Exogenous arachidonic acid mediates permeability of human brain microvessel endothelial cells through prostaglandin E2 activation of EP3 and EP4 receptors.

JOURNAL OF NEUROCHEMISTRY

| 2015 | 135 | 867–879

doi: 10.1111/jnc.13117

,1

,1 ,

*Department of Pharmacology and Therapeutics, Center for Research and Treatment of Atherosclerosis, University of Manitoba, DREAM Children’s Hospital Research Institute of Manitoba, Winnipeg, Manitoba, Canada †Human Nutritional Sciences, Center for Research and Treatment of Atherosclerosis, University of Manitoba, DREAM Children’s Hospital Research Institute of Manitoba, Winnipeg, Manitoba, Canada ‡Biochemistry and Medical Genetics, Center for Research and Treatment of Atherosclerosis, University of Manitoba, DREAM Children’s Hospital Research Institute of Manitoba, Winnipeg, Manitoba, Canada

Abstract The blood–brain barrier, formed by microvessel endothelial cells, is the restrictive barrier between the brain parenchyma and the circulating blood. Arachidonic acid (ARA; 5,8,11,14cis-eicosatetraenoic acid) is a conditionally essential polyunsaturated fatty acid [20:4(n 6)] and is a major constituent of brain lipids. The current study examined the transport processes for ARA in confluent monolayers of human brain microvascular endothelial cells (HBMEC). Addition of radioactive ARA to the apical compartment of HBMEC cultured on Transwellâ inserts resulted in rapid incorporation of radioactivity into the basolateral medium. Knock down of fatty acid transport proteins did not alter ARA passage into the basolateral medium as a result of the rapid generation of prostaglandin E2 (PGE2), an eicosanoid known to facilitate

opening of the blood–brain barrier. Permeability following ARA or PGE2 exposure was confirmed by an increased movement of fluorescein-labeled dextran from apical to basolateral medium. ARA-mediated permeability was attenuated by specific cyclooxygenase-2 inhibitors. EP3 and EP4 receptor antagonists attenuated the ARA-mediated permeability of HBMEC. The results indicate that ARA increases permeability of HBMEC monolayers likely via increased production of PGE2 which acts upon EP3 and EP4 receptors to mediate permeability. These observations may explain the rapid influx of ARA into the brain previously observed upon plasma infusion with ARA. Keywords: arachidonic acid, blood–brain barrier, endothelial cells, fatty acid. J. Neurochem. (2015) 135, 867–879.

Read the Editorial Highlight for this article on page 845.

The cerebral microvasculature with its endothelial cell lining is a part of the neurovascular unit, comprised of groups of neurons and their associated astrocytes along with the

microvessels and their associated pericytes (Balabanov and Dore-Duffy 1998). The blood–brain barrier (BBB), formed by the brain microvessel endothelial cells, is the protective 1

Received December 27, 2014; revised manuscript received March 13, 2015; accepted March 26, 2015. Address correspondence and reprint requests to Dr Grant M. Hatch, Department of Pharmacology and Therapeutics, Faculty of Medicine, University of Manitoba, 753 McDermot Avenue, Winnipeg, Manitoba, Canada R3E 0W3. E-mail: [email protected]

These authors contributed equally to this work. Abbreviations used: ARA, arachidonic acid; BBB, blood–brain barrier; CNS, central nervous system; cPGES, cytosolic prostaglandin E2 synthase; EP1–4, prostaglandin E2 receptors 1–4; HBMEC, human brain microvascular endothelial cells; mPGES, microsomal prostaglandin E2 synthase MRP4multi-drug resistance protein 4; PGE2, prostaglandin E2; PGT, prostaglandin transporter.

© 2015 International Society for Neurochemistry, J. Neurochem. (2015) 135, 867--879

