Accepted Article
Received Date : 08-Feb-2014 Revised Date
: 25-Apr-2014
Accepted Date : 28-May-2014 Article type
: Original Article
Exogenous Connective Tissue Growth Factor Preserves the Hair Inductive Ability of Human Dermal Papilla Cells
Peipei Zhang, M.D.1,3, Sudheer K. Ravuri, Ph.D.2, Jiping Wang, M.D.3, Kacey G. Marra, Ph.D. 2, Russell E. Kling, B.A.2, and Jiake Chai, M.D.*3 1
Medical School of Chinese People’s Liberation Army, #28 Fuxing Road, Haidian District,
Beijing, China, 100853 2
Department of Plastic Surgery, University of Pittsburgh, 200 Lothrop St, Pittsburgh, PA,
USA, 15261 3
Department of Burns and Plastic Surgery, First Hospital Affiliated to General Hospital of
PLA, #51 Fucheng Road, Haidian District, Beijing, China, 100048
This article has been accepted for publication and undergone full peer review but has not been through the copyediting, typesetting, pagination and proofreading process which may lead to differences between this version and the Version of Record. Please cite this article as an 'Accepted Article', doi: 10.1111/ics.12146 This article is protected by copyright. All rights reserved.
Accepted Article
Phone number
Email
Peipei Zhang
1-412-326-5678
[email protected]
Sudheer K. Ravuri
1-412-383-8939
[email protected]
Jiping Wang
86-010-66848750
[email protected]
Kacey G. Marra
1-412-383-8924
[email protected]
Russell E. Kling
1-914-879-5640
[email protected]
Jiake Chai*
86-010-66867972
[email protected]
Address for correspondence: *Corresponding author: Jia-ke Chai, Department of Burns and Plastic Surgery, First Hospital Affiliated to General Hospital of PLA, Beijing 100048, China, Email:[email protected], phone 86-010-66867972, fax 86-010-68989181
Synopsis
OBJECTIVE: Dermal papilla cells are required for inducing epithelial stem cells during hair morphogenesis and regeneration. Adult human dermal papilla cells lose their hair inductive capacity after several in vitro culture passages. Maintaining the hair-inductive capacity of adult human dermal papilla cells is an obstacle that needs to be overcome in order to realize
This article is protected by copyright. All rights reserved.
Accepted Article
tissue engineered hair follicles. We hypothesized that connective tissue growth factor (CTGF), a fibrogenic factor known to influence Wnt, BMP, and TGF-β could influence key signaling pathways in human dermal papilla cells. The purpose of this study was to determine the effect of exogenous connective tissue growth factor on cultured human dermal papilla cells. METHODS: Adult human dermal papilla cells were isolated and cultured in the presence of CTGF (20ng/ml or 40ng/ml). Human dermal papilla cells positivity was determined using the alkaline phosphatase immunofluorescence. After treatment with CTGF, the proliferation of human dermal papilla cells was assessed. The presence of connective tissue growth factor in human dermal papilla cells was identified by immunofluorescence. The α-smooth muscle actin protein expression was evaluated by western blot. Gene expression profile of Wnt, BMP, TGF-β signaling pathways and alkaline phosphatase, versican activity, were determined using real time RT-PCR.
RESULTS: CTGF reduced proliferation rate of cultured human dermal papilla cells in a dose-dependent manner. Exogenous connective tissue growth factor increased the expression of cytoplasmic connective tissue growth factor, and increased mRNA expression of alkaline phosphatase and β-catenin, BMP2 and TGF-β2 in human dermal papilla cells. Versican mRNA level was suppressed and a small increase in α-smooth muscle actin protein expression was observed.
This article is protected by copyright. All rights reserved.
Accepted Article
CONCLUSION: Exogenous connective tissue growth factor can preserve the innate hair-inductive ability of adult human dermal papilla cells in vitro cultures, which is controlled through the Wnt, BMP and TGF-β signaling pathways.
Key words Connective tissue growth factor (CTGF); human dermal papilla cells (hDPCs); signal pathway; hair follicle reconstruction; tissue engineering
Introduction
It has previously been shown that the interaction between dermal papilla cells and endothelial cells is a key factor in the regeneration of hair follicles [1]. Various preclinical studies have demonstrated the successful regeneration of hair follicles in rodent models [2,3], but to date none have shown regeneration in a human model. Dermal papilla cells derived from embryonic skin can maintain their ability to proliferate over time, but lose their hair-inductive capability with increasing passage number [4,5]. Additionally, there are ethical limitations with the use of embryonic stem cells, particularly when attempting clinical translation. Obtaining and using adult dermal papilla in hair follicle regeneration research is far easier and without ethical consideration. However, the adult cells show a lower proliferative capacity in culture and lose their in situ potency to induce hair follicles in the epidermis. An effective strategy to enhance the hair-inductive ability of adult hDPCs could greatly impact tissue engineered hair follicle research.
This article is protected by copyright. All rights reserved.
Accepted Article
The findings by others suggest methods need to be taken toward successful mitigation of the hDPCs expansion problem [6]. One method is the use of conditioned medium obtained from epidermal keratinocyte culture [7]. In addition, bone morphogenetic protein-6[8] and basic fibroblast growth factor [9] were reported to aid in hDPCs expansion cultures for preserving the hair-inductive capacity. Other strategies to preserve the hair-inductive properties of hDPCs include growing them in three-dimensional aggregates [10,11] and culturing them together with keratinocytes on extracellular matrix substrates[12] in order to mimic the in vivo microenvironment. Our previous study examined the physiological significance of connective tissue growth factor (CTGF, CCN2) on hDPCs in vivo [13]. This work revealed that nude mice transplanted with CTGF-treated hDPCs combined with human hair outer root sheath cells could grow immature hair follicles. While this work was not novel, it did not reveal the relevant signaling pathways involved in CTGF hair regeneration. Wnt signaling pathway is known to be critical for the hair cell differentiation and hair pigmentation [14]. It contributes to the initiation of folliculogenesis and is the first mesenchymal signal involved in the epithelial-mesenchymal interaction of folliculogenesis. The Wnt/β-catenin signaling pathway activation can maintain the dermal papilla cells hair-induction ability for a long time [15]. Wnt-3a-treated DPCs have a higher capacity to induce hair formation in engraftment assays [16]. The BMP/TGF-β signaling pathway also plays an important role in the formation of hair follicles. The presence of BMP2 has been demonstrated to activate the function of subcutaneous fat and hair follicles in response to the external environment and have implications for the evolution of integuments. Furthermore, BMP and Wnt signaling This article is protected by copyright. All rights reserved.
Accepted Article
pathways provide a platform for mutual modulations in the dermis and hair follicle development. The TGF-β signaling pathway is important in the induction of hair follicles to enter the catagen phase [17]. TGF-β2 was one of the genes specifically upregulated in hDPCs[18] and is required for folliculogenesis[19].
To investigate the mechanism of CTGF in induction and formation of immature hair follicles, we studied the changes of several pathways that CTGF could influence the dermal papilla cells in vitro.
Materials and Methods
Ethics Statement and Donor Data
Sample collection was approved by the Ethics Committee of the First Hospital Affiliated to General Hospital of the Chinese People's Liberation Army, and written informed consent was obtained from all donors. Volunteer donors were comprised of 10 males and 12 female aged 31 to 57 years with no history or evidence of genetic disease or malignancy.
Reagents and Antibodies
Collagenase
was obtained from Worthington (Worthington, USA). Dulbecco’s
Modified Eagle’s medium/F12 (DMEM/F12) (1:1) was from ScienCell (ScienCell, USA). 0.25% Trypsin-Ethylene Diamine Tetraacetie Acid (EDTA), Fetal bovine serum (FBS), penicillin/streptomycin, amphotericin B, and Trizol were obtained from Gibco and Invitrogen (Invitrogen, Auckland, USA). Hydrocortisone, MTT, DMSO, RIPA buffer, phenylmethanesulfonyl fluoride (PMSF), anti-rabbit FITC conjugated secondary antibody
This article is protected by copyright. All rights reserved.
Accepted Article
(F9887) and protease and phosphatase inhibitor cocktails were obtained from Sigma (Sigma-Aldrich, USA). Recombinant Human CTGF and epidermal growth factor (EGF) were obtained from Pepro Tech Asia (Israel). Rabbit anti-CTGF antibody (ab6992), rabbit antialkaline phosphatase (ALP) antibody (ab108337), rabbit anti-alpha smooth muscle actin (α-SMA) antibody (ab5694), rabbit anti-beta actin antibody (ab8227) and goat anti-rabbit secondary antibody (ab150080) were obtained from Abcam (Cambridge, UK). Mouse anti-CD133 (abx12050) was obtained from abbexa (Cambridge, UK). BCA kit and SDS sample buffer were from Pierce (Thermo Fisher Scientific, USA). Reverse Transcription System kit was obtained from Promega (Promega, USA). Fast SYBR Green Master Mix from BioSystems (BioSystems, Spain). Insulin-Transferrin-Selenium-G (ITS) Supplement was obtained from Macgene (Macgene, Beijing, China).
Isolation, culture and identification of hDPCs
Excess scalp skin from facelift procedures were collected with IRB approval. Human dermal papillas were isolated by using one-step of enzyme digestion method under microdissection. Briefly, the scalp skin was cut into strips of 0.3 to 0.5cm in width and 0.5 to 1cm in length. The strips were repeatedly rinsed with sterile PBS for 10 times, each of 5 min, and then incubated with 0.25% collagenase Ⅳ at 37°C for 30 min. When the cutaneous fat had been digested and the fibrous sheath just began to be digested, the enzyme digestion was stopped with culture medium containing 20% of FBS. The dermal papilla pellets were dissected out using a dissecting microscope. Isolated dermal papilla pellets were seeded and incubated in DMEM:F12 medium, 20% FBS, penicillin/streptomycin (100U/ml and 100mg/L, respectively), amphotericin B (2.5mg/L), hydrocortisone (0.4mg/L), EGF This article is protected by copyright. All rights reserved.
