Expression and characterization of recombinant GH11 xylanase from thermotolerant Streptomyces sp. SWU10.

Appl Biochem Biotechnol (2014) 172:436–446 DOI 10.1007/s12010-013-0508-4

Expression and Characterization of Recombinant GH11 Xylanase from Thermotolerant Streptomyces sp. SWU10 Wasana Sukhumsirichart & Warin Deesukon & Takuya Kawakami & Shotaro Matsumoto & Weeranuch Seesom & Tatsuji Sakamoto

Received: 24 May 2013 / Accepted: 4 September 2013 / Published online: 3 October 2013 # Springer Science+Business Media New York 2013

Abstract Xylans are major hemicellulose components of plant cell wall which can be hydrolyzed by xylanolytic enzymes. Three forms of endo-β-1,4-xylanases (XynSW1, XynSW2A, and XynSW2B) produced by thermotolerant Streptomyces sp. SWU10 have been reported. In the present study, we described the expression and characterization of the fourth xylanase enzyme from this bacteria, termed XynSW3. The gene containing 726 bp was cloned and expressed in Escherichia coli. The recombinant enzyme (rXynSW3) was purified from cell-free extract to homogeneity using Ni-affinity column chromatography. The apparent molecular mass of rXynSW3 was 48 kDa. Amino acid sequence analysis revealed that it belonged to a xylanase of glycoside hydrolase family 11. The optimum pH and temperature for enzyme activity were 5.5–6.5 and 50 °C, respectively. The enzyme was stable up to 40 °C and in wide pH ranges (pH 0.6–10.3). Xylan without arabinosyl side chain is the most preferable substrate for the enzyme. By using birch wood xylan as substrate, rXynSW3 produced several oligosaccharides in the initial stage of hydrolysis, and their levels increased with time, demonstrating that the enzyme is an endo-acting enzyme. The major products were xylobiose, triose, and tetraose. The rXynSW3 can be applied in several industries such as food, textile, and biofuel industries, and waste treatment. Keywords Expression . Characterization . Xylanase . Glycoside hydrolase family 11 . Streptomyces sp.

W. Sukhumsirichart (*) : W. Deesukon : W. Seesom Department of Biochemistry, Faculty of Medicine, Srinakharinwirot University, 114 Sukhumvit 23, Bangkok 10110, Thailand e-mail: [email protected] T. Kawakami : S. Matsumoto : T. Sakamoto (*) Division of Applied Life Sciences, Graduate School of Life and Environmental Sciences, Osaka Prefecture University, Osaka 599-8531, Japan e-mail: [email protected]

Appl Biochem Biotechnol (2014) 172:436–446

437

Introduction Xylan is a heterogeneous polysaccharide with linear backbone of β-1,4-D-xylopyranoside residues [1] and a major hemicellulose component which comprises up to 39 % of the plant dry weight [2]. Xylans from different sources, such as grasses, cereals, softwood, and hardwood, differ in composition. Birch wood xylan contains 89.3 % xylose, 1 % arabinose, 1.4 % glucose, and 8.3 % anhydrouronic acid [3]. Glucuronoxylans are the main hemicelluloses of hardwoods. The backbone consists of β-1,4-D-xylopyranose units with an α-1,2 linked 4-O-methylglucuronic acid on about every tenth xylose unit [4]. Arabinoglucuronoxylans are the major components of non-woody materials (agricultural crops) and the minor component for softwoods. Softwood xylans consist of β-1,4-xylose unit containing α-L-arabinofuranose residue, attached to about every ninth xylose unit. The hemicellulose portion of cereals has been reported to consist mainly of arabinoxylan [5], whose backbone is made up of 1,4-linked xylose units. Xylan degradation requires various xylanolytic enzymes [5], of which endo-β-1,4xylanases (EC 3.2.1.8) are major enzyme for depolymerization of xylan backbones into short xylooligosaccharide, which are further hydrolyzed by β-xylosidases (EC 3.2.1.37) to xylose. In addition, the biodegradation of xylans requires a set of accessory enzymes including α-L-arabinofuranosidases, α-D-glucuronidases, and acetyl xylan esterases [5, 6]. So far, endo-xylanases produced by a number of bacteria and fungi are mostly extracellular. Although endo-xylanases are classified into glycoside hydrolase (GH) families 5, 8, 10, 11, 30, and 43 based on amino acid sequence similarities, most of them belong to GH10 and GH11 (http://www.cazy.org/Glycoside-Hydrolases.html). These two families have different molecular structures, molecular weights, and catalytic properties. GH10 xylanases generally consist of higher molecular weight proteins (>30 kDa) with a (β/α)8 barrel structure, whereas GH11 consists of lower molecular weight proteins (20–30 kDa) with a β-jelly-roll structure. The GH10 xylanases generate predominantly xylose, xylobiose, xylotriose, and other oligosaccharide products, whereas GH11 exclusively consist of true endo-β-1,4-xylanases that cleave internal β-1,4-xylosidic bonds; therefore, the oligosaccharide is a major product. Streptomyces, fungus-like bacteria, has been recognized as the dominant xylanolytic species of actinomyces that produce enzymes involved in hemicellulose degradation, which have important industrial applications [7] including biobleaching of wood pulp; treating animal feed to increase digestibility; processing food to increase clarification such as juices and wines [8]; extracting coffee, plant oil, and starches [9]; and converting lignocellulosic biomass to feedstock and biofuel. They are gram-positive and have high GC-content genomes [10]. Thermotolerant Streptomyces sp. SWU10 had been reported to produce multiple xylanase enzymes which belong to GH10 (XynSW2A and XynSW2B) [11] and GH11 (XynSW1) [12]. The XynSW2A showed the highest temperature stability among other Streptomyces spp. In this study, the full-length gene of XynSW3 (xynSW3) was isolated from the Streptomyces sp. SWU10, cloned and expressed in Escherichia coli. The recombinant XynSW3 (rXynSW3) was purified and characterized for its physicochemistry.