867

868

S. Dalvi et al.

and selectively permeable barrier between the brain parenchyma and the circulating blood (Rubin et al. 1991). In addition to complex tight junctions, reduced pinocytotic activity and the absence of fenestrations, brain microvessel endothelial cells also express several specific transport and carrier molecules that contribute to the selective permeability of the BBB (Gloor et al. 2001; Mitchell and Hatch 2011; Dalvi et al. 2014). These properties result in a significantly reduced degree of paracellular as well as transcellular flux of molecules into the brain. Human brain microvascular endothelial cells (HBMECs) exhibit the presence of several specific transport and carrier molecules that contribute to the selective permeability of the BBB (Gloor et al. 2001; Mitchell and Hatch 2011). Besides acting as a physical barrier, the BBB also functions as a metabolic barrier by virtue of possessing enzymes such as CYP450 (1A and 2B) that degrade or inactivate potentially toxic substances (Abbott et al. 2006). In addition, the metabolic activity of the BBB provides the potential to generate vasoactive materials that can provide autoregulation in the cerebral microvasculature. Integrity of the BBB is of utmost importance in maintaining the homeostasis of the microenvironment of the brain. Human brain microvessel endothelial cells (HBMECs) of the BBB are unique as they are connected to adjacent endothelial cells by means of tight junctions and exhibit very high transendothelial electrical resistance (Mitchell and Hatch 2011). The tight junctions that maintain the BBB are an intricate complex of several proteins that link the actin cytoskeleton of one cell to that of another. These proteins include junctional adhesion molecule-1, occludin and claudins (transmembrane proteins) and zonula occludens-1, -2 and -3, cingulin, AF-6 and 7H6 (cytoplasmic proteins). These tight junctional complexes are not static structures but can ‘bend without breaking’, thereby maintaining structural integrity (Huber et al. 2001). The tight junction-associated proteins can be modulated by several intracellular processes that involve calcium signaling, phosphorylation and G-proteins, each of which can be potential targets for drugs (Hawkins and Davis 2005). The integrity of the tight junctions can be compromised in a variety of neurological diseases like stroke, traumatic brain injury and neurodegenerative disorders. Understanding the molecular biology of tight junctions, and the cellular mediators that can alter tight junction integrity in the BBB, may hold the key to the prevention and treatment of neurological diseases (Ballabh et al. 2004). Arachidonic acid (ARA; 5,8,11,14-cis-eicosatetraenoic acid) is a conditionally essential, polyunsaturated fatty acid [20:4(n 6)] and is a major constituent of brain lipids (Rapoport 2008). It cannot be synthesized de novo by vertebrates. However, it can be produced from the essential fatty acid, linoleic acid [18:2(n 6)], by elongation and desaturation processes in the hepatocytes (Rapoport 2008) and astrocytes (Moore et al. 1991). ARA is liberated from

membrane phospholipids by the action of phospholipases, especially phospholipase A2 and is metabolized to physiologically active molecules such as prostaglandin E2 via the cyclooxygenase pathway (Needleman et al. 1986; Bosetti 2007). ARA plays both physiological and pathological roles in the brain. Besides being a direct precursor of prostaglandins and other eicosanoids, ARA is also responsible for maintaining cell membrane fluidity, enhancing the activity of membrane-associated adenylate cyclase and guanylate cyclase and functioning as a second messenger (Chan et al. 1985). ARA and its metabolites are involved in various processes in the central nervous system, including synaptic signaling, neuronal firing, neurotransmitter release, nociception, neuronal gene expression, cerebral blood flow regulation, sleep/wake cycle and appetite (Bosetti 2007). ARA serves both as a neurotrophic and neurotoxic substance in the brain (Katsuki and Okuda 1995). Neurotrophic effects including promotion of cell survival and enhancement of neurite extension are mediated by ARA itself while neurotoxic effects such as induction of apoptosis are mediated by cytotoxic lipid peroxides generated by ARA metabolism (Williams et al. 1998). ARA is also a potent inducer of cellular edema and plays a central role in the development of edema in inflammatory conditions of the brain (Chan et al. 1983). Changes in the composition of membrane fatty acids, specifically ARA, directly alter the cellular levels of prostaglandins. Increased levels of ARA and consequent increased production of prostaglandin E2 (PGE2) are observed in brain tumors such as meningiomas and gliomas (Kokoglu et al. 1998). Alterations in ARA metabolism have also been linked to a number of neurological disorders, including epilepsy, ischemia, stroke, HIV-associated dementia, amyotrophic lateral sclerosis, Alzheimer disease, Parkinson disease, schizophrenia, and mood disorders (Bosetti 2007). Transport of fatty acids across membranes is a controversial field and may involve diffusional as well as proteinmediated transport processes (reviewed in Hamilton 2007; Mitchell and Hatch 2011). Previously, we demonstrated that the transport of various fatty acids across confluent layers of the HBMEC was, in part, mediated by fatty acid transport proteins (Mitchell et al. 2009, 2011). In the present study, we examined ARA movement across confluent monolayers of primary cultured HBMECs. We show that incubation of HBMECs with ARA results in rapidly increased permeability across the monolayers and the mechanism is likely through a PGE2-mediated promotion of HBMECs permeability through EP3 and EP4 receptor activation.