Accepted Article
(20μg/L), ITS Supplement (5mg/L). Cells were grown at 37°C in a humid atmosphere containing 5%CO2. To identify the isolated hDPCs, immunofluorescence of ALP was performed. 5×104 passage 3 hDPCs per well were cultured in 6well culture plates. The cells were expanded to 80% confluence and fixed with 4% paraformaldehyde buffer for 20min at room temperature. The cells were permeabilized at room temperature for 10min with PBS containing 0.1% TritonX-100, and then incubated with 3%H2O2 for 15min. To prevent nonspecific binding, the cells were blocked with 10% goat serum albumin for 1hour at room temperature and incubated with ALP primary antibody at a dilution of 1:200 at 4°C overnight, followed by incubation of FITC-laveled secondary antibody diluted at 1:160 with 10% goat serum in PBS and incubated for 1h at room temperature in a moist container in dark. After 4 washes with PBS, fluorescence was visualized by fluorescence microscopy.
To estimate the purity of isolated hDPCs, the positive incidence of CD133 was detected by flow cytometry. The cultured passage 3 hDPCs were digested and labeled with a CD133 antibody conjugated to allophycocyanin and sorted on a MoFlo high-speed sorter.
Proliferation assay for hDPCs (MTT)
To determine the proliferative effect of CTGF, passage 6 hDPCs were seeded at a density of 3×103 cells per well in a 96-well plate. The cells were incubated in medium with 0ng/ml, 20ng/ml or 40ng/ml CTGF for 7 days. Every Filtered MTT reagent was added to one sample daily and further incubated for 4h. After the medium was removed, cells in each well were treated with 100μl DMSO, and optical density was measured at 570nm. This article is protected by copyright. All rights reserved.
Accepted Article
Immunofluorescence for CTGF 10×103 passage 6 hDPCs were cultured on coverslips in 24-well culture plates. Cells were treated with 0 ng/mL and 40ng/mL CTGF were regarded as the control group and treated group, respectively. The cells were expanded to 80% confluence and fixed with 4% paraformaldehyde buffer for 20min at room temperature. The cells were permeabilized at room temperature for 10min with PBS containing 0.1% TritonX-100, and then incubated with 3%H2O2 for 15min. To prevent nonspecific binding, the cells were blocked with 10% goat serum albumin for 1hour at room temperature and incubated with CTGF primary antibody at a dilution of 1:200 at 4°C overnight, followed by incubation of FITC-laveled secondary antibody diluted at 1:160 with 10% goat serum in PBS and incubated for 1h at room temperature in a moist container in dark. After 4 washes with PBS, fluorescence was visualized by fluorescence microscopy. Western blot analysis of α-SMA Passage 6 hDPCs with or without 40ng/ml CTGF grown to 80% confluence were washed twice in ice-cold PBS, scraped, and centrifuged at 1000rpm for 10min. Whole cell lysates were prepared by using RIPA buffer (1% Nonidet P-40, 0.5% deoxycholate, 0.1% SDS in PBS, pH 7.4) containing 1 mM phenylmethylsulfonyl fluoride (PMSF) and protease and phosphatase inhibitor cocktails. The pellet was incubated on ice for 20 min. Lysates were microcentrifuged at the maximum speed (16,000×g) for 10 min at 4°C, and the supernatant was removed and used for the whole cell extracts. Protein concentration was measured by using a BCA kit. The normalized amounts of proteins from the cytosolic fraction of hDPCs
This article is protected by copyright. All rights reserved.
Accepted Article
treated with or without CTGF were resolved by sodiumdodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and analyzed by Western blotting using specific antibodies. Briefly, protein samples were resuspended in SDS sample buffer supplemented with 1% (vol/vol) β-mercaptoethanol, boiled for 10min at 95°C, and snap chilled on ice. Samples were loaded on 10% SDS-polyacrylamide gel electrophoresis at 80 volts for 30min and then at 110 volts for 1.5 hours. Proteins were transferred to Hybond ECL nitrocellulose membrane in 25mM Tris and 192mM glycine, pH8.3, followed by blocking with 5% nonfat dry milk in PBST (0.05% Tween 20) for 1h at room temperature. After overnight incubation at 4°C with α-SMA primary antibodies at 1:200 and β-actin at 1:1000, respectively, proteins were detected with horseradish peroxidase-conjugated secondary antibodies. Then, the immunoreactive bands were detected by using enhanced chemiluminescent (ECL) plus reagent kit before exposure for at least 3 min to Kodak film. Real-time Reverse Transcription-PCR for CTGF, β-catenin, BMP2, TGF-β2, ALP and versican After passage 6 hDPCs were seeded at 3×103 cells per cm2 and cultured until sub-confluency (5-7 days), total RNA was extracted from these cells. CTGF, β-catenin, BMP2, TGF-β2, ALP, versican and glyceraldehydes-3-phosphate dehydrogenase (GAPDH) mRNA levels were determined by real-time RT-PCR. mRNA was reverse-transcribed to cDNA using a Reverse Transcription System kit according to the manufacturers’ instructions. cDNA was then used for specific real-time PCR. The primers for CTGF, β-catenin, BMP2, TGF-β2, ALP, versican and GAPDH were synthesized from Sangon Biotech (Shanghai, P.R.C.) (Table І). The PCR reaction was carried out in the presence of Fast SYBR Green This article is protected by copyright. All rights reserved.
Accepted Article
Master Mix (Applied Biosystems). The cycling conditions used were as follows: 95°C for 8min, followed by 40 cycles of 95°C for 12s and 60°C for 50s, and ending with a full extension cycle of 60.0 °C for 10min. Gene copy number was estimated by comparison with a standard curve constructed using CTGF, β-catenin, BMP2, TGF-β2, ALP and versican DNAs and corrected for housekeeping GAPDH copy number. Primers were designed based on published cDNA sequences as following. Reactions were set up in a 96-well spectrofluorometric thermal iCycler, and fluorescence was real-time monitored during every PCR cycle at the annealing step.
Statistical analysis
Data are presented as means±SD. All statistics and graphs were carried out using SPSS 13.0 software. Student’s t-test or one-way ANOVA followed by appropriate Bonferroni corrections were used. A value of p＜0.05 was considered statistically significant.
Results
hDPCs identification
The isolated DP adhered to the flask overnight, migrated in about 48h, and phenotypically resembled sunflowers. The isolated hDPCs were identified as ALP positive cells. Flow cytometry showed that CD133 (+) cells were above 80% (Fig 1).
CTGF reduced cultured hDPCs proliferation in a dose-dependent manner.
During the 7 days of culture, the number of expanded hDPCs was smaller in CTGF-supplemented media (20ng/ml and 40ng/ml) than in the control media. CTGF at This article is protected by copyright. All rights reserved.
Accepted Article
40ng/ml showed higher reduced proliferation effect on hDPCs compared with CTGF at 20ng/ml(p＜0.05).
(Fig 2) .
Exogenous CTGF could increase the expression of endogenous CTGF in the dermal papilla cells
Immunocytochemistry was conducted after treatment with CTGF. After 7 days of culture, it was shown that there was positive staining of CTGF in the endocylema of hDPCs (Fig 3). RT-PCR confirmed that the copy number of CTGF in hDPCs increased after the interaction of CTGF in the hDPCs culture medium (Fig 4).
CTGF can increase the expression of DP cell marker ALP andα-SMA but decrease versican
To investigate the change of hDPCs’ hair-inductive ability after the stimulation of CTGF, western blot for α-SMA and RT-PCR for ALP and versican were used to detect protein and gene expressions. The results showed that after 7 days of stimulation with CTGF the expression of α-SMA protein (Fig 5) and ALP mRNA (Fig 6a) in hDPCs increased (P0.05) (Fig 6b).
CTGF can modulate several pathways activity in hDPCs
To determine whether CTGF can influence the pathways involved in hair growth, RT-PCR was used to determine β-catenin (Wnt pathway), BMP2 (BMP pathway), TGF-β2 (TGF-β pathway) mRNA expression. As evidenced by the results, the expression of mRNA of β-catenin, BMP2 and TGF-β2 in hDPCs treated with CTGF were all increased compared to the cells without CTGF treatment. (P＜0.05) The increase of β-catenin and TGF-β2 was
This article is protected by copyright. All rights reserved.
Accepted Article
greater than the increase in BMP2 expression. This indicates that the Wnt, BMP2 and TGF-β2 pathways were all modulated by CTGF in hDPCs (Fig 7).
Discussion
The mammalian hair follicle is a multi-layered structure and has the ability to self-renewal. The follicle will undergo a cycle of anagen (the active growth phase), catagen (the apoptotic regression phase), and telogen (the resting phase)[20,21]. The cells derived from the mesenchyme, such as dermal papilla and dermal sheath cells, interact with the cells derived from the epithelium, such as epithelial cells of outer and inner root sheaths, matrix and hair shaft, and promote hair growth after birth. It has been reported that dermal papilla cells could secrete diffusible proteins that are essential to the regulation of hair cycling and have follicle-inductive ability through interactions with the surrounded epithelial components [22]. However, successful tissue engineering of hair follicles using hDPCs remains elusive. One explanation could be because hDPCs lose their hair inductive ability after long-term culture. Efficient expansion of hDPCs while maintaining their hair-inductive capacity in culture has been a major challenge and a prerequisite for future tissue engineering hair follicle therapies.
It has been demonstrated that the members of CCN family can regulate differentiation of skeletal mesenchymal cells such as muscle cells[23], chondrocytes[24], and osteoblasts[25] by modulating Wnt[26], BMP[27] and TGF-β[28] signaling pathways. Several reports have indicated that CTGF (CCN2), a member of the CCN family of proteins, the major mitogenic and chemoattractant protein produced by umbilical vein and vascular
This article is protected by copyright. All rights reserved.
Accepted Article
endothelial cells, has a vital role in hair follicle development. It stimulates the proliferation and differentiation of chondrocytes, induces angiogenesis, promotes cell adhesion of fibroblasts, endothelial, and epithelial cells. Lindner et al[29] described in patent application (No.WO2009118283) that CTGF is one of the extracellular matrix proteins and it can contribute to the formation of hair-like microfollicle structures in vitro. Our previous study about physiological significance of CTGF in vivo showed that in the presence of exogenous CTGF, as well as a higher number of hDPCs mixed with human hair follicle out root sheath cells, resulted in the generation of a hair follicle structure in a nude mouse model. This data prompted us to examine whether CTGF induces Wnt, BMP and TGF-β signaling in hDPCs and thus promote hair follicle formation. We first examined the effect of CTGF on the bioactivity of hDPCs. CTGF treated hDPCs showed reduced proliferation in a dose dependent manner; out of which 40ng/ml showed higher reduction in cell proliferation at D4 and D5. This indicates that CTGF may conserve the bioactivity and initial characteristics of the hDPCs. Interestingly, the three markers of hDPCs, alkaline phosphatase (ALP), versican and α-SMA, did not show the consistency of change after the treatment of CTGF. The increase of ALP was obvious whereas versican showed a downward trend. The protein level of α-SMA in CTGF treatment group was higher than that of the control group, but the difference was not significance. ALP has been regarded as a useful marker to indicate the location, shape and size of DP in skin specimens [30-33]. The dermal papilla and lower dermal sheath around the end bulb of a follicle specifically express ALP activity and have the potential capacity to restore hair growth [6]. ALP is expected to activate in anagen but not in catgen and telogen. ALP activity This article is protected by copyright. All rights reserved.