Materials and Methods Chemicals and Reagents HisTrap HP (5 ml) was purchased from GE Healthcare UK Ltd. (Little Chalfont, Buckinghamshire, UK). Wheat arabinoxylan (low viscosity) was obtained from Megazyme International

438


Ireland Ltd. (Wicklow, Ireland). Birch wood xylan and oat spelt xylan were from Sigma-Aldrich Co. (St. Louis, MO, USA). La Taq DNA polymerase with GC buffer was purchased from Takara bio Inc. (Shiga, Japan). Restriction endo-nucleases were obtained from New England Biolabs Inc. (Ipswich, MA, USA). BugBuster Mater Mix was purchased from Novagen (Darmstadt, Germany). All other chemicals were from Wako Pure Chemical Industries, Ltd. (Osaka, Japan) unless otherwise stated and were of certified reagent grade. Host Strain, Vectors, and Medium E. coli DH5α, the pGEM-T Easy vector (Promega Co., Madison, WI, USA), and the pCold ProS2 vector (Takara bio, Japan) were used for cloning and expression of the PCR products. E. coli transformants were grown in LB medium consisting of 1 % peptone, 0.5 % yeast extract, and 1 % NaCl (pH 7.0) supplemented with 50 μg/ml of ampicillin. Enzyme Assay Xylanase activity was assayed by measuring the release of reducing groups in a reaction mixture containing 190 μl of 0.1 % birch wood xylan in 20 mM Na-phosphate buffer (pH 6.0) and 10 μl of enzyme sample at 40 °C for 10 min. Reducing sugars were measured by the Somogyi–Nelson method [13]. One unit was defined as the amount of enzyme that forms reducing groups corresponding to 1 μmol of D-xylose in 1 min under the above conditions. All activity measurements were performed at least three times, and data was expressed as mean ± SD. Cloning and Sequencing of the Gene Encoding XynSW3 The partial fragment of xynSW3 gene was amplified from the genomic DNA of Streptomyces sp. SWU10 using the degenerated primers which were designed from conserved amino acid sequences of GH11 xylanase from Streptomyces sp. [14] (S11F: 5′-TACTCSTTCTGGA CSGAC and S11R: 5′-CTGCTCTGRTANCCYTC), which generated a 503-bp DNA fragment. PCR was carried out as follows: 5 min at 94 °C for 1 cycle and followed by 30 cycles of 30 s at 94 °C, 30 s at 55 °C, and 45 s at 72 °C, and a final extension step of 7 min at 72 °C. The PCR product was ligated into the pGEM-T Easy vector and sequenced. Primers for full-length xynSW3 gene (XynSW3F: 5′-ATGCAGCAGGACGGCACACAG and XynSW3R: 5′-TCAACCGCTGACCGTGATGTTC) were designed from the alignment results between the 503-bp partial fragment and other xylanase genes from BLAST search including Streptomyces lividans (GenBank accession no. M64553) and S. coelicolor (GenBank accession no. AL939104). The PCR product (726 bp) was cloned and sequenced. Sequence Analysis The similarity analysis of the nucleotide and deduced amino acid sequence of the xynSW3 gene was carried out using the NCBI (http://blast.ncbi.nlm.nih.gov/Blast.cgi) and the UniProtKB (http://www.uniprot.org/blast/uniprot) blast programs [15]. Multiple alignments of protein sequence were accomplished by using Clustal W program (http://www.ebi.ac.uk/ clustalW). The signal peptide in the deduced amino acid sequence of xynSW3 gene was predicted using SignalP (http://www.cbs.dtu.dk/Sercices/SignalP) [16]. Module sequence analysis of the protein was performed using the Pfam database (http://pfam.sanger.ac.uk/search).


