individuals. Oysters were challenged by injecting with 100 ml of heat-killed Listeria monocytogenes (HKLM) or heat-killed Vibrio alginolyticus (HKVA; suspended in 0.1 M PBS at a concentration of 1 108 cell/ml) into adductor muscle. In the control group, the oysters were injected with equal volume of PBS. Hemolymph from five randomly sampled individuals in each group was harvested and mixed together as one sample at different time points (3, 6, 12, 24 h after challenge). 2.4. RNA isolation and real-time quantitative PCR Total RNA were extracted with TRIzol reagent (Invitrogen, USA) following the manufacturer's instructions. The quality of the RNA samples were assessed via a Biophotometer examined at 260/ 280 nm and an electrophoresis using a 1.0% agarose gel. To perform reverse transcription, total RNAs were firstly treated with DNase I (Invitrogen, CA, USA) to remove genomic DNA. Then, RNA was reverse-transcribed using the Super Script III first-strand cDNA synthesis kit with random primers (Invitrogen, USA). The expression patterns of CgMyD88-T1 and CgMyD88-T2 were determined by quantitative real-time PCR (qPCR) and normalized with reference gene geneglyceraldehyde-3-phosphate dehydrogenase (GAPDH). All primers used in this study are listed in Table 1. The qPCR was performed using a Light-Cycler 480II System (Roche, USA) with a 20 mL volume that contained 10 mL 2 Master Mix, 1 mL each of the forward and reverse primers (10 mM), 1 mL 1:10-diluted cDNA, and 7 mL PCR-grade water. The real-time PCR program was designed as follows: 95 C for 10 s; followed by 45 cycles of 95 C for 15 s, 55 C for 15 s and 72 C for 10 s. Dissociation curve analysis of was performed at the end of each PCR reaction to confirm the specificity of the amplification products. Each reaction was
Table 1 Sequences of designed primers used in this study. Primer
Sequence(5'to 30 )
Comment
CgMyD88-T1F CgMyD88-T1R CgMyD88-T1EcoRIF CgMyD88-T1XhoI R CgMyD88-T2F CgMyD88-T2R CgMyD88-T2EcoRI F CgMyD88-T2XhoI R GAPDH-F GAPDH-R Q CgMyD88-T1F Q CgMyD88-T1R Q CgMyD88-T2F Q CgMyD88-T2R Nested Universal Primer CgMyD88-T1 5'race1 CgMyD88-T1 5'race2 CgMyD88-T1 3'race1 CgMyD88-T1 3'race2 CgMyD88-T2 50 race1 CgMyD88-T2 50 race2 CgMyD88-T2 3'race1 CgMyD88-T2 30 race2
TGGTTTCACTTTAGTTGTTGGAT ACGTAATGCCACTGTTCTAAGA CGGAATTCATGGGTGCATATGACTAC ATCTCGAGTTATGCAACGGATGCTTT GCTTAACATCATTGGAGGTGT GCCTTATGCTACAGTTGCTCT CGGAATTCATGGACAATTTTGAATACGA ATCTCGAGTTATGCTACAGTTGCTCTC CTTTCCGCGTACCAGTTCCA GCTGCTTCGCTTGTCTCCAC ACCTCCCCTCCCTACAACCTCAGACT CCTGGTGACATGGAATGGGCAACT TTCAAAGATTATTCCCGACCAAA TATGCTACAGTTGCTCTCATTCTC AAGCAGTGGTATCAACGCAGAGT TTGTCATCACAATTACAGAAGGCAGAATT GAATAATTTTTCTACTCCGAGCACCTGG CACCAGGTGCTCGGAGTAGAAAAATTAT GAGCTGAGAGTCTTTGTTTGGGACAGG CCTCAGTACCATCAAGTCGAATGGGTAT GGATTCCGCCGAAATTACAACTAAAA CGTTCAAAGATTATTCCCGACCAAAG ACAAACTTTTTCGCCACTGCGTAGAG
ORF pCMV-N Flag vector ORF pCMV-N Flag vector Real Time PCR of GAPDH Real Time PCR of CgMyD88-T1 Real Time PCR of CgMyD88-T2 Race adaptor 5'race 3'race 5'race 3'race
Please cite this article in press as: F. Xu, et al., Expression and function analysis of two naturally truncated MyD88 variants in the Pacific oyster Crassostrea gigas, Fish & Shellfish Immunology (2015), http://dx.doi.org/10.1016/j.fsi.2015.04.034
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
YFSIM3431_proof ■ 13 May 2015 ■ 3/7
F. Xu et al. / Fish & Shellfish Immunology xxx (2015) 1e7
performed in triplicates. The relative expression level of CgMyD88 variants were calculated based on the 2DDCt Method [12].