Accepted Article
in the DPs was closely related to proliferation of the hair matrix and hair-inductive activity. It is also important in the epithelial-mesenchymal interaction and is involved in the establishment and maintenance of the hair germ cells for the subsequent hair cycle. The increase of ALP after the treatment of CTGF showed the possibility that CTGF maintained or increased the hair-inductivity of hDPCs. On the other hand, versican and α-SMA were also used as markers for DPCs [10, 15, 34]. During the hair follicle development, versican was not expressed until the hair follicles were beginning to produce fibers. With follicle maturation, versican expression reaches a maximum at the height of the growth phase, after which it diminished at the end of this phase approached [35]. Our results reveal that after the CTGF treatment, the activations of versican reduced although the reduction is not obvious. This may suggest that CTGF maintain the initial condition of hDPCs and keep them in the early stage of anagen. α-SMA correlated with cells originating from terminal hair follicles [36] and undersigns myofibroblastic transition[37]. Jiang et al [38] revealed that CTGF could markedly elevate α-SMA expression in CTGF-treated myofibroblastic phenotype cells. Our results showed that CTGF could increase α-SMA expression in a minor manner. The difference may because of the two different cell types react distinguishingly to CTGF. Taken together, we suppose that CTGF maintain hDPCs in the early stage of anagen keeping with the hair-inductive ability but not hair fiber growth ability. Thus the immature hair follicles that observed in vivo with CTGF treatment can be explained as hDPCs don’t induce hair fiber growth with the interfere with CTGF. CTGF is found at its highest levels in the vascular tissue and the maturing chondrocytes of the embryo [39]. While in adult skin, CTGF is largely absent but is restricted to the dermal This article is protected by copyright. All rights reserved.
Accepted Article
papillae [40]. We observed that exogenous CTGF in culture media could increase the expression of intracellular CTGF in hDPCs, which supports the hypothesis that CTGF exposure may affect Wnt, BMP and TGF-β signaling in the cells. The Wnt pathway contributes to the initiation of folliculogenesis. Activation of the Wnt pathway is thought to be the first mesenchymal signal involved in the epithelial-mesenchymal interaction of folliculogenesis[14]. CTGF can activate Wnt pathway in the course of osteoblast differentiation [41] and epithelial–mesenchymal transition[38]. Our findings suggested CTGF significantly upregulated β-catenin gene expression in hDPCs. This may contribute to the induction of immature hair follicle formation. On the contrary, Liu et al[40] reported that addition of CTGF to cultured keratinocytes resulted in reduced steady state levels of endogenous β-catenin and lost of CTGF resulted in an increase in β-catenin accumulation and β-catenin reporter activity in epithelial cells. The opposite effects of CTGF on epithelial and mesenchymal (hDPCs) cells should be checked further more. TGF-β pathway is a well-known inducer of extracellular matrix components such as collagen and fibronectin. TGF-β2 is involved in promotion of the hair placode and contributes to anagen induction [42]. TGF-β2 is highly expressed in hDPCs compared with human hair follicle cells, and is suggested to mediate the hair-inductive capacity of hDPCs[18]. TGF-β2 also acts as intercellular modulator of growth factor signaling exchange between the hair follicle epithelium and the mesenchyme. CTGF can directly bind TGF-β through its cysteine-rich domain [26]. Our results showed that CTGF could stimulate TGF-β2 gene expression in hDPCs. This indicated the maintenance of hair-inductive ability of hDPCs. It also may enhance the communication between epithelium and mesenchyme and promote the hair
This article is protected by copyright. All rights reserved.
Accepted Article
follicle to enter the anagen process. BMP2 is a multifunctional growth factor, and it was originally defined by its ability to induce ectopic bone and cartilage formation in vivo. In the hair formation process, BMP2 controls not only the differentiation process of hair matrix cells, but also the activity of dermal papilla fibroblasts [43]. CTGF can directly interact with BMP2 and promote CTGF/BMP2-induced proteoglycan synthesis [27]. Our results show that CTGF can increase the gene expression of BMP2 in hDPCs, but the extent is much less than the increase of β-catenin and TGF-β2. So the effect to maintain the hair-inductive ability by β-catenin and TGF-β2 exceeded the effect of hair follicle differentiation by BMP2. The coordinate activity of above growth stimulatory pathways is essential for proper hair fiber formation. In summary, the present work demonstrates that exogenous CTGF could functionally interact with the bioactivity of cultured adult hDPCs. CTGF could reduce the proliferation of hDPCs in a dose-dependent manner and upregulate the expression of ALP. CTGF may conserve the hair-inductive ability of hDPCs via activating Wnt, BMP and TGF-β pathways, thus indicating the relevance of the role in CTGF in hair regeneration.
Acknowledgments
This work was supported by the national science and technology support program special funds of China (2009BAI87B03). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
This article is protected by copyright. All rights reserved.
Accepted Article
Fig 1 hDPCs isolation and identification
(a) isolated DP (20×) (b) cells outgrown from DP after 5 days culture. (20×) (c) human dermal papilla cells positive for alkaline phosphatase (20×)
(d,e) Flow cytometry was used to determine
the proportion of CD133 positive cells from passage 3 hDPCs (d) negative control. (e) is CD133 detection, the positives were 86.66%.
Fig 2 CTGF effects on proliferation of cultured hDPCs. Proliferation of passage 6 hDPCs cultured for 1-7 days in Dulbecco’s modified Eagle’s/F12 medium supplemented with various concentrations of CTGF (20ng/ml, 40ng/ml) or without CTGF. Data is displayed in means ± s.d. of at least three (n = 9) independent experiments of each concentration or time point. One representative blot is presented for each experimental group. One-Way ANOVA, followed by Bonferroni’s multiple comparison test, * p ＜0.05, **p＜0.01 compared to control or comparison between groups as indicated. Bar, ISD.
Fig 3 Immunofluorescence for CTGF. Passage 6 hDPCs cultured for 7 days in Dulbecco’s modified Eagle’s/F12 medium supplemented with 20ng/ml CTGF. hDPCs showed positive expression of CTGF.(20×)
Fig 4 Real-time PCR analysis of CTGF expression in hDPCs and exogenous CTGF treated hDPCs. Gene expression levels of CTGF was examined in passage 6 hDPCs cultured in Dulbecco’s modified Eagle’s medium/F12 medium, supplemented with (40ng/ml) or without CTGF for 7 days. Data shown in the figure was the ratio of respective gene expression to GAPDH mRNA expression. Data presented from at least 2 independent experiments (n = 4), as means ± s.d. Expression level in hDPCs was set as 1.0. Statistical significance determined by Student’s t-test. * p＜0.05 compared to hDPCs as indicated. Bar, ISD.
This article is protected by copyright. All rights reserved.
Accepted Article
Fig 5 Western blot analysis of α-SMA in protein extracted from passage 6 hDPCs treated with (40ng/ml) or without CTGF. (a) The anti-α-SMA showed band at 42KD. β-actin served as a loading control for protein normalization. (b) α-SMA protein level is given as percent of control level. Data is displayed in means ± s.d. of at least three (n = 3) independent experiments. One representative blot is presented for each experimental group. Statistical significance determined by Student’s t-test. * p＜ 0.05 compared to hDPCs as indicated. Bar, ISD.
Fig 6 Real-time PCR analysis of ALP and versican expression in hDPCs and exogenous CTGF treated hDPCs. Gene expressions of ALP and versican were examined in passage hDPCs cultured in Dulbecco’s modified Eagle’s medium/F12 medium, supplemented with (40ng/ml) or without CTGF for 7 days. Data shown in the figure was the ratio of the respective gene expression to GAPDH mRNA expression. Data presented from at least 2 independent experiments (n = 4), as means ± s.d. Expression level in hDPCs was set as 1.0. Statistical significance determined by Student’s t-test. * p＜0.05 compared to hDPCs as indicated. Bar, ISD. (a) Gene expression of ALP. (b) Gene expression of versican.
Fig 7 Real-time PCR analysis of β-catenin, BMP2 and TGF-β expression in hDPCs and exogenous CTGF treated hDPCs. Gene expression of β-catenin, BMP2 and TGF-β was examined in passage 6 hDPCs cultured in Dulbecco’s modified Eagle’s medium/F12 medium, supplemented with (40ng/ml) or without CTGF for 7 days. Data shown in figure was the ratio of the respective gene expression to GAPDH mRNA expression. Data presented from at least 2 independent experiments (n = 4), as means ± s.d. Expression level in hDPCs was set as 1.0. Statistical significance determined by Student’s t-test. * p ＜0.05 compared to hDPCs as indicated. Bar, ISD.
This article is protected by copyright. All rights reserved.
Accepted Article
Reference 1.
Kishimoto J, Ehama R, Wu L, Jiang S, Jiang N, Burgeson RE. Selective activation of the versican promoter by epithelial–mesenchymal interactions during hair follicle development. Proc Natl Acad Sci U S A 1999; 96:7336-7341.
2.
Kamimura J, Lee D, Baden HP, Brissette J, Dotto GP. Primary mouse keratinocyte cultures contain hair follicle progenitor cells with multiple differentiation potential. J Invest Dermatol1997; 109:534-540.
3.
Ferraris C, Bernard BA, Dhouailly D. Adult epidermal keratinocytes are endowed with pilosebaceous forming abilities. Int J Dev Biol 1997; 41:491-498.
4.
Zheng Y, Nace A, Chen W, Watkins K, Sergott L, Homan Y, et al. Mature hair follicles generated from dissociated cells: a universal mechanism of folliculoneogenesis. Dev Dyn 2010; 239:2619-2626.
5.