439

Expression of xynSW3 in E. coli and Purification of the Recombinant Enzyme To obtain mature XynSW3, PCR was performed using two primers, pcoldSW3F (5′CAAGAATTCGCCACCACCATCACCACCAAC) and pcoldSW3R (5′-GCTAAGCTTTCA ACCGCTGACCGTGATGTT), and the genomic DNA of Streptomyces sp. SWU10 as the template. EcoRI and HindIII restriction sites (underlined) were added to the primers, respectively. The PCR condition consisted of 5 min at 94 °C, followed by 35 cycles of 30 s at 94 °C, 30 s at 50 °C, and 1 min at 72 °C, and a final extension step of 7 min at 72 °C. The amplified fragment was digested with EcoRI and HindIII, ligated to the restriction enzyme sites of the pCold ProS2 vector, and sequenced. The recombinant plasmid was termed pCold-xynSW3. For production of rXynSW3, 10 % of an overnight culture of the E. coli DH5α transformant containing the pCold-xynSW3 plasmid was inoculated to LB medium (10 ml) containing ampicillin (50 μg/ml) and cultured at 37 °C for 1 h. Then, isopropyl β-thiogalactopyranoside was added to a concentration of 1 mM, and incubation was continued at 15 °C for 4 days. The cells obtained from 50 ml of culture broth were harvested by centrifugation and lyzed in BugBuster Mater Mix (2.5 ml). After centrifugation, the cell-free extract was diluted with MilliQ (10 ml) and loaded onto a HisTrap HP equilibrated with a buffer consisting of 20 mM Na-phosphate buffer (pH 8.0), 500 mM NaCl, and 20 mM imidazole. The bound proteins were eluted by a linear gradient of imidazole (70 ml, from 0 to 250 mM) in the same buffer. Influence of Temperature and pH on rXynSW3 To determine the optimum temperature, the enzyme reaction was performed at various temperatures in 20 mM Na-phosphate buffer (pH 6.0) for 10 min. The temperature stability was evaluated by measuring the residual activity after 1 h pre-incubation of the enzyme (15 mU) at temperatures between 4 and 70 °C in 20 mM Na-phosphate buffer (pH 6.0) containing 50 μg/ml of bovine serum albumin. The optimum pH was determined by measuring the activity at 40 °C for 10 min over the pH range 4.3 to 7.6 using Na-acetate buffer (pH 4.3 and 5.1) and Na-phosphate buffer (pH 5.5 to 7.6). The pH stability was studied by pre-incubation of the enzyme (15 mU) at 4 °C for 16 h at various pHs in 1 M HCl (pH 0.3), 0.5 M HCl (pH 0.6), 100 mM Na-acetate HCl buffer (pH 1.2 and 1.5), 100 mM glycine-HCl buffer (pH 2.4 and 3.6), 100 mM Naacetate buffer (pH 4.2 and 4.9), Na-phosphate buffer (pH 6.0 and 6.7), 100 mM glycineNaOH buffer (pH 7.5 to 9.5), and 100 mM CAPS-NaOH buffer (pH 10.3 and 10.9). The remaining activity was expressed as a percent of the activity of the enzyme solution kept in 100 mM Na-phosphate buffer (pH 6.0) at 4 °C for 16 h. Substrate Specificity of rXynSW3 Towards Polysaccharides Substrate specificity towards polysaccharides was tested by incubating 3 mU of the enzyme with 200 μl of 0.1 % substrates in Na-phosphate buffer (pH 6.0) at 40 °C for 30 min. Reducing sugars released into the mixtures were measured by the Somogyi–Nelson method. Analysis of the Enzymatic Products by High-Performance Anion-Exchange Chromatography (HPAEC) Birch wood xylan was hydrolyzed by incubating a reaction mixture containing 600 μl of 0.1 % substrate in 20 mM Na-phosphate buffer (pH 6.0) and rXynSW3 (5 mU) at 40 °C. Aliquots were taken at intervals, and the products were analyzed by HPAEC using a Dionex