Table 2 Similarity and identity analysis. The shaded area shows the similarity and nonshaded area shows the identity.
2.5. Plasmid construction, cell culture and transfection To examine the effect of CgMyD88 variants on NF-kB transcriptional activity, eukaryotic expression plasmid of CgMyD88-T1 and CgMyD88-T2 were constructed. Complete ORF of CgMyD88 variants were amplified and inserted respectively into pCMV-NFlag (Invitrogen, USA). The primers for the above expression vectors are listed in Table 1. All the resulting colonies were confirmed by sequencing with ABI 3730 DNA sequencer. The HEK293T cells were cultured in Dulbecco's modified Eagle's medium (DMEM, Gibco) containing 10% fetal bovine serum (FBS, Gibco BRL) and antibiotics (100 mg/L streptomycin and 105 U/L penicillin, Gibco) in a humidified incubator under 5% CO2 at 37 C. Transient transfection was performed using Lipofectamine 2000 (Invitrogen) according to the manufacturer's directions. 24 h prior to transfection, HEK293T cells were seeded on 48-well plates (105 cells/well), and transiently co-transfected with NF-kB reporter vectors (100 ng/well), pRL-TK vectors (20 ng/well) and targeted recombined vectors (100, 200, 300, 400 or 500 ng/well). The NF-kB reporter vector [13] and pCMV-N-Flag- CgMyD88 recombined vector [6] were previously constructed in our laboratory, and the Renilla luciferase pRL-Tk vector (Promega) was used as an internal control. The cells were transfected in serum-free culture medium for 4e6 h. Then, the medium was replaced with complete DMEM. 2.6. Dual-luciferase reporter assay and statistical analysis For the dual-luciferase reporter assays, the cells were lysed at 48 h post-transfection and measured using a luciferase reporter assay system (Promega, USA). Each experiment was performed in triplicate and repeated at least three times at different times and under similar conditions. To eliminate the influence of the differences in transfection efficiency, the relative luciferase values were calculated by normalized the firefly luciferase activity on basis of activity of the Renilla luciferase activity. The experimental results are expressed as fold stimulation changes relative to the empty vector control. All results are shown as the mean ± SD. The significance of data was examined using one-way ANOVA followed by the Tukey multiple comparison tests using the SPSS software package. 3. Result 3.1. cDNA cloning and characterization of CgMyD88-T1and CgMyD88s-2 The full length of CgMyD88-T1 and CgMyD88-T2 (GenBank accession No. KP222301and KP222302) cDNA and predicted amino acid sequences are shown in Fig. 1S. They contain a 552 bp or a 555 bp ORF, encoding 183 or 184 amino acid residues, respectively. SMART analysis showed that both of the CgMyD88 variants only contain a TIR domain, lacking of the typical C-terminal DD domain. Multiple sequence alignments revealed that the TIR domains of vertebrate share 47.4e88.4% of identity, and that of invertebrates share only 13.6e37.3% of identity (Table 2). The deduced amino acid sequences of truncated CgMyD88s share 19.8e26.3% identity with their homologs from other species. Genomic arrangement shows that CgMyD88 variants are located in tandem in the same scaffold. In addition, the genomic structure analysis demonstrated that both of them contain three exons and two introns, which is obviously inconsistent with the full-length form of CgMyD88 consisted of six exons and five introns