Zhang S, Hu H, Zhang H, Liu S, Liu S, Zhang Y, et al. Hair follicle stem cells derived from single rat vibrissa via organ culture reconstitute hair follicles in vivo. Cell Transplant 2012; 21:1075-1085.
6.
Aoi N, Inoue K, Chikanishi T, Fujiki R, Yamamoto H, Kato H, et al. 1,25-Dihydroxyvitamin D3 modulates the hair-inductive capacity of dermal papilla cells: therapeutic potential for hair regeneration. Stem Cells Transl Med. 2012;1:615-626.
7.
Inamatsu M, Matsuzaki T, Iwanari H, Yoshizato K. Establishment of rat dermal papilla cell lines that sustain the potency to induce hair folliclesfrom afollicular skin. J Invest Dermatol 1998; 111: 767–775.
8.
Rendl M, Polak L, Fuchs E. BMP signalingin dermal papilla cells is required for their hair follicle-inductive properties. Genes Dev 2008;22:543–557.
This article is protected by copyright. All rights reserved.
Accepted Article
9.
Osada A, Iwabuchi T, Kishimoto J, Hamazaki TS, Okochi H. Long-term culture of mouse vibrissal dermal papilla cells and de novo hair follicle induction.Tissue Eng 2007;13:975–982.
10. Higgins CA, Richardson GD, Ferdinando D, Westgate GE, Jahoda CA. Modelling the hair follicle dermal papilla using spheroid cell cultures. Exp Dermatol 2010;19:546-548. 11. Higgins CA, Chen JC, Cerise JE, Jahoda CA, Christiano AM. Microenvironmental reprogramming by threedimensional culture enables dermal papilla cells to induce de novo human hair-follicle growth. Proc Natl Acad Sci U S A. 2013;110:19679-19688. 12. Havlickova B, Bíró T, Mescalchin A, Tschirschmann M, Mollenkopf H, Bettermann A, et al. A human folliculoid microsphere assay for exploring epithelial-mesenchymal interactions in the human hair follicle. J Invest Dermatol 2009; 129:972–983. 13. Zhang P, Chai J, Wang J, Duan H, Ma L, Zhu G. Functions of exogenous application of connective tissue growth factor in stimulating human dermal papilla cells and human hair follicle outer root sheath cells for reconstructive tissue-engineering hair follicles. Natl Med J China 2013; 93: 1063-1066. 14. Rabbani P, Takeo M, Chou W, Myung P, Bosenberg M, Chin L, et al.Coordinated activation of Wnt in epithelial and melanocyte stem cells initiates pigmented hair regeneration. Cell 2011;145:941-955. 15. Soma T, Fujiwara S, Shirakata Y, Hashimoto K, Kishimoto J. Hair-inductive ability of human dermal papilla cells cultured under Wnt⁄b-catenin signalling activation. Exp Dermatol 2012;21:307-309. 16. Kishimoto J, Burgeson RE, Morgan BA.Wnt signaling maintains the hair-inductive activity of the dermal papilla. Genes Dev 2000;14:1181–1185. 17. Plikus MV, Mayer JA, de la Cruz D, Baker RE, Maini PK, Maxson R, et al. Cyclic dermal BMP signaling regulates stem cell activation during hair regeneration. Nature 2008;451:340-344.
This article is protected by copyright. All rights reserved.
Accepted Article
18. Inoue K, Aoi N, Yamauchi Y, Sato T, Suga H, Eto H, et al. TGFbeta2 is specifically expressed in human dermal papilla cells and modulates hair folliculogenesis. J Cell Mol Med 2009;13:4643– 4656. 19. Foitzik K, Paus R, Doetschman T, Dotto GP. The TGF-2 isoform is both a required and sufficient inducer of murine hair follicle morphogenesis. Dev Biol 1999;212:278 –289. 20. Botchkarev VA, Kishimoto J. Molecular control of epithelial—mesenchymal interactions during hair follicle cycling. J Investig Dermatol Symp Proc 2003;8:46-55. 21. Stenn KS, Paus R. Controls of hair follicle cycling. Physiol Rev 2001; 81: 449-494. 22. Yamao M, Inamatsu M, Ogawa Y, Toki H, Okada T, Toyoshima KE, et al. Contact between dermal papilla cells and dermal sheath cells enhances the ability of DPCs to induce hair growth. J Invest Dermatol 2010; 130: 2707-2718. 23. Calhabeu F, Lafont J, Le Dreau G, Laurent M, Kazazian C, Schaeffer L, et al. NOV/CCN3 imparis muscle cell commitment and differentiation. Exp Cell Res 2006;312: 1876-1889. 24. Lafont J, Jacques C, Le Dreau G, Calhabeu F, Thibout H, Dubois C, et al. New target genes for NOV/CCN3 in chondrocytes: TGF-beta2 and type X collagen. J Bone Miner Res 2005;20: 2213-2223. 25. Smerdel-Ramoya A, Zanotti S, Deregowski V, Canalis E. Connective tissue growth factor enhances osteoblastogenesis in vitro. J Biol Chem 2008; 283: 22690-22699. 26. Luo Q, Kang Q, Si W, Jiang W, Park JK, Peng Y, et al. Connective tissue growth factor (CTGF) is regulated by Wnt and bone morphogenetic proteins signaling in osteoblast differentiation of mesenchymal stem cells. J Biol Chem 2004;279: 55958-55968. 27. Maeda A, Nishida T, Aoyama E, Kubota S, Lyons KM, Kuboki T, et al.CCN family 2/connective tissue growth factor modulates BMP signalling as a signal conductor, which action regulates the proliferation and differentiation of chondrocytes. J Biochem 2009;145: 207-216.
This article is protected by copyright. All rights reserved.
Accepted Article
28. Abreu JG, Ketpura NI, Reversade B, De Robertis EM. Connective-tissue growth factor (CTGF) modulates cell signalling by BMP and TGF-beta. Nat Cell Biol 2002;4: 599-604. 29. Lindner G, Lauster R. Methods for producing de novo papillae and hair microfollicles and their use for in vitro tests and in vivo implantations: European, EP2105499A1 [P/OL]. (2009-9-30) 30. McElwee KJ, Kissling S, Wenzel E, Huth A, Hoffmann R. Cultured peribulbar dermal sheath cells can induce hair follicle development and contribute to the dermal sheath and dermal papilla. J Invest Dermatol 2003;121:1267–1275. 31. Iida M, Ihara S, Matsuzaki T. Hair cycledependent change of alkaline phosphatase activity in the mesenchyme and epithelium in mouse vibrissal follicles. Dev Growth Differ 2007;49:185–195. 32. Paus R, Müller-Röver S, Van Der Veen C, Maurer M, Eichmüller S, Ling G, et al. A comprehensive guide for the recognition and classification of distinct stages of hair follicle morphogenesis. J Invest Dermatol 1999; 113:523-532. 33. Miyake T, Cameron AM, Hall BK. Stage-specific expression patterns of alkaline phosphatase during development of the first arch skeleton in inbred C57BL/6 mouse embryos. J Anat. 1997;190:239-260.. 34. Robinson M, Reynolds AJ, Gharzi A, Jahoda CA.In vivo induction of hair growth by dermal cells isolated from hair follicles after extended organ culture. J Invest Dermatol. 2001;117:596-604. 35. du Cros DL, LeBaron RG, Couchman JR. Association of versican with dermal matrices and its potential role in hair follicle development and cycling. J Invest Dermatol. 1995;105:426-431. 36. Hill RP, Gledhill K, Gardner A, Higgins CA, Crawford H, Lawrence C, et al. Generation and characterization of multipotent stem cells from established dermal cultures. PLoS One. 2012;7:e50742.
This article is protected by copyright. All rights reserved.
Accepted Article
37. Reynolds AJ, Chaponnier C, Jahoda CA, Gabbiani G. A quantitative study of the differential expression of alpha-smooth muscle actin in cell populations of follicular and non-follicular origin. J Invest Dermatol. 1993;101:577-583. 38. Jiang CG, Lv L, Liu FR, Wang ZN, Na D, Li F, et al. Connective tissue growth factor is a positive regulator of epithelial–mesenchymal transition and promotes the adhesion with gastric cancer cells in human peritoneal mesothelial cells. Cytokine 2013;61: 173-180. 39. Ivkovic S, Yoon BS, Popoff SN, Safadi FF, Libuda DE, Stephenson RC, et al. Connective tissue growth factor coordinates chondrogenesis and angiogenesis during skeletal development. Development 2003;130:2779–2791. 40. Liu S, Leask A. CCN2 modulates hair follicle cycling in mice. Mol Biol Cell. 2013;24:3939-3944. 41. Si W, Kang Q, Luu HH, Park JK, Luo Q, Song WX, et al.CCN1/Cyr61 is regulated by the canonical Wnt signal and plays an important role in Wnt3A-induced osteoblast differentiation of mesenchymal stem cells. Mol Cell Biol 2006;26: 2955-2964. 42. Oshimori N, Fuchs E. Paracrine TGF-β signaling counterbalances BMP-mediated repression in hair follicle stem cell activation. Cell Stem Cell 2012;10: 63–75. 43. Millar SE. Molecular mechanisms regulating hair follicle development. J Invest Dermatol2002; 118: 216–225.
This article is protected by copyright. All rights reserved.
Accepted Article
Table І
Primer sequences
Forward
Reverse
CTGF
CTCCACCCGAGTTACCAATG
TGGCGATTTTAGGTGTCCG
β-catenin
GCTATTCCACGACTAGTTCAGC
AGCTCCAGTACACCCTTCTAC
BMP2
CGCAGCTTCCATCACGAA
TGCAGATGTGAGAAACTCGTC
TGF-β
CCTGAGTGGCTGTCTTTTGA
CGTGGAGTTTGTTATCTTTGCTG
ALP
GATGTGGAGTATGAGAGTGACG GGTCAAGGGTCAGGAGTTC
GAPDH
TGAAGGTCGGAGTCAACGG
TGGAAGATGGTGATGGGAT
This article is protected by copyright. All rights reserved.
Accepted Article This article is protected by copyright. All rights reserved.
Accepted Article This article is protected by copyright. All rights reserved.
Accepted Article This article is protected by copyright. All rights reserved.
Accepted Article This article is protected by copyright. All rights reserved.
Accepted Article This article is protected by copyright. All rights reserved.
Accepted Article This article is protected by copyright. All rights reserved.