440


DXc-500 system (Dionex Corp., Sunnyvale, CA, USA) with a CarboPac PA-1 column (4×250 mm; Dionex) and pulsed amperometric detection. Sugars were eluted at a flow rate of 1 ml/min with 0.1 M NaOH for 5 min followed by a linear gradient from 0 to 0.45 M Naacetate in 0.1 M NaOH for 30 min. Protein Analysis Protein concentration was determined by a Coomassie Plus—The Better Bradford Assay Kit (Pierce Biotechnology Inc., Rockford, IL, USA) with bovine serum albumin as the standard. Protein homogeneity and molecular mass were estimated by SDS-PAGE in a 10 % gel by the method of Laemmli [17]. The proteins were visualized with Coomassie Brilliant Blue R-250 staining. Sugar Analysis Uronic acids were quantified by the method of Blumenkrantz and Asboe-Hansen [18]. Neutral sugar composition of polysaccharides was determined by HPAEC after hydrolysis with 1 M sulfuric acid at 100 °C for 2 h. HPAEC was performed using a CarboPac PA-1 column (2×250 mm) at a flow rate of 0.25 ml/min with 16 mM NaOH for 30 min. Analytes in the effluent were monitored by pulsed amperometric detection.

Results and Discussion Gene Cloning and Nucleotide Sequence In the previous study, we have cloned two xylanase genes, xynSW1 (GenBank accession no. AB638336) and xynSW2 (GenBank accession no. AB601446) from thermotolerant

10 20 30 40 50 60 70 . . . . | . . . . | . . . . | . . . . | . . . . | . . . . | . . . . | . . . . | . . . . | . . . . | . . . . | . . . . | . . . . | . . . . |

xynSW3 [Streptomyces sp. SWU10 xylanase [S. coelicoflavus] xylanase [S. coelicolor A3(2)] xynC [S. lividans] xylanase [S. ghanaensis] xylanase [A. halophila] Clustal Consensus

MQ Q D G T Q Q D WT K Q K R A P L D G V S R R G F . . . . . . . . AR . . . NP . . . N . . . . . . . . . . . . . . . . RI . . SP . . . N .M. . . . . . . . . . . . . . RI . . SP . . . N .M. . . . . . . . . - - - - -Q IQ . NP . . FS . L . . . . . - - - - - - - - - - MS T E D S Y A R S F G . . S . . . : . . . * * . *


DGGG S . . . . . . . . . . . . . . . . . . . . N . . . . : * * * *


D N WG S . . . . . . . . . . . . . . . . . . . . ESY . . : . : * *


A R A G M N MG Q F K Y Y M I M A T E G Y Q S . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . R . . . . . . . . . . . . . . . . . . . . . . R . . . . . . . . . . . . . . . . . . L . . . R . . . . . . . . . . . . . . HD . P L . S . D H . . . L . . . . . . . * * . * : * . * : * * * : * * * * * * *

LGG AG T L A L A T A S G L L L P G T A HA A T T . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . V . . . . . . . . . . . . . . . . . . . . . . . . . V . . G - . . A . . . . . . . S . D . . * * * * * * : * * . * * . * * * * * * * * * *

I . . . . . *

T T N Q T G T D G - MY Y S . . . . . . . . . - . . . . . . . . . . . . . - . . . . . . . . . . . . . - . . . . . . . . . . Y . . - . . . . . Q . . . . . H . GF . . . * * * * * . * : * * *

F WT . . . . . . . . . . . . . . . * * *

80 90 100 110 120 130 140 . . . . | . . . . | . . . . | . . . . | . . . . | . . . . | . . . . | . . . . | . . . . | . . . . | . . . . | . . . . | . . . . | . . . . |

V S MT . . . . . . . . . . . . . . . . . . . . * * * *

L NGGG S . . . . . . . . . . . . . . . . . . . . . . . . . SS . . . * . . * * *

YS . . . . . . . . . . * *

T Q WT N C G N F V A G K G W S T G G R R T V R Y N G Y F N P S G N G Y G C L Y G WT . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . DG - N . . . . . . . . . V . . . . . . . . . . . . R . . . . . . . . . . . . . N . . . . . . . . . T . . . . . . . . . . . . . . . . . . S . . D . . . . . C . . . . . N . . . . N . Y . S . S . . . . . . . . LT . . . . . * * * : * * * * * . * * * * . . * . . * * . * * * * * * * * * * * * *

S . . . . . *

NP . . . . . . . . . . * *

LVEYY . . . . . . . . . . . . . . . . . . . . . . . . . * * * * *

I . . . . . *

V . . . . . *

150 160 170 180 190 200 210 . . . . | . . . . | . . . . | . . . . | . . . . | . . . . | . . . . | . . . . | . . . . | . . . . | . . . . | . . . . | . . . . | . . . . |

Y R P T G - T Y KG T V S S . . . . . - . . . . . . . . . . . . . - . . . . . . . . . . . . . - . . . . . . . . . . . . . - E . R . . . Y . . . . G . D D HR . . . T . * * * * : : * * * *