3
1. H.sapiens 2. M.musculus 3. X.laevis 4. D.rerio 5. B.floridae 6. C.farreri 7. CgMyD88 8. CgMyD88-T1 9. CgMyD88-T2 10. hydra
1
2
96.3 81.1 84.7 71.6 44.4 46.2 45.8 46.3 50.0
88.4 67.9 66.3 81.1 84.7 81.2 71.1 67.0 43.2 43.6 48.2 44.6 46.3 45.9 46.8 45.7 51.6 54.7
3
4
5
6
7
71.1 50.8 26.4 27.3 69.5 50.3 25.5 28.3 64.5 47.4 23.2 26.5 50.5 24.9 26.1 68.0 23.7 25.8 42.8 44.4 37.3 44.6 44.2 61.5 46.8 44.8 47.9 43.8 48.4 45.9 45.5 41.8 50.5 50.5 33.1 35.5
8
9
10
24.2 24.2 23.2 26.3 23.3 26.0 24.8
20.3 19.8 20.5 22.3 21.6 24.4 20.6 71.7
25.0 26.0 26.5 25.0 24.1 17.9 19.1 16.7 13.6
90.8 39.3 38.0
(Fig. 1). The SMART program predicted that both truncated CgMyD88s reserve only one conserved TIR domain. Further alignments of TIR domain showed that three conserved boxes (box 1, box2 and box3) in vertebrate diversified in invertebrate except for bivalve box1 (YDAFVIYN P) (Fig. 2). Phylogenic analysis showed that CgMyD88 variants clustered together and then grouped with other mollusk MyD88, including previously reported complete CgMyd88 (Fig. 3). 3.2. The effect of CgMyD88 variants on activity of Rel/NF-kB To assess the effects of two CgMyD88Ts on NF-kB signaling, the co-transfection assay was performed in the HEK293 cell line. The results showed that both CgMyD88-T1 and CgMyD88-T2 could suppress the NF-kB activation. Compared to transactivation of CgMyD88, CgMyD88-T1 and -2 can suppress its activity down to 12.4% and 16.4% of the original level, respectively. Meanwhile, such inhibitory effects display a dose-dependent manner, with the effects increasing over the transfection dose of expression vector (Fig. 4). 3.3. Tissue distribution of CgMyD88s and response to microbial challenge Tissue distribution demonstrated that both CgMyD88-T1 and CgMyD88-T2 were constitutively expressed in various tissues with high expression in the gill and hemocytes, respectively (Fig. 5). The temporal expression patterns of CgMyD88-T1and CgMyD88-T2 in hemocytes under bacterial challenge were also assessed (Fig. 6). The expression level of CgMyD88-T1 mRNA increased over 8-fold in 6 h and gradually decreased after 12 h of post HKLM challenge, while the peak of CgMyD88-T2 did not occur until 24 h. In contrast, HKVA infection can induce a stronger response, which reached over 60 folds at 6 h post-challenge. 4. Discussion The conserved role of MyD88 in TLR signaling transduction has been confirmed ranging from mammals to mollusks, including human [14], rat [4], Xenopus [15], fish [16], Drosophila [17], Chlamys farreri [18],etc. Unexpectedly, we found two novel truncated forms of Myd88 lacking DD domain, CgMyD88-T1 and CgMyD88-T2. Both CgMyD88Ts contain the conserved TIR domain, which has previously been proved to be required for mediating TLR/MyD88 heterodimerization to activate the followed signaling transduction [19]. Moreover, the comparisonof mRNA sequences and genome showed that CgMyD88 variants were encoded in the genome rather than generated from alternative splicing at mRNA level. Alternative splicing (AS) can produce multiple transcript isoforms from a single
Please cite this article in press as: F. Xu, et al., Expression and function analysis of two naturally truncated MyD88 variants in the Pacific oyster Crassostrea gigas, Fish & Shellfish Immunology (2015), http://dx.doi.org/10.1016/j.fsi.2015.04.034
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