Materials and methods [14C]ARA, [3H]ARA, and [1-14C]oleic acid were obtained from Amersham Pharmacia Biotech (Baie-d’Urfe, QC, Canada). Primary


Arachidonate mediates permeability of brain endothelial cells

HBMECs isolated from normal human brain cortical vessels and the cell culture medium and reagents for growing and passaging cells were obtained from Cell Systems Corporation (Kirkland, WA, USA). Transwellâ plates with polycarbonate inserts (0.4 lm; 24 mm diameter) were obtained from Corning Life Sciences (Lowell, MA, USA). Ecolite scintillant was obtained from ICN Biochemicals (Montreal, QC, Canada). Fluorescein dextran was obtained from Invitrogen (Burlington, ON, Canada). Bovine serum albumin (BSA) was obtained from Sigma Chemical Company (St. Louis, MO, USA). RNeasyâ Plus Mini Kit for RNA extraction was obtained from Qiagen (Cambridge, MA, USA). Primers for PCR were designed with the OligoPerfectTM Designer primer design tool (Invitrogen) and obtained from Invitrogen. Antibodies for western blot analysis were obtained from Santa Cruz Biotechnology, Inc. (Dallas, TX, USA) or Abcam Inc. (Toronto, ON, Canada). PGE2 ELISA kit (ab133021) was obtained from Abcam Inc. All other biochemicals and drugs were certified ACS grade and obtained from either Fisher Scientific or Sigma Chemical Company (Winnipeg, MB, Canada). All cell culture flasks and dishes were obtained from Corning, Inc. (Corning, NY, USA). Culturing of HBMEC Frozen HBMEC received in a vial from Cell Systems Corporation were rapidly thawed in a 37°C water bath and plated in a T75 flask and grown until 80–90% confluent. They were further passaged in a 1 : 3 split ratio into more T75 flasks. The polycarbonate inserts of Transwellâ plates to be used for permeability studies were first coated with an attachment factor provided by Cell Systems, and the HBMEC were plated on these inserts (70 000 cells/cm2). Permeability studies were performed as soon as these cells reached confluency, typically in 3–4 days. The cells were maintained in CSC complete medium that, in addition to a basal medium, contained 10% fetal bovine serum supplemented with ciprofloxacin and 50 lg/mL of CS-C growth factor (bovine Growth Factor and porcine heparin). Cells were incubated in a humidified incubator at 37°C in 5% CO2. Culture medium was replaced every 2 days until the cells were 50% confluent and then every day until the cells were 100% confluent. Transepithelial electric resistance was measured using an Epithelial Voltohmmeter (World Precision Instruments Inc., Sarasota, FL, USA) to ensure intact monolayers before all experiments were performed. Cells used in the current study were passage 6 or lower. Permeability studies Confluent HBMEC monolayers were incubated apically with assay buffer (122 mM sodium chloride, 2.9 mM potassium chloride, 1.9 mM calcium chloride, 2.5 mM magnesium sulfate, 25 mM sodium bicarbonate, 10 mM HEPES, 10 mM glucose and 0.4 mM dipotassium phosphate, pH 7.4) that contained 0.1 mM BSA, 0.1 mM [14C]ARA or [3H]ARA (2–10 lCi per dish). The basolateral medium consisted of only assay buffer with 0.1 mM BSA. In some experiments, 10 lM of indomethacin or NS-398 or celecoxib was added to the apical medium prior to incubation. In other experiments, cells were incubated with 0.1 mM ARA or 0.1 mM ARA + 10 lM celecoxib or 10 ng/mL PGE2. Incubation was carried out for up to 30 min. In other experiments, cells were incubated with 0.1 mM [1-14C]oleic acid bound to albumin (1 : 1 molar ratio) in the absence or presence of 0.1 mM ARA or 10 ng/

869

mL PGE2. In other experiments, confluent HBMEC monolayers were incubated apically with 0.1 mM [3H]ARA bound to albumin (1 : 1 molar ratio) in the absence or presence of the specific EP receptor anatgonists SC19220 (EP1), or PF04418948 (EP2), or SC2040478 (EP3), or CAY1058 (EP4). At the indicated times a 50 lL sample of basolateral medium was collected and radioactivity determined as described (Mitchell et al. 2009). An equivalent volume of basolateral medium was added to the basolateral chamber to replenish the removed medium. In some experiments, the apical medium was removed and [3H]PGE2 determined as previously described (Pestel et al. 2005). In some experiments fluorescein isothiocyanate-labeled dextran (FDX) (10 000 mw) at 10 lM concentration was added to determine paracellular diffusion. A 25 lL aliquot of basolateral medium was sampled and fluorescence was determined using a Biotek Synergy HT plate reader. Fluorescence was detected at Ex (k) 485 nm and Em (k) 528 nm. siRNA studies Transient transfection of HBMEC cells was done using the FastForward method for transfection of adherent cells as described in the HiPerFect reagent handbook (Qiagen). Briefly, cells were seeded at a density of 48 000 cells/cm2 in T25 flasks in 4 mL of fresh medium 85 000 cells/cm2 in 6-well inserts in 1.5 mL fresh medium or cells were seeded onto 100 mm dishes at a density of 3.0 9 106 cells/cm2 in 10 mL of fresh media. Cells were seeded 4–6 h prior to the addition of 5 nM siRNA complexes. The FATP-1 (Fatty acid transport protein-1) siRNA target sequence was 50 -CCGGCTGG TGAAGGTCAATGA. The FATP-1 siRNA target sequence was 50 CAGGAGGTGAACGTCTATGGA