DGG T Y D I YQ T T R Y N A P . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . K. . . . . . . . . . . . . V . R .M. . D . . * * * * * * : * : * * * : * *

S . . . . . *

V E G T KT . . . . . . . . . . . . . . . . . . . . . . R . . . . . A . * * * * *

F Q Q YWS . . . . . . . . . . . . . . . . . . . D . . . . . P . F . . * * : * *

V RQ S . . . . . . . . . . . . . . . . . . . . * * * *

KV T S G S G T . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . - - P R AG . . . . . * *

I . . . . . *

T T G N H F D AW . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . * * * * * * * * *

220 230 240 . . . . | . . . . | . . . . | . . . . | . . . . | . . . . | . . .

SGS . . . . . . . . . . . . . . . * * *

S . . . . . *

N . . . . . *

I . . . . . *

TVSG . . . . . . . . . . . . . . . . . . . . * * * *

Fig. 1 Alignment of XynSW3 sequence [BAK53483.1] with GH11 xylanase from six actinomyces to demonstrate the homology regions. S. coelicoflavus [WP_007388526.1], S. coelicolor A3(2) [NP_624448.1], S. lividans [P26220.1], S. ghanaensis [WP_004982418.1], and Amycolatopsis halophila [WP_017975297.1]


Table 1 Purification of rXynSW3 from Streptomyces sp. SWU10

Enzyme assay was performed using birch wood xylan as the substrate

441

Purification

Protein Activity Specific Purification Yield activity

Step

(mg)

(U)

(U/mg)

(Fold)

Cell-free extract

28.3

73.0

2.58

1

100

HisTrap HP

2.17

70.8

32.6

12.6

97

(%)

Streptomyces sp. SWU10 [11, 12] which produced three xylanases (XynSW1, XynSW2A, and XynSW2B). The third xylanase gene (xynSW3) of this bacterium was cloned and expressed in this study. A partial gene fragment of xynSW3 (503 bp) was first amplified by PCR using the degenerate primers S11F and S11R, which are specific for GH11 xylanases of Streptomyces spp. The DNA sequence of xynSW3 was submitted to the DDBJ/EMBL/GenBank with accession no. AB649146. The full-length xynSW3 gene consists of 726 bp which encodes for a polypeptide of 241 amino acid residues and contains 65.8 % GC content. The BLAST search demonstrated that the xynSW3 shares the highest identity to the xylanase gene of S. coelicolor (96 %; GenBank accession no. AL939104) [19] and S. lividans (95 %; GenBank accession no. M64553) [20]. Alignment of amino acid sequences of XynSW3 with other GH11 xylanases from 6 actinomyces showed the longest sequence homology at amino acid 202 to 208 (Fig. 1). Analysis by using the SignalP predictions program revealed that the putative XynSW3 protein had an N-terminal signal peptide of 49 amino acids. The XynSW3 without signal peptide sequence has a calculated molecular mass of 20,872 Da. In addition, Pfam analysis of the amino acid sequence of XynSW3 predicted Glyco_hydro_11 (PF00457) domains at positions 58 to 239. These data

Fig. 2 SDS-PAGE gel of proteins from the respective purification steps for rXynSW3. M molecular markers, lane 1 the cell-free extract, lane 2 HisTrap HP. Proteins were visualized by Coomassie Brilliant Blue R-250 staining

442


Fig. 3 Effect of temperature (a) and pH (b) on activity (open circles) and stability (closed circles) of rXynSW3. Experimental conditions are described in the text

confirmed that XynSW3 of Streptomyces sp. SWU10 belongs to GH11, the same as XynSW1, whereas XynSW2A and XynSW2B belong to GH10. Generally, the GH11 and GH10 xylanases have some distinct enzyme activities. Expression of xynSW3 in E. coli The mature xynSW3 gene (without the signal sequence) was amplified by PCR, inserted into the pCold ProS2 vector, and transformed into E. coli. The rXynSW3 expressed from the Table 2 Influence of metals and EDTA on enzyme activity of rXynSW3

Enzyme activity was determined by assaying xylanase activity under standard conditions in the presence of each compound at a concentration of 1 mM. Relative activity was calculated by taking the activity in the absence of metals as 100 %. Enzyme assays were performed in triplicate, and data were expressed as mean ± SD

Compound

Relative activity (%)

None

100

AgNO3

14±0

BaCl2

96±2

CdCl2

94±2

CoCl2

84±1

Cu(CH3COO)2

94±1

FeSO4 FeCl3

87±0 81±4

HgCl2

3±0

KCl

100±1

MnCl2

73±1

NaCl

95±2

NiCl2

86±1

ZnSO4

91±1

EDTA

94±1


443

Table 3 Sugar content of xylans and substrate specificities of rXynSW3 Substrate

Sugar content (mol%)