Received Date : 08-Feb-2014 Revised Date
: 25-Apr-2014
Accepted Date : 28-May-2014 Article type
: Original Article
Exogenous Connective Tissue Growth Factor Preserves the Hair Inductive Ability of Human Dermal Papilla Cells
Peipei Zhang, M.D.1,3, Sudheer K. Ravuri, Ph.D.2, Jiping Wang, M.D.3, Kacey G. Marra, Ph.D. 2, Russell E. Kling, B.A.2, and Jiake Chai, M.D.*3 1
Medical School of Chinese People’s Liberation Army, #28 Fuxing Road, Haidian District,
Beijing, China, 100853 2
Department of Plastic Surgery, University of Pittsburgh, 200 Lothrop St, Pittsburgh, PA,
USA, 15261 3
Department of Burns and Plastic Surgery, First Hospital Affiliated to General Hospital of
PLA, #51 Fucheng Road, Haidian District, Beijing, China, 100048
This article has been accepted for publication and undergone full peer review but has not been through the copyediting, typesetting, pagination and proofreading process which may lead to differences between this version and the Version of Record. Please cite this article as an 'Accepted Article', doi: 10.1111/ics.12146 This article is protected by copyright. All rights reserved.
Accepted Article
Phone number
Peipei Zhang
1-412-326-5678
[email protected]
Sudheer K. Ravuri
1-412-383-8939
[email protected]
Jiping Wang
86-010-66848750
[email protected]
Kacey G. Marra
1-412-383-8924
[email protected]
Russell E. Kling
1-914-879-5640
[email protected]
Jiake Chai*
86-010-66867972
[email protected]
Address for correspondence: *Corresponding author: Jia-ke Chai, Department of Burns and Plastic Surgery, First Hospital Affiliated to General Hospital of PLA, Beijing 100048, China, Email:[email protected], phone 86-010-66867972, fax 86-010-68989181
Synopsis
OBJECTIVE: Dermal papilla cells are required for inducing epithelial stem cells during hair morphogenesis and regeneration. Adult human dermal papilla cells lose their hair inductive capacity after several in vitro culture passages. Maintaining the hair-inductive capacity of adult human dermal papilla cells is an obstacle that needs to be overcome in order to realize
This article is protected by copyright. All rights reserved.
Accepted Article
tissue engineered hair follicles. We hypothesized that connective tissue growth factor (CTGF), a fibrogenic factor known to influence Wnt, BMP, and TGF-β could influence key signaling pathways in human dermal papilla cells. The purpose of this study was to determine the effect of exogenous connective tissue growth factor on cultured human dermal papilla cells. METHODS: Adult human dermal papilla cells were isolated and cultured in the presence of CTGF (20ng/ml or 40ng/ml). Human dermal papilla cells positivity was determined using the alkaline phosphatase immunofluorescence. After treatment with CTGF, the proliferation of human dermal papilla cells was assessed. The presence of connective tissue growth factor in human dermal papilla cells was identified by immunofluorescence. The α-smooth muscle actin protein expression was evaluated by western blot. Gene expression profile of Wnt, BMP, TGF-β signaling pathways and alkaline phosphatase, versican activity, were determined using real time RT-PCR.
RESULTS: CTGF reduced proliferation rate of cultured human dermal papilla cells in a dose-dependent manner. Exogenous connective tissue growth factor increased the expression of cytoplasmic connective tissue growth factor, and increased mRNA expression of alkaline phosphatase and β-catenin, BMP2 and TGF-β2 in human dermal papilla cells. Versican mRNA level was suppressed and a small increase in α-smooth muscle actin protein expression was observed.
This article is protected by copyright. All rights reserved.
Accepted Article
CONCLUSION: Exogenous connective tissue growth factor can preserve the innate hair-inductive ability of adult human dermal papilla cells in vitro cultures, which is controlled through the Wnt, BMP and TGF-β signaling pathways.
Key words Connective tissue growth factor (CTGF); human dermal papilla cells (hDPCs); signal pathway; hair follicle reconstruction; tissue engineering
Introduction
It has previously been shown that the interaction between dermal papilla cells and endothelial cells is a key factor in the regeneration of hair follicles [1]. Various preclinical studies have demonstrated the successful regeneration of hair follicles in rodent models [2,3], but to date none have shown regeneration in a human model. Dermal papilla cells derived from embryonic skin can maintain their ability to proliferate over time, but lose their hair-inductive capability with increasing passage number [4,5]. Additionally, there are ethical limitations with the use of embryonic stem cells, particularly when attempting clinical translation. Obtaining and using adult dermal papilla in hair follicle regeneration research is far easier and without ethical consideration. However, the adult cells show a lower proliferative capacity in culture and lose their in situ potency to induce hair follicles in the epidermis. An effective strategy to enhance the hair-inductive ability of adult hDPCs could greatly impact tissue engineered hair follicle research.
This article is protected by copyright. All rights reserved.
Accepted Article
The findings by others suggest methods need to be taken toward successful mitigation of the hDPCs expansion problem [6]. One method is the use of conditioned medium obtained from epidermal keratinocyte culture [7]. In addition, bone morphogenetic protein-6[8] and basic fibroblast growth factor [9] were reported to aid in hDPCs expansion cultures for preserving the hair-inductive capacity. Other strategies to preserve the hair-inductive properties of hDPCs include growing them in three-dimensional aggregates [10,11] and culturing them together with keratinocytes on extracellular matrix substrates[12] in order to mimic the in vivo microenvironment. Our previous study examined the physiological significance of connective tissue growth factor (CTGF, CCN2) on hDPCs in vivo [13]. This work revealed that nude mice transplanted with CTGF-treated hDPCs combined with human hair outer root sheath cells could grow immature hair follicles. While this work was not novel, it did not reveal the relevant signaling pathways involved in CTGF hair regeneration. Wnt signaling pathway is known to be critical for the hair cell differentiation and hair pigmentation [14]. It contributes to the initiation of folliculogenesis and is the first mesenchymal signal involved in the epithelial-mesenchymal interaction of folliculogenesis. The Wnt/β-catenin signaling pathway activation can maintain the dermal papilla cells hair-induction ability for a long time [15]. Wnt-3a-treated DPCs have a higher capacity to induce hair formation in engraftment assays [16]. The BMP/TGF-β signaling pathway also plays an important role in the formation of hair follicles. The presence of BMP2 has been demonstrated to activate the function of subcutaneous fat and hair follicles in response to the external environment and have implications for the evolution of integuments. Furthermore, BMP and Wnt signaling This article is protected by copyright. All rights reserved.
Accepted Article
pathways provide a platform for mutual modulations in the dermis and hair follicle development. The TGF-β signaling pathway is important in the induction of hair follicles to enter the catagen phase [17]. TGF-β2 was one of the genes specifically upregulated in hDPCs[18] and is required for folliculogenesis[19].
To investigate the mechanism of CTGF in induction and formation of immature hair follicles, we studied the changes of several pathways that CTGF could influence the dermal papilla cells in vitro.
Materials and Methods
Ethics Statement and Donor Data
Sample collection was approved by the Ethics Committee of the First Hospital Affiliated to General Hospital of the Chinese People's Liberation Army, and written informed consent was obtained from all donors. Volunteer donors were comprised of 10 males and 12 female aged 31 to 57 years with no history or evidence of genetic disease or malignancy.
Reagents and Antibodies
Collagenase
was obtained from Worthington (Worthington, USA). Dulbecco’s
Modified Eagle’s medium/F12 (DMEM/F12) (1:1) was from ScienCell (ScienCell, USA). 0.25% Trypsin-Ethylene Diamine Tetraacetie Acid (EDTA), Fetal bovine serum (FBS), penicillin/streptomycin, amphotericin B, and Trizol were obtained from Gibco and Invitrogen (Invitrogen, Auckland, USA). Hydrocortisone, MTT, DMSO, RIPA buffer, phenylmethanesulfonyl fluoride (PMSF), anti-rabbit FITC conjugated secondary antibody
This article is protected by copyright. All rights reserved.
Accepted Article
(F9887) and protease and phosphatase inhibitor cocktails were obtained from Sigma (Sigma-Aldrich, USA). Recombinant Human CTGF and epidermal growth factor (EGF) were obtained from Pepro Tech Asia (Israel). Rabbit anti-CTGF antibody (ab6992), rabbit antialkaline phosphatase (ALP) antibody (ab108337), rabbit anti-alpha smooth muscle actin (α-SMA) antibody (ab5694), rabbit anti-beta actin antibody (ab8227) and goat anti-rabbit secondary antibody (ab150080) were obtained from Abcam (Cambridge, UK). Mouse anti-CD133 (abx12050) was obtained from abbexa (Cambridge, UK). BCA kit and SDS sample buffer were from Pierce (Thermo Fisher Scientific, USA). Reverse Transcription System kit was obtained from Promega (Promega, USA). Fast SYBR Green Master Mix from BioSystems (BioSystems, Spain). Insulin-Transferrin-Selenium-G (ITS) Supplement was obtained from Macgene (Macgene, Beijing, China).
Isolation, culture and identification of hDPCs
Excess scalp skin from facelift procedures were collected with IRB approval. Human dermal papillas were isolated by using one-step of enzyme digestion method under microdissection. Briefly, the scalp skin was cut into strips of 0.3 to 0.5cm in width and 0.5 to 1cm in length. The strips were repeatedly rinsed with sterile PBS for 10 times, each of 5 min, and then incubated with 0.25% collagenase Ⅳ at 37°C for 30 min. When the cutaneous fat had been digested and the fibrous sheath just began to be digested, the enzyme digestion was stopped with culture medium containing 20% of FBS. The dermal papilla pellets were dissected out using a dissecting microscope. Isolated dermal papilla pellets were seeded and incubated in DMEM:F12 medium, 20% FBS, penicillin/streptomycin (100U/ml and 100mg/L, respectively), amphotericin B (2.5mg/L), hydrocortisone (0.4mg/L), EGF This article is protected by copyright. All rights reserved.