YFSIM3431_proof ■ 13 May 2015 ■ 4/7
4
F. Xu et al. / Fish & Shellfish Immunology xxx (2015) 1e7
Fig. 1. Comparison of gene loci, gene structures and functional domains between complete CgMyD88 and the truncated CgMyD88s. The boxes of different colors in the scaffolds indicate different genes. The red and green boxes indicate the ORF and UTR regions, respectively. TS: Transporter; UN: unknown gene; DEATH: Death Domain; TIR:Toll/IL1receptor domain. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
Fig. 2. Multiple alignment analysis of the TIR domain of the truncated CgMyD88s and other known MyD88 proteins. Box 1, box 2 and box 3 are in red. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
gene thus leading to transcriptome and proteome diversity in an organism [20,21]. However, alternative splicing is not the only mechanism of generating protein diversity. Another way in parallel is duplication of genes followed by substitutions, insertions, deletions, etc [22]. Gene duplication plays a leading role in the generation of novel gene function [23]. Under the driving force of adaptive evolution, vast majority of duplicated genes are deleted or degrade into pseudogenes [24,25]. More rarely, some new copies acquire novel functions and contribute to organism complexity and adaptability [26]. Here, the two copies of CgMyD88Ts surviving strict selection make a difference for oyster. They can skip the complex regulation of AS and be directly transcribed into specific mRNA. For invertebrate it seems wise to encode directly in the genome in case of unnecessary errors in the process of AS [27].
CgMyD88 multialignment and phylogenetic analysis showed that highest identity (71.7%) or relationship was shared between two truncated forms, suggesting that the two new duplicates may originate from one common ancestor. Moreover, genome arrangement demonstrated that gene loci of the two CgMyD88Ts are located in tandem in the same scaffold. Therefore, based on these lines of evidences, it is reasonable to infer that two truncated genes may be originated from one recent gene tandem duplication event of their ancestor. As we expected, CgMyD88-T1 and CgMyD88-T2 tend to perform as negative domains of CgMyD88 on the NF-kB activity in HEK293T cell line. It is worth noting that when a small quantity of truncated CgMyD88s were transfected alone, they tended to lightly active the NF-kB, but once the dose increased, it reversely inhibited the NF-kB
Please cite this article in press as: F. Xu, et al., Expression and function analysis of two naturally truncated MyD88 variants in the Pacific oyster Crassostrea gigas, Fish & Shellfish Immunology (2015), http://dx.doi.org/10.1016/j.fsi.2015.04.034
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
YFSIM3431_proof ■ 13 May 2015 ■ 5/7
F. Xu et al. / Fish & Shellfish Immunology xxx (2015) 1e7
Fig. 3. Phylogenetic tree of 18 MyD88s. The number at each node indicates the percentage of bootstrapping after 1000 replications. The bar (0.1) shows genetic distance, and GenBank accession numbers are as follows: Homo sapiens (NP002459), Mus musculus (NP034981), Gallus gallus (NP001026133), Danio rerio (NP997979), Takifugu rubripes (NP00110666), Branchiostoma belcheri (ABQ32299), Chlamys farreri (ABB76627), CgMyD88(AGY49099), Drosophila melanogaster (NP610479), Anopheles gambiaee (XP314167), Aedes aegypti (XP314167) and Culex quinquefasciatus (XP001868621).