Relative activity (%)

Arabinose

Xylose

Uronic acid

Birch wood xylan

0

86±1

14±0

100

Oat spelt xylan

10±0

79±2

11±1

92±2

Wheat arabinoxylan

34±1

63±2

3±0

60±4

Soluble fractions of the substrates were used in the enzyme assay. The concentration of the substrates was 0.1 %. Enzyme activity was measured by the Somogyi–Nelson method. Detailed methods used for the enzyme assay are described in the text. All experiments were performed in triplicate, and data were expressed as mean ± SD

constructed plasmid (pCold-xynSW3) in E. coli was designed to be a fusion protein consisting of a 25-kDa segment containing a histidine tag and a ProS2-tag, attached to the N-terminus of XynSW3. The fusion protein was purified from the cell-free extract by Ni-affinity chromatography. This procedure represented a 12.6-fold purification of rXynSW3 with a final yield of 97 % (2.17 mg) and a specific activity of 32.6 U/mg (Table 1). SDS-PAGE analysis of the purified rXynSW3 showed a strong protein band with molecular mass of 48 kDa (Fig. 2). Characteristics of rXynSW3 The rXynSW3 shows the highest activity at 50 °C and pH 5.5–6.5 (Fig. 3). Recombinant xylanase enzymes from other bacteria also have optimal activity around pH 6.0 and 50 °C such as Bacillus subtilis strain B10 [21], Alternaria sp. HB186 [22], and Bacillus pumilus ARA [23]. After incubation of the enzyme at pH 6.0 and 40 °C for 1 h, the initial activity completely remained. More than 80 % of the initial enzyme activity remained after 16 h of incubation at pHs from 0.6 to 10.3 (Fig. 3). Even in the presence of 1 M HCl (pH 0.34), 76 % of the initial activity was remained. We examined the sensitivity of the enzyme to 13 metal ions (Ag+, Ba2+, Cd2+, Co2+, 2+ Cu , Fe2+, Fe3+, Hg2+, K+, Mn2+, Na+, Ni2+, and Zn2+) and metal chelator (EDTA). The enzyme was strongly inhibited by Ag+ and Hg2+ (Table 2). Inactivation of GH11 xylanases by Ag+ and Hg2+ has been reported by other studies [24–26]. In contrast, some GH11 xylanases are not affected by Hg2+ [27, 28]. No effect on activity was detected with the other metals and EDTA. Substrate specificity of the rXynSW3 towards xylans with different degrees of substitution was examined and found that the enzyme degraded birch wood xylan better than oat spelt xylan and wheat arabinoxylan (Table 3). Birch wood xylan contains the lowest residue substitutions among the three substrates, indicating that the enzyme can degrade β-1,4-xylan Table 4 Kinetic parameters of rXynSW3 towards birch wood xylan and wheat arabinoxylan Substrate

Km (mg/ml)

Vmax (mg/min/mg protein)

Birch wood xylan

2.30

0.35

Wheat arabinoxylan

5.56

0.39

The reaction mixture contained 200 μl of substrate with various concentrations in 20 mM Na-phosphate buffer (pH 6.0) and 30 μg of the enzyme and was incubated at 40 °C for 5 min. Enzyme activity was measured by the Somogyi–Nelson method. The data were analyzed by Lineweaver–Burk plots using a least-squares linear regression

444


regions lacking substitutions. With respect to kinetic parameters, rXynSW3 had higher affinity for birch wood xylan than wheat arabinoxylan although Vmax values for the substrates were similar (Table 4). Using birch wood xylan as substrate, the rXynSW3 produced several oligosaccharides in the initial stage of hydrolysis, and their levels increased with time (Fig. 4), demonstrating that the enzyme is an endo-acting enzyme. The final major products were xylobiose, triose, and tetraose. Little xylose was detected in a reaction mixture even when the time of incubation was 16 h. This degradation pattern is normal for GH11 enzymes but not for GH10 enzymes. The three peaks eluted at around 16.5 min might be xylooligosaccharides substituted with uronic acid (glucuronic acid or 4-O-methyl glucuronic acid) considering the sugar composition of birch wood xylan. Generally, the GH11 xylanases preferably cleave in unsubstituted regions of the backbone and require three unsubstituted consecutive xylose residues for hydrolysis; therefore, the GH11 xylanases have low activity on heteroxylans with a high degree of substitution. In contrast, the GH10 xylanases show a higher activity on xylooligosaccharides and produce smaller hydrolysis products from glucuronoxylan and arabinoxylans than the GH11 [29–31]. With the comparison of the four xylanases from thermotolerant Streptomyces sp. SWU 10, it was found that the XynSW2A is the best thermal species (80 °C), whereas XynSW1 and rXynSW3 exhibited the best pH stability (2–11 and 0.6–10.3, respectively). The optimum temperature values were 60 °C (XynSW2A and XynSW2B), 50 °C (rXynSW3), and 40 °C (XynSW1). The pH optima were 5.0 (XynSW1) and 6.0 (XynSW2A, XynSW2B, and rXynSW3). The xylanase from S. lividans also exhibited similar pH and temperature optimum (pH 6.0 and 60 °C). These enzymes prefer substrate without arabinosyl side chain substitution [11, 12]. The multiple xylanase enzymes produced from thermotolerant Streptomyces sp. SWU10 may have a synergistic effect which increases the degradation efficiency of various types of