Accepted Article
(20μg/L), ITS Supplement (5mg/L). Cells were grown at 37°C in a humid atmosphere containing 5%CO2. To identify the isolated hDPCs, immunofluorescence of ALP was performed. 5×104 passage 3 hDPCs per well were cultured in 6well culture plates. The cells were expanded to 80% confluence and fixed with 4% paraformaldehyde buffer for 20min at room temperature. The cells were permeabilized at room temperature for 10min with PBS containing 0.1% TritonX-100, and then incubated with 3%H2O2 for 15min. To prevent nonspecific binding, the cells were blocked with 10% goat serum albumin for 1hour at room temperature and incubated with ALP primary antibody at a dilution of 1:200 at 4°C overnight, followed by incubation of FITC-laveled secondary antibody diluted at 1:160 with 10% goat serum in PBS and incubated for 1h at room temperature in a moist container in dark. After 4 washes with PBS, fluorescence was visualized by fluorescence microscopy.
To estimate the purity of isolated hDPCs, the positive incidence of CD133 was detected by flow cytometry. The cultured passage 3 hDPCs were digested and labeled with a CD133 antibody conjugated to allophycocyanin and sorted on a MoFlo high-speed sorter.
Proliferation assay for hDPCs (MTT)
To determine the proliferative effect of CTGF, passage 6 hDPCs were seeded at a density of 3×103 cells per well in a 96-well plate. The cells were incubated in medium with 0ng/ml, 20ng/ml or 40ng/ml CTGF for 7 days. Every Filtered MTT reagent was added to one sample daily and further incubated for 4h. After the medium was removed, cells in each well were treated with 100μl DMSO, and optical density was measured at 570nm. This article is protected by copyright. All rights reserved.
Accepted Article
Immunofluorescence for CTGF 10×103 passage 6 hDPCs were cultured on coverslips in 24-well culture plates. Cells were treated with 0 ng/mL and 40ng/mL CTGF were regarded as the control group and treated group, respectively. The cells were expanded to 80% confluence and fixed with 4% paraformaldehyde buffer for 20min at room temperature. The cells were permeabilized at room temperature for 10min with PBS containing 0.1% TritonX-100, and then incubated with 3%H2O2 for 15min. To prevent nonspecific binding, the cells were blocked with 10% goat serum albumin for 1hour at room temperature and incubated with CTGF primary antibody at a dilution of 1:200 at 4°C overnight, followed by incubation of FITC-laveled secondary antibody diluted at 1:160 with 10% goat serum in PBS and incubated for 1h at room temperature in a moist container in dark. After 4 washes with PBS, fluorescence was visualized by fluorescence microscopy. Western blot analysis of α-SMA Passage 6 hDPCs with or without 40ng/ml CTGF grown to 80% confluence were washed twice in ice-cold PBS, scraped, and centrifuged at 1000rpm for 10min. Whole cell lysates were prepared by using RIPA buffer (1% Nonidet P-40, 0.5% deoxycholate, 0.1% SDS in PBS, pH 7.4) containing 1 mM phenylmethylsulfonyl fluoride (PMSF) and protease and phosphatase inhibitor cocktails. The pellet was incubated on ice for 20 min. Lysates were microcentrifuged at the maximum speed (16,000×g) for 10 min at 4°C, and the supernatant was removed and used for the whole cell extracts. Protein concentration was measured by using a BCA kit. The normalized amounts of proteins from the cytosolic fraction of hDPCs
This article is protected by copyright. All rights reserved.
Accepted Article
treated with or without CTGF were resolved by sodiumdodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and analyzed by Western blotting using specific antibodies. Briefly, protein samples were resuspended in SDS sample buffer supplemented with 1% (vol/vol) β-mercaptoethanol, boiled for 10min at 95°C, and snap chilled on ice. Samples were loaded on 10% SDS-polyacrylamide gel electrophoresis at 80 volts for 30min and then at 110 volts for 1.5 hours. Proteins were transferred to Hybond ECL nitrocellulose membrane in 25mM Tris and 192mM glycine, pH8.3, followed by blocking with 5% nonfat dry milk in PBST (0.05% Tween 20) for 1h at room temperature. After overnight incubation at 4°C with α-SMA primary antibodies at 1:200 and β-actin at 1:1000, respectively, proteins were detected with horseradish peroxidase-conjugated secondary antibodies. Then, the immunoreactive bands were detected by using enhanced chemiluminescent (ECL) plus reagent kit before exposure for at least 3 min to Kodak film. Real-time Reverse Transcription-PCR for CTGF, β-catenin, BMP2, TGF-β2, ALP and versican After passage 6 hDPCs were seeded at 3×103 cells per cm2 and cultured until sub-confluency (5-7 days), total RNA was extracted from these cells. CTGF, β-catenin, BMP2, TGF-β2, ALP, versican and glyceraldehydes-3-phosphate dehydrogenase (GAPDH) mRNA levels were determined by real-time RT-PCR. mRNA was reverse-transcribed to cDNA using a Reverse Transcription System kit according to the manufacturers’ instructions. cDNA was then used for specific real-time PCR. The primers for CTGF, β-catenin, BMP2, TGF-β2, ALP, versican and GAPDH were synthesized from Sangon Biotech (Shanghai, P.R.C.) (Table І). The PCR reaction was carried out in the presence of Fast SYBR Green This article is protected by copyright. All rights reserved.
Accepted Article
Master Mix (Applied Biosystems). The cycling conditions used were as follows: 95°C for 8min, followed by 40 cycles of 95°C for 12s and 60°C for 50s, and ending with a full extension cycle of 60.0 °C for 10min. Gene copy number was estimated by comparison with a standard curve constructed using CTGF, β-catenin, BMP2, TGF-β2, ALP and versican DNAs and corrected for housekeeping GAPDH copy number. Primers were designed based on published cDNA sequences as following. Reactions were set up in a 96-well spectrofluorometric thermal iCycler, and fluorescence was real-time monitored during every PCR cycle at the annealing step.
Statistical analysis
Data are presented as means±SD. All statistics and graphs were carried out using SPSS 13.0 software. Student’s t-test or one-way ANOVA followed by appropriate Bonferroni corrections were used. A value of p＜0.05 was considered statistically significant.
Results
hDPCs identification
The isolated DP adhered to the flask overnight, migrated in about 48h, and phenotypically resembled sunflowers. The isolated hDPCs were identified as ALP positive cells. Flow cytometry showed that CD133 (+) cells were above 80% (Fig 1).
CTGF reduced cultured hDPCs proliferation in a dose-dependent manner.
During the 7 days of culture, the number of expanded hDPCs was smaller in CTGF-supplemented media (20ng/ml and 40ng/ml) than in the control media. CTGF at This article is protected by copyright. All rights reserved.
Accepted Article
40ng/ml showed higher reduced proliferation effect on hDPCs compared with CTGF at 20ng/ml(p＜0.05).
(Fig 2) .
Exogenous CTGF could increase the expression of endogenous CTGF in the dermal papilla cells
Immunocytochemistry was conducted after treatment with CTGF. After 7 days of culture, it was shown that there was positive staining of CTGF in the endocylema of hDPCs (Fig 3). RT-PCR confirmed that the copy number of CTGF in hDPCs increased after the interaction of CTGF in the hDPCs culture medium (Fig 4).
CTGF can increase the expression of DP cell marker ALP andα-SMA but decrease versican
To investigate the change of hDPCs’ hair-inductive ability after the stimulation of CTGF, western blot for α-SMA and RT-PCR for ALP and versican were used to detect protein and gene expressions. The results showed that after 7 days of stimulation with CTGF the expression of α-SMA protein (Fig 5) and ALP mRNA (Fig 6a) in hDPCs increased (P0.05) (Fig 6b).
CTGF can modulate several pathways activity in hDPCs
To determine whether CTGF can influence the pathways involved in hair growth, RT-PCR was used to determine β-catenin (Wnt pathway), BMP2 (BMP pathway), TGF-β2 (TGF-β pathway) mRNA expression. As evidenced by the results, the expression of mRNA of β-catenin, BMP2 and TGF-β2 in hDPCs treated with CTGF were all increased compared to the cells without CTGF treatment. (P＜0.05) The increase of β-catenin and TGF-β2 was
This article is protected by copyright. All rights reserved.
Accepted Article
greater than the increase in BMP2 expression. This indicates that the Wnt, BMP2 and TGF-β2 pathways were all modulated by CTGF in hDPCs (Fig 7).
Discussion
The mammalian hair follicle is a multi-layered structure and has the ability to self-renewal. The follicle will undergo a cycle of anagen (the active growth phase), catagen (the apoptotic regression phase), and telogen (the resting phase)[20,21]. The cells derived from the mesenchyme, such as dermal papilla and dermal sheath cells, interact with the cells derived from the epithelium, such as epithelial cells of outer and inner root sheaths, matrix and hair shaft, and promote hair growth after birth. It has been reported that dermal papilla cells could secrete diffusible proteins that are essential to the regulation of hair cycling and have follicle-inductive ability through interactions with the surrounded epithelial components [22]. However, successful tissue engineering of hair follicles using hDPCs remains elusive. One explanation could be because hDPCs lose their hair inductive ability after long-term culture. Efficient expansion of hDPCs while maintaining their hair-inductive capacity in culture has been a major challenge and a prerequisite for future tissue engineering hair follicle therapies.
It has been demonstrated that the members of CCN family can regulate differentiation of skeletal mesenchymal cells such as muscle cells[23], chondrocytes[24], and osteoblasts[25] by modulating Wnt[26], BMP[27] and TGF-β[28] signaling pathways. Several reports have indicated that CTGF (CCN2), a member of the CCN family of proteins, the major mitogenic and chemoattractant protein produced by umbilical vein and vascular
This article is protected by copyright. All rights reserved.
Accepted Article
endothelial cells, has a vital role in hair follicle development. It stimulates the proliferation and differentiation of chondrocytes, induces angiogenesis, promotes cell adhesion of fibroblasts, endothelial, and epithelial cells. Lindner et al[29] described in patent application (No.WO2009118283) that CTGF is one of the extracellular matrix proteins and it can contribute to the formation of hair-like microfollicle structures in vitro. Our previous study about physiological significance of CTGF in vivo showed that in the presence of exogenous CTGF, as well as a higher number of hDPCs mixed with human hair follicle out root sheath cells, resulted in the generation of a hair follicle structure in a nude mouse model. This data prompted us to examine whether CTGF induces Wnt, BMP and TGF-β signaling in hDPCs and thus promote hair follicle formation. We first examined the effect of CTGF on the bioactivity of hDPCs. CTGF treated hDPCs showed reduced proliferation in a dose dependent manner; out of which 40ng/ml showed higher reduction in cell proliferation at D4 and D5. This indicates that CTGF may conserve the bioactivity and initial characteristics of the hDPCs. Interestingly, the three markers of hDPCs, alkaline phosphatase (ALP), versican and α-SMA, did not show the consistency of change after the treatment of CTGF. The increase of ALP was obvious whereas versican showed a downward trend. The protein level of α-SMA in CTGF treatment group was higher than that of the control group, but the difference was not significance. ALP has been regarded as a useful marker to indicate the location, shape and size of DP in skin specimens [30-33]. The dermal papilla and lower dermal sheath around the end bulb of a follicle specifically express ALP activity and have the potential capacity to restore hair growth [6]. ALP is expected to activate in anagen but not in catgen and telogen. ALP activity This article is protected by copyright. All rights reserved.