5
activation (the result did not show). The most likely explanation is that the foreign invader, here is the transfected recombinant plasmid, tends to cause an immunologic overreaction at first stage [28], and then the overreaction, as a result, covered up the real function of the CgMyD88 variants. Additionally, when cotransfected with CgMyD88, CgMyD88Ts can dramatically restrain the NF-kB activation which was triggered by CgMyD88. CgMyD88Ts can inhibit endogenous NF-kB activation and competitively suppress the full CgMyD88-dependent NF-kB activation. It was also consistent with deletion mutants of CgMyD88 (CgMyD88-TIR) in our previous study, where CgMyD88-TIR blocked the CgTLR1-triggered activation of NF-kB [6]. Such inhibitions may be caused by dominant negative effect of truncated CgMyD88. Further, we first looked into the structure of Myddosome complex, which is composed of 6 MyD88, 4 IRAK4 and 4 IRAK2 death domain (DD) [29]. CgMyD88 variants can participate in the formation of Myddosome complex through binding with other TIR domaincontaining proteins, such as TLR or Myd88, but can not recruit downstream signaling protein IRAK4 due to its lack of DD domain. As a result, Myddosome cannot form a functional signaling complex, and TLR signaling pathway is blocked therewith. To assess the possible functions of MyD88Ts in oyster immune response, their expression profile has been examined. Both MyD88Ts displayed a constitutive expression in all detected tissues, which is consistent with its homologs in other mollusk, such as C. farreri [30], Ruditapes philippinarum [31]. CgMyD88Ts were expressed at highest level in the gills and hemocytes,
Fig. 4. Effects of CgMyD88-T1and CgMyD88-T2 expressions on the activity of NF-kB reporter gene. (A) CgMyD88-T1inhibited CgMyD88 triggered NF-kB activation. CgMyD88-T1 was transiently co-transfected with 100 ng CgMyD88into HEK293 cells. (B) CgMyD88-T2 inhibited CgMyD88 triggered NF-kB activation. CgMyD88-T2 was transiently co-transfected with 100 ng CgMyD88 into HEK293 cells. Luciferase activities were tested at 48 h post transfection. Significant differences are indicated by different letters (p < 0.05).
Fig. 5. Relative expression levels of (A) CgMyD88-T1 and (B) CgMyD88-T2 in different tissues: hemocytes, heart, gill, mantle, adductor muscle, digestive gland and gonads. Each bar represents the mean of the normalized expression levels of replicates (N ¼ 3).
Please cite this article in press as: F. Xu, et al., Expression and function analysis of two naturally truncated MyD88 variants in the Pacific oyster Crassostrea gigas, Fish & Shellfish Immunology (2015), http://dx.doi.org/10.1016/j.fsi.2015.04.034
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
YFSIM3431_proof ■ 13 May 2015 ■ 6/7
6
F. Xu et al. / Fish & Shellfish Immunology xxx (2015) 1e7
Fig. 6. Expression profiles of CgMyD88 variants mRNA in hemocytes under Listeria monocytogenes (HKLM) or heat-killed Vibrio alginolyticus (HKVA) challenge. (A) Temporal expression pattern of CgMyD88-T1 in hemocytes under challenge with HKLM and HKVA; (B) Temporal expression pattern of CgMyD88-T2 in hemocytes under challenge with HKLM and HKVA. Each bar represents the mean of normalized expression levels of 3 replications. Significant differences were indicated by an asterisk (** represent p < 0.01).
demonstrating that their expression profile has diversified after gene duplication. Moreover, under bacterial infection, CgMyD88-T1 and CgMyD88-T2 showed a complementary expression pattern in hemocytes, in which CgMyD88-T1 mRNA was rapidly up-regulated and peaked at 6 h after bacterial challenge, but CgMyD88-T2was up-regulated until 24 h post-challenge. Thus, these results suggested that both CgMyD88Ts not only participated in the innate immune, but also played distinct role in host defense against bacteria. Inflammatory response is vital and necessary to eliminate invaded pathogens, while excessive cytokine production will be harmful or even fatal to the host itself [32]. Therefore, the host has evolved a negative feedback mechanism to keep immune balance. In human, the splice variant of MyD88 without the ID can behave as a dominant-negative inhibitor of IL-1 and LPS-Induced NF-kB Activation [10]. In oysters, instead of alternative splicing, nature truncated CgMyD88s also can act as negative regulators to inhibit NF-kB activation, displaying complexity of oyster innate immune and diversified immune regulation in different species. In conclusion, we reported a novel mechanism of regulating NFkB activation in the Pacific oyster. Two naturally truncated CgMyD88s without DD domain were identified, which may be originated from one tandem duplication in a ancient gene locus. Over-expression of CgMyD88-T1 or CgMyD88-T2 can suppress either endogenous NF-kB activity or CgMyD88-dependent NF-kB activation. Moreover, both of them could be significantly induced in response to bacterial infection, highlighting their crucial functions in immune balance in oysters.