Fig. 4 HPAEC chromatograms of degradation products of birch wood xylan following incubation with rXynSW3 for the indicated times. Authentic samples Xyl1 to Xyl5 represent xylose to xylopentaose, respectively


445

xylan. Some bacteria had been reported to produce multiple xylanases such as the three genes (xlnA, xlnB, and xlnC) of S. lividans encoding three distinct xylanases [20]. Xylanases have been used for enzymatic production of xylooligosaccharides, which have potential applications in food, animal feed, textile, waste treatment, paper, and biofuel industries [32]. Therefore, XynSW3 is one of the xylanolytic enzymes that have these application potentials.

Conclusion XynSW3 is the fourth endo-β-1,4-xylanase synthesized by thermotolerant Streptomyces sp. SWU10. It is classified as GH11 xylanase. The full-length xynSW3 gene consists of 726 bp encoding a polypeptide of 241 amino acid residues. Recombinant XynSW3 enzyme shows a wide range of pH stability (0.6–10.3). Optimum pH and temperature were 6.0 and 50 °C. The enzyme was stable up to 40 °C when incubated in pH 6.0 for 1 h. This enzyme has potential application in several industries such as food, textile, and biofuel. Acknowledgments This work was supported by grants from the Royal Golden Jubilee Ph.D. Program of Thailand Research Fund (PHD/0257/2549), Srinakharinwirot University (2557), and JSPS/NRCT (ACP program). The authors would like to thank Dr. Alfredo Villarroel for proofreading the article.

References 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20.

Collins, T., Gerday, C., & Feller, G. (2005). FEMS Microbiology Review, 29, 3–23. Wilkie, K. C. B. (1979). Advances in Carbohydrate Chemistry and Biochemistry, 36, 215–264. Kormelink, F. J. M., & Voragen, A. G. J. (1993). Applied Microbiology and Biotechnology, 38, 688–695. Hector, R. E., Qureshi, N., Hughes, S. R., & Cotta, M. A. (2008). Applied Microbiology and Biotechnology, 80, 675–684. Beg, Q. A., Kapoor, M., Mahajan, G., & Hoondal, S. (2001). Applied Microbiology and Biotechnology, 56, 326–338. Kuhad, R. C., & Singh, A. (1993). Critical Reviews in Biotechnology, 13, 151–172. Collins, T., De Vos, D., Hoyoux, A., Savvides, S. N., Gerday, C., Van Beeumen, J., et al. (2005). Journal of Molecular Biology, 354, 425–435. Biely, P. (1985). Trends in Biotechnology, 3, 286–290. Biely, P., Vrsanská, M., & Claeyssens, M. (1991). European Journal of Biochemistry, 200, 157–163. Vrancken, K., Van Mellaert, L., & Anné, J. (2010). Methods in Molecular Biology, 668, 97–107. Deesukon, W., Nishimura, Y., Harada, N., Sakamoto, T., & Sukhumsirichart, W. (2011). Process Biochemistry, 46, 2255–2262. Deesukon, W., Nishimura, Y., Sakamoto, T., & Sukhumsirichart, W. (2013). Molecular Biotechnology, 54, 37–46. Somogyi, M. (1952). Journal of Biological Chemistry, 195, 19–23. Li, N., Yang, P., Wang, Y., Luo, H., Meng, K., Wu, N., et al. (2008). Journal of Microbiology and Biotechnology, 18, 410–416. Altschul, S. F., Madden, T. L., Schaffer, A. A., Zhang, J., Zhang, Z., Miller, W., et al. (1997). Nucleic Acids Research, 25, 3389–3402. Bendtsen, J. D., Nielsen, H., von Heijne, G., & Brunak, S. (2004). Journal of Molecular Biology, 340, 783–795. Laemmli, U. K. (1970). Nature, 227, 680–685. Blumenkrantz, N., & Asboe-Hansen, G. (1973). Analytical Biochemistry, 54, 484–489. Bentley, S. D., Chater, K. F., Cerdeno-Tarraga, A. M., Challis, G. L., Thomson, N. R., James, K. D., et al. (2002). Nature, 417, 141–147. Shareck, F., Roy, C., Yaguchi, M., Morosoli, R., & Kluepfel, D. (1991). Gene, 107, 75–82.