Accepted Article
in the DPs was closely related to proliferation of the hair matrix and hair-inductive activity. It is also important in the epithelial-mesenchymal interaction and is involved in the establishment and maintenance of the hair germ cells for the subsequent hair cycle. The increase of ALP after the treatment of CTGF showed the possibility that CTGF maintained or increased the hair-inductivity of hDPCs. On the other hand, versican and α-SMA were also used as markers for DPCs [10, 15, 34]. During the hair follicle development, versican was not expressed until the hair follicles were beginning to produce fibers. With follicle maturation, versican expression reaches a maximum at the height of the growth phase, after which it diminished at the end of this phase approached [35]. Our results reveal that after the CTGF treatment, the activations of versican reduced although the reduction is not obvious. This may suggest that CTGF maintain the initial condition of hDPCs and keep them in the early stage of anagen. α-SMA correlated with cells originating from terminal hair follicles [36] and undersigns myofibroblastic transition[37]. Jiang et al [38] revealed that CTGF could markedly elevate α-SMA expression in CTGF-treated myofibroblastic phenotype cells. Our results showed that CTGF could increase α-SMA expression in a minor manner. The difference may because of the two different cell types react distinguishingly to CTGF. Taken together, we suppose that CTGF maintain hDPCs in the early stage of anagen keeping with the hair-inductive ability but not hair fiber growth ability. Thus the immature hair follicles that observed in vivo with CTGF treatment can be explained as hDPCs don’t induce hair fiber growth with the interfere with CTGF. CTGF is found at its highest levels in the vascular tissue and the maturing chondrocytes of the embryo [39]. While in adult skin, CTGF is largely absent but is restricted to the dermal This article is protected by copyright. All rights reserved.
Accepted Article
papillae [40]. We observed that exogenous CTGF in culture media could increase the expression of intracellular CTGF in hDPCs, which supports the hypothesis that CTGF exposure may affect Wnt, BMP and TGF-β signaling in the cells. The Wnt pathway contributes to the initiation of folliculogenesis. Activation of the Wnt pathway is thought to be the first mesenchymal signal involved in the epithelial-mesenchymal interaction of folliculogenesis[14]. CTGF can activate Wnt pathway in the course of osteoblast differentiation [41] and epithelial–mesenchymal transition[38]. Our findings suggested CTGF significantly upregulated β-catenin gene expression in hDPCs. This may contribute to the induction of immature hair follicle formation. On the contrary, Liu et al[40] reported that addition of CTGF to cultured keratinocytes resulted in reduced steady state levels of endogenous β-catenin and lost of CTGF resulted in an increase in β-catenin accumulation and β-catenin reporter activity in epithelial cells. The opposite effects of CTGF on epithelial and mesenchymal (hDPCs) cells should be checked further more. TGF-β pathway is a well-known inducer of extracellular matrix components such as collagen and fibronectin. TGF-β2 is involved in promotion of the hair placode and contributes to anagen induction [42]. TGF-β2 is highly expressed in hDPCs compared with human hair follicle cells, and is suggested to mediate the hair-inductive capacity of hDPCs[18]. TGF-β2 also acts as intercellular modulator of growth factor signaling exchange between the hair follicle epithelium and the mesenchyme. CTGF can directly bind TGF-β through its cysteine-rich domain [26]. Our results showed that CTGF could stimulate TGF-β2 gene expression in hDPCs. This indicated the maintenance of hair-inductive ability of hDPCs. It also may enhance the communication between epithelium and mesenchyme and promote the hair
This article is protected by copyright. All rights reserved.
Accepted Article
follicle to enter the anagen process. BMP2 is a multifunctional growth factor, and it was originally defined by its ability to induce ectopic bone and cartilage formation in vivo. In the hair formation process, BMP2 controls not only the differentiation process of hair matrix cells, but also the activity of dermal papilla fibroblasts [43]. CTGF can directly interact with BMP2 and promote CTGF/BMP2-induced proteoglycan synthesis [27]. Our results show that CTGF can increase the gene expression of BMP2 in hDPCs, but the extent is much less than the increase of β-catenin and TGF-β2. So the effect to maintain the hair-inductive ability by β-catenin and TGF-β2 exceeded the effect of hair follicle differentiation by BMP2. The coordinate activity of above growth stimulatory pathways is essential for proper hair fiber formation. In summary, the present work demonstrates that exogenous CTGF could functionally interact with the bioactivity of cultured adult hDPCs. CTGF could reduce the proliferation of hDPCs in a dose-dependent manner and upregulate the expression of ALP. CTGF may conserve the hair-inductive ability of hDPCs via activating Wnt, BMP and TGF-β pathways, thus indicating the relevance of the role in CTGF in hair regeneration.
Acknowledgments
This work was supported by the national science and technology support program special funds of China (2009BAI87B03). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
This article is protected by copyright. All rights reserved.
Accepted Article
Fig 1 hDPCs isolation and identification
(a) isolated DP (20×) (b) cells outgrown from DP after 5 days culture. (20×) (c) human dermal papilla cells positive for alkaline phosphatase (20×)
(d,e) Flow cytometry was used to determine
the proportion of CD133 positive cells from passage 3 hDPCs (d) negative control. (e) is CD133 detection, the positives were 86.66%.
Fig 2 CTGF effects on proliferation of cultured hDPCs. Proliferation of passage 6 hDPCs cultured for 1-7 days in Dulbecco’s modified Eagle’s/F12 medium supplemented with various concentrations of CTGF (20ng/ml, 40ng/ml) or without CTGF. Data is displayed in means ± s.d. of at least three (n = 9) independent experiments of each concentration or time point. One representative blot is presented for each experimental group. One-Way ANOVA, followed by Bonferroni’s multiple comparison test, * p ＜0.05, **p＜0.01 compared to control or comparison between groups as indicated. Bar, ISD.
Fig 3 Immunofluorescence for CTGF. Passage 6 hDPCs cultured for 7 days in Dulbecco’s modified Eagle’s/F12 medium supplemented with 20ng/ml CTGF. hDPCs showed positive expression of CTGF.(20×)
Fig 4 Real-time PCR analysis of CTGF expression in hDPCs and exogenous CTGF treated hDPCs. Gene expression levels of CTGF was examined in passage 6 hDPCs cultured in Dulbecco’s modified Eagle’s medium/F12 medium, supplemented with (40ng/ml) or without CTGF for 7 days. Data shown in the figure was the ratio of respective gene expression to GAPDH mRNA expression. Data presented from at least 2 independent experiments (n = 4), as means ± s.d. Expression level in hDPCs was set as 1.0. Statistical significance determined by Student’s t-test. * p＜0.05 compared to hDPCs as indicated. Bar, ISD.
This article is protected by copyright. All rights reserved.
Accepted Article
Fig 5 Western blot analysis of α-SMA in protein extracted from passage 6 hDPCs treated with (40ng/ml) or without CTGF. (a) The anti-α-SMA showed band at 42KD. β-actin served as a loading control for protein normalization. (b) α-SMA protein level is given as percent of control level. Data is displayed in means ± s.d. of at least three (n = 3) independent experiments. One representative blot is presented for each experimental group. Statistical significance determined by Student’s t-test. * p＜ 0.05 compared to hDPCs as indicated. Bar, ISD.
Fig 6 Real-time PCR analysis of ALP and versican expression in hDPCs and exogenous CTGF treated hDPCs. Gene expressions of ALP and versican were examined in passage hDPCs cultured in Dulbecco’s modified Eagle’s medium/F12 medium, supplemented with (40ng/ml) or without CTGF for 7 days. Data shown in the figure was the ratio of the respective gene expression to GAPDH mRNA expression. Data presented from at least 2 independent experiments (n = 4), as means ± s.d. Expression level in hDPCs was set as 1.0. Statistical significance determined by Student’s t-test. * p＜0.05 compared to hDPCs as indicated. Bar, ISD. (a) Gene expression of ALP. (b) Gene expression of versican.
Fig 7 Real-time PCR analysis of β-catenin, BMP2 and TGF-β expression in hDPCs and exogenous CTGF treated hDPCs. Gene expression of β-catenin, BMP2 and TGF-β was examined in passage 6 hDPCs cultured in Dulbecco’s modified Eagle’s medium/F12 medium, supplemented with (40ng/ml) or without CTGF for 7 days. Data shown in figure was the ratio of the respective gene expression to GAPDH mRNA expression. Data presented from at least 2 independent experiments (n = 4), as means ± s.d. Expression level in hDPCs was set as 1.0. Statistical significance determined by Student’s t-test. * p ＜0.05 compared to hDPCs as indicated. Bar, ISD.
This article is protected by copyright. All rights reserved.
Accepted Article
Reference 1.
Kishimoto J, Ehama R, Wu L, Jiang S, Jiang N, Burgeson RE. Selective activation of the versican promoter by epithelial–mesenchymal interactions during hair follicle development. Proc Natl Acad Sci U S A 1999; 96:7336-7341.
2.
Kamimura J, Lee D, Baden HP, Brissette J, Dotto GP. Primary mouse keratinocyte cultures contain hair follicle progenitor cells with multiple differentiation potential. J Invest Dermatol1997; 109:534-540.
3.
Ferraris C, Bernard BA, Dhouailly D. Adult epidermal keratinocytes are endowed with pilosebaceous forming abilities. Int J Dev Biol 1997; 41:491-498.
4.
Zheng Y, Nace A, Chen W, Watkins K, Sergott L, Homan Y, et al. Mature hair follicles generated from dissociated cells: a universal mechanism of folliculoneogenesis. Dev Dyn 2010; 239:2619-2626.
5.