Acknowledgments This work was supported by the Joint Funds of NSFC-Guangdong of China (U1201215), the National Science Foundation of China (No. 41176150) and Program of the Pearl River Young Talents of Science and Technology in Guangzhou of China (2013J2200095).
Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.fsi.2015.04.034.
References [1] F. Leulier, B. Lemaitre, Toll-like receptorsdtaking an evolutionary approach, Nat Rev Genet 9 (2008) 165e178. [2] P.G. Motshwene, M.C. Moncrieffe, J.G. Grossmann, C. Kao, M. Ayaluru, A.M. Sandercock, et al., An oligomeric signaling platform formed by the Tolllike receptor signal transducers MyD88 and IRAK-4, J Biological Chem 284 (2009) 25404e25411. [3] S. Dimicoli, Y. Wei, C. Bueso-Ramos, H. Yang, C. DiNardo, Y. Jia, et al., Overexpression of the toll-like receptor (TLR) signaling adaptor MYD88, but lack of genetic mutation, in myelodysplastic syndromes, PloS one 8 (2013) e71120. [4] S. Janssens, R. Beyaert, A universal role for MyD88 in TLR/IL-1R-mediated signaling, Trends Biochem Sci 27 (2002) 474e482. [5] K. Burns, F. Martinon, C. Esslinger, H. Pahl, P. Schneider, J.-L. Bodmer, et al., MyD88, an adapter protein involved in interleukin-1 signaling, J Biological Chem 273 (1998) 12203e12209. [6] Y. Zhang, X. He, F. Yu, Z. Xiang, J. Li, K.L. Thorpe, et al., Characteristic and functional analysis of toll-like receptors (TLRs) in the lophotrocozoan, Crassostrea gigas, reveals ancient origin of TLR-mediated innate immunity, PloS one 8 (2013) e76464. [7] N.L. Barbosa-Morais, M. Irimia, Q. Pan, H.Y. Xiong, S. Gueroussov, L.J. Lee, et al., The evolutionary landscape of alternative splicing in vertebrate species, Science 338 (2012) 1587e1593. [8] A. Poltorak, X. He, I. Smirnova, M.Y. Liu, C. Van Huffel, X. Du, et al., Defective LPS signaling in C3H/HeJ and C57BL/10ScCr mice: mutations in Tlr4 gene, Science 282 (1998) 2085e2088. [9] B.S. Willis, C.M. Niswender, T. Su, P.S. Amieux, G.S. McKnight, Cell-type specific expression of a dominant negative PKA mutation in mice, PloS one 6 (2011) e18772. [10] S. Janssens, K. Burns, J. Tschopp, R. Beyaert, Regulation of interleukin-1-and lipopolysaccharide-induced NF-kB activation by alternative splicing of MyD88, Curr Biol 12 (2002) 467e471. [11] J.J. Campanella, L. Bitincka, J. Smalley, MatGAT: an application that generates similarity/identity matrices using protein or DNA sequences, BMC Bioinforma 4 (2003) 29. [12] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using real-time quantitative PCR and the 2 DDCT method, methods 25 (2001) 402e408. [13] Y. Zhang, X. He, Z. Yu, Two homologues of inhibitor of NF-kappa B (IkB) are involved in the immune defense of the Pacific oyster, Crassostrea gigas, Fish shellfish Immunol 30 (2011) 1354e1361. [14] D. Hultmark, Macrophage differentiation marker MyD88 is a member of the Toll/IL-1 receptor family, Biochem biophysical Res Commun 199 (1994) 144e146. [15] C. Prothmann, N.J. Armstrong, R.A. Rupp, The Toll/IL-1 receptor binding protein MyD88 is required for Xenopus axis formation, Mech Dev 97 (2000) 85e92. [16] T. Takano, H. Kondo, I. Hirono, T. Saito-Taki, M. Endo, T. Aoki, Identification and characterization of a myeloid differentiation factor 88 (MyD88) cDNA and gene in Japanese flounder, Paralichthys olivaceus, Dev Comp Immunol 30 (2006) 807e816. [17] T. Horng, R. Medzhitov, Drosophila MyD88 is an adapter in the Toll signaling pathway, Proc Natl Acad Sci U. S. A 98 (2001) 12654e12658. [18] L. Qiu, L. Song, W. Xu, D. Ni, Y. Yu, Molecular cloning and expression of a Toll receptor gene homologue from Zhikong Scallop, Chlamys farreri, Fish shellfish Immunol 22 (2007) 451e466.