446


21. Huang, J., Wang, G., & Xiao, L. (2006). Bioresource Technology, 97, 802–808. 22. Mao, L., Meng, P., Zhou, C., Ma, L., Zhang, G., & Ma, Y. (2012). World Journal of Microbiology and Biotechnology, 28, 777–784. 23. Qu, W., & Shao, W. (2011). Biotechnology Letters, 33, 1407–1416. 24. Li, N., Shi, P., Yang, P., Wang, Y., Luo, H., Bai, Y., et al. (2009). Applied Biochemistry and Biotechnology, 159, 521–531. 25. Kui, H., Luo, H., Shi, P., Bai, Y., Yuan, T., Wang, Y., et al. (2010). Applied Biochemistry and Biotechnology, 162, 953–965. 26. Liu, W., Shi, P., Chen, Q., Yang, P., Wang, G., Wang, Y., et al. (2010). Applied Biochemistry and Biotechnology, 162, 1–12. 27. Luo, H., Wang, Y., Li, J., Wang, H., Yang, J., Yang, Y., et al. (2009). Enzyme and Microbial Technology, 45, 126–133. 28. Decelle, B., Tsang, A., & Storms, R. K. (2004). Current Genetics, 46, 166–175. 29. Biely, P., Vrsanská, M., Tenkanen, M., & Kluepfel, D. (1997). Journal of Biotechnology, 57, 151–166. 30. Vardakou, M., Katapodis, P., Samiotaki, M., Kekos, D., Panayotou, G., & Christakopoulos, P. (2003). International Journal of Biological Macromolecules, 33, 129–134. 31. Pollet, A. (2010). Ph.D. Thesis, Katholieke Universiteit Leuven, Leuven. 32. Prade, R. A. (1996). Biotechnology and Genetic Engineering Reviews, 13, 101–131.

Xylanase (GH11) from Acremonium cellulolyticus: homologous expression and characterization.

Characterization and sequencing of an active-site cysteine-containing peptide from the xylanase of a thermotolerant Streptomyces.

Recombinant xylanase from Streptomyces coelicolor Ac-738: characterization and the effect on xylan-containing products.

Cloning, expression, and characterization of a novel alkali-tolerant xylanase from alkaliphilic Bacillus sp. SN5.

Purification and characterization of a new xylanase (xylanase B) produced by Streptomyces lividans 66.

Preliminary X-ray diffraction analysis of thermostable β-1,4-xylanase from Streptomyces sp. S9.

Two nucleoside receptors from Streptomyces coelicolor: expression of the genes and characterization of the recombinant proteins.

A novel low molecular weight endo-xylanase from Streptomyces sp. CS628 cultivated in wheat bran.

Isolation and characterization of a thermotolerant ene reductase from Geobacillus sp. 30 and its heterologous expression in Rhodococcus opacus.

Expression and characterization of thermotolerant lipase with broad pH profiles isolated from an Antarctic Pseudomonas sp strain AMS3.

Production and characterization of xylanase from a Streptomyces species grown on agricultural wastes.

Characterization and high expression of recombinant Ustilago maydis xylanase in Pichia pastoris.

Cloning, expression and characterization of a pectate lyase from Paenibacillus sp. 0602 in recombinant Escherichia coli.

Expression and Characterization of a Recombinant Laccase with Alkalistable and Thermostable Properties from Streptomyces griseorubens JSD-1.

Molecular and biochemical characterization of a novel multidomain xylanase from Arthrobacter sp. GN16 isolated from the feces of Grus nigricollis.

Purification and characterization of a secreted recombinant phosphotriesterase (parathion hydrolase) from Streptomyces lividans.

Cloning, expression and characterization of a novel cold-active and halophilic xylanase from Zunongwangia profunda.

Effect of acidic amino acids engineered into the active site cleft of Thermopolyspora flexuosa GH11 xylanase.

Streptomyces burgazadensis sp. nov., isolated from soil.

Streptomyces catbensis sp. nov., isolated from soil.

Streptomyces seymenliensis sp. nov., isolated from soil.

Gene Expression and Molecular Characterization of a Xylanase from Chicken Cecum Metagenome.

Cloning, over-expression and characterization of a thermo-tolerant xylanase from Thermotoga thermarum.

Streptomyces zagrosensis sp. nov., isolated from soil.