Zhang S, Hu H, Zhang H, Liu S, Liu S, Zhang Y, et al. Hair follicle stem cells derived from single rat vibrissa via organ culture reconstitute hair follicles in vivo. Cell Transplant 2012; 21:1075-1085.
6.
Aoi N, Inoue K, Chikanishi T, Fujiki R, Yamamoto H, Kato H, et al. 1,25-Dihydroxyvitamin D3 modulates the hair-inductive capacity of dermal papilla cells: therapeutic potential for hair regeneration. Stem Cells Transl Med. 2012;1:615-626.
7.
Inamatsu M, Matsuzaki T, Iwanari H, Yoshizato K. Establishment of rat dermal papilla cell lines that sustain the potency to induce hair folliclesfrom afollicular skin. J Invest Dermatol 1998; 111: 767–775.
8.
Rendl M, Polak L, Fuchs E. BMP signalingin dermal papilla cells is required for their hair follicle-inductive properties. Genes Dev 2008;22:543–557.
This article is protected by copyright. All rights reserved.
Accepted Article
9.
Osada A, Iwabuchi T, Kishimoto J, Hamazaki TS, Okochi H. Long-term culture of mouse vibrissal dermal papilla cells and de novo hair follicle induction.Tissue Eng 2007;13:975–982.
10. Higgins CA, Richardson GD, Ferdinando D, Westgate GE, Jahoda CA. Modelling the hair follicle dermal papilla using spheroid cell cultures. Exp Dermatol 2010;19:546-548. 11. Higgins CA, Chen JC, Cerise JE, Jahoda CA, Christiano AM. Microenvironmental reprogramming by threedimensional culture enables dermal papilla cells to induce de novo human hair-follicle growth. Proc Natl Acad Sci U S A. 2013;110:19679-19688. 12. Havlickova B, Bíró T, Mescalchin A, Tschirschmann M, Mollenkopf H, Bettermann A, et al. A human folliculoid microsphere assay for exploring epithelial-mesenchymal interactions in the human hair follicle. J Invest Dermatol 2009; 129:972–983. 13. Zhang P, Chai J, Wang J, Duan H, Ma L, Zhu G. Functions of exogenous application of connective tissue growth factor in stimulating human dermal papilla cells and human hair follicle outer root sheath cells for reconstructive tissue-engineering hair follicles. Natl Med J China 2013; 93: 1063-1066. 14. Rabbani P, Takeo M, Chou W, Myung P, Bosenberg M, Chin L, et al.Coordinated activation of Wnt in epithelial and melanocyte stem cells initiates pigmented hair regeneration. Cell 2011;145:941-955. 15. Soma T, Fujiwara S, Shirakata Y, Hashimoto K, Kishimoto J. Hair-inductive ability of human dermal papilla cells cultured under Wnt⁄b-catenin signalling activation. Exp Dermatol 2012;21:307-309. 16. Kishimoto J, Burgeson RE, Morgan BA.Wnt signaling maintains the hair-inductive activity of the dermal papilla. Genes Dev 2000;14:1181–1185. 17. Plikus MV, Mayer JA, de la Cruz D, Baker RE, Maini PK, Maxson R, et al. Cyclic dermal BMP signaling regulates stem cell activation during hair regeneration. Nature 2008;451:340-344.
This article is protected by copyright. All rights reserved.
Accepted Article
18. Inoue K, Aoi N, Yamauchi Y, Sato T, Suga H, Eto H, et al. TGFbeta2 is specifically expressed in human dermal papilla cells and modulates hair folliculogenesis. J Cell Mol Med 2009;13:4643– 4656. 19. Foitzik K, Paus R, Doetschman T, Dotto GP. The TGF-2 isoform is both a required and sufficient inducer of murine hair follicle morphogenesis. Dev Biol 1999;212:278 –289. 20. Botchkarev VA, Kishimoto J. Molecular control of epithelial—mesenchymal interactions during hair follicle cycling. J Investig Dermatol Symp Proc 2003;8:46-55. 21. Stenn KS, Paus R. Controls of hair follicle cycling. Physiol Rev 2001; 81: 449-494. 22. Yamao M, Inamatsu M, Ogawa Y, Toki H, Okada T, Toyoshima KE, et al. Contact between dermal papilla cells and dermal sheath cells enhances the ability of DPCs to induce hair growth. J Invest Dermatol 2010; 130: 2707-2718. 23. Calhabeu F, Lafont J, Le Dreau G, Laurent M, Kazazian C, Schaeffer L, et al. NOV/CCN3 imparis muscle cell commitment and differentiation. Exp Cell Res 2006;312: 1876-1889. 24. Lafont J, Jacques C, Le Dreau G, Calhabeu F, Thibout H, Dubois C, et al. New target genes for NOV/CCN3 in chondrocytes: TGF-beta2 and type X collagen. J Bone Miner Res 2005;20: 2213-2223. 25. Smerdel-Ramoya A, Zanotti S, Deregowski V, Canalis E. Connective tissue growth factor enhances osteoblastogenesis in vitro. J Biol Chem 2008; 283: 22690-22699. 26. Luo Q, Kang Q, Si W, Jiang W, Park JK, Peng Y, et al. Connective tissue growth factor (CTGF) is regulated by Wnt and bone morphogenetic proteins signaling in osteoblast differentiation of mesenchymal stem cells. J Biol Chem 2004;279: 55958-55968. 27. Maeda A, Nishida T, Aoyama E, Kubota S, Lyons KM, Kuboki T, et al.CCN family 2/connective tissue growth factor modulates BMP signalling as a signal conductor, which action regulates the proliferation and differentiation of chondrocytes. J Biochem 2009;145: 207-216.
This article is protected by copyright. All rights reserved.
Accepted Article
28. Abreu JG, Ketpura NI, Reversade B, De Robertis EM. Connective-tissue growth factor (CTGF) modulates cell signalling by BMP and TGF-beta. Nat Cell Biol 2002;4: 599-604. 29. Lindner G, Lauster R. Methods for producing de novo papillae and hair microfollicles and their use for in vitro tests and in vivo implantations: European, EP2105499A1 [P/OL]. (2009-9-30) 30. McElwee KJ, Kissling S, Wenzel E, Huth A, Hoffmann R. Cultured peribulbar dermal sheath cells can induce hair follicle development and contribute to the dermal sheath and dermal papilla. J Invest Dermatol 2003;121:1267–1275. 31. Iida M, Ihara S, Matsuzaki T. Hair cycledependent change of alkaline phosphatase activity in the mesenchyme and epithelium in mouse vibrissal follicles. Dev Growth Differ 2007;49:185–195. 32. Paus R, Müller-Röver S, Van Der Veen C, Maurer M, Eichmüller S, Ling G, et al. A comprehensive guide for the recognition and classification of distinct stages of hair follicle morphogenesis. J Invest Dermatol 1999; 113:523-532. 33. Miyake T, Cameron AM, Hall BK. Stage-specific expression patterns of alkaline phosphatase during development of the first arch skeleton in inbred C57BL/6 mouse embryos. J Anat. 1997;190:239-260.. 34. Robinson M, Reynolds AJ, Gharzi A, Jahoda CA.In vivo induction of hair growth by dermal cells isolated from hair follicles after extended organ culture. J Invest Dermatol. 2001;117:596-604. 35. du Cros DL, LeBaron RG, Couchman JR. Association of versican with dermal matrices and its potential role in hair follicle development and cycling. J Invest Dermatol. 1995;105:426-431. 36. Hill RP, Gledhill K, Gardner A, Higgins CA, Crawford H, Lawrence C, et al. Generation and characterization of multipotent stem cells from established dermal cultures. PLoS One. 2012;7:e50742.
This article is protected by copyright. All rights reserved.
Accepted Article
37. Reynolds AJ, Chaponnier C, Jahoda CA, Gabbiani G. A quantitative study of the differential expression of alpha-smooth muscle actin in cell populations of follicular and non-follicular origin. J Invest Dermatol. 1993;101:577-583. 38. Jiang CG, Lv L, Liu FR, Wang ZN, Na D, Li F, et al. Connective tissue growth factor is a positive regulator of epithelial–mesenchymal transition and promotes the adhesion with gastric cancer cells in human peritoneal mesothelial cells. Cytokine 2013;61: 173-180. 39. Ivkovic S, Yoon BS, Popoff SN, Safadi FF, Libuda DE, Stephenson RC, et al. Connective tissue growth factor coordinates chondrogenesis and angiogenesis during skeletal development. Development 2003;130:2779–2791. 40. Liu S, Leask A. CCN2 modulates hair follicle cycling in mice. Mol Biol Cell. 2013;24:3939-3944. 41. Si W, Kang Q, Luu HH, Park JK, Luo Q, Song WX, et al.CCN1/Cyr61 is regulated by the canonical Wnt signal and plays an important role in Wnt3A-induced osteoblast differentiation of mesenchymal stem cells. Mol Cell Biol 2006;26: 2955-2964. 42. Oshimori N, Fuchs E. Paracrine TGF-β signaling counterbalances BMP-mediated repression in hair follicle stem cell activation. Cell Stem Cell 2012;10: 63–75. 43. Millar SE. Molecular mechanisms regulating hair follicle development. J Invest Dermatol2002; 118: 216–225.
This article is protected by copyright. All rights reserved.
Accepted Article
Table І
Primer sequences
Forward
Reverse
CTGF
CTCCACCCGAGTTACCAATG
TGGCGATTTTAGGTGTCCG
β-catenin
GCTATTCCACGACTAGTTCAGC
AGCTCCAGTACACCCTTCTAC
BMP2
CGCAGCTTCCATCACGAA
TGCAGATGTGAGAAACTCGTC
TGF-β
CCTGAGTGGCTGTCTTTTGA
CGTGGAGTTTGTTATCTTTGCTG
ALP
GATGTGGAGTATGAGAGTGACG GGTCAAGGGTCAGGAGTTC
GAPDH
TGAAGGTCGGAGTCAACGG
TGGAAGATGGTGATGGGAT
This article is protected by copyright. All rights reserved.
Accepted Article This article is protected by copyright. All rights reserved.
Accepted Article This article is protected by copyright. All rights reserved.
Accepted Article This article is protected by copyright. All rights reserved.
Accepted Article This article is protected by copyright. All rights reserved.
Accepted Article This article is protected by copyright. All rights reserved.
Accepted Article This article is protected by copyright. All rights reserved.