Please cite this article in press as: F. Xu, et al., Expression and function analysis of two naturally truncated MyD88 variants in the Pacific oyster Crassostrea gigas, Fish & Shellfish Immunology (2015), http://dx.doi.org/10.1016/j.fsi.2015.04.034
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15
YFSIM3431_proof ■ 13 May 2015 ■ 7/7
F. Xu et al. / Fish & Shellfish Immunology xxx (2015) 1e7 [19] H. Wesche, W.J. Henzel, W. Shillinglaw, S. Li, Z. Cao, MyD88: an adapter that recruits IRAK to the IL-1 receptor complex, Immunity 7 (1997) 837e847. [20] P.M. Harrison, A. Kumar, N. Lang, M. Snyder, M. Gerstein, A question of size: the eukaryotic proteome and the problems in defining it, Nucleic acids Res 30 (2002) 1083e1090. [21] B. Modrek, C. Lee, A genomic view of alternative splicing, Nat Genet 30 (2002) 13e19. [22] F.D. Ciccarelli, C. von Mering, M. Suyama, E.D. Harrington, E. Izaurralde, P. Bork, Complex genomic rearrangements lead to novel primate gene function, Genome Res 15 (2005) 343e351. [23] J. Urbain, Gene duplication and the evolution of proteins, Revue francaise d'etudes cliniques biologiques 14 (1969) 735e740. [24] J.H. Nadeau, D. Sankoff, Comparable rates of gene loss and functional divergence after genome duplications early in vertebrate evolution, Genetics 147 (1997) 1259e1266. [25] W.H. Li, Z. Gu, H. Wang, A. Nekrutenko, Evolutionary analyses of the human genome, Nature 409 (2001) 847e849.
7
[26] J. Yang, R. Lusk, W.H. Li, Organismal complexity, protein complexity, and gene duplicability, Proc Natl Acad Sci U. S. A 100 (2003) 15661e15665. [27] J. Xie, Differential evolution of signal-responsive RNA elements and upstream factors that control alternative splicing. Cellular and molecular life sciences, CMLS 71 (2014) 4347e4360. [28] M. Gleeson, R.L. Clancy, A.W. Cripps, Mucosal immune response in a case of sudden infant death syndrome, Pediatr Res 33 (1993) 554e556. [29] S.-C. Lin, Y.-C. Lo, H. Wu, Helical assembly in the MyD88eIRAK4eIRAK2 complex in TLR/IL-1R signalling, Nature 465 (2010) 885e890. [30] L. Qiu, L. Song, Y. Yu, W. Xu, D. Ni, Q. Zhang, Identification and characterization of a myeloid differentiation factor 88 (MyD88) cDNA from Zhikong scallop Chlamys farreri, Fish shellfish Immunol 23 (2007) 614e623. [31] Y. Lee, I. Whang, N. Umasuthan, M. De Zoysa, C. Oh, D.-H. Kang, et al., Characterization of a novel molluscan MyD88 family protein from manila clam, Ruditapes philippinarum, Fish shellfish Immunol 31 (2011) 887e893. [32] R.L. Danner, R. Elin, J. Hosseini, R. Wesley, J. Reilly, J. Parillo, Endotoxemia in human septic shock, CHEST J 99 (1991) 169e175.
Please cite this article in press as: F. Xu, et al., Expression and function analysis of two naturally truncated MyD88 variants in the Pacific oyster Crassostrea gigas, Fish & Shellfish Immunology (2015), http://dx.doi.org/10.1016/j.fsi.2015.04.034
16 17 18 19 20 21 22 23 24 25 26 27 28 29 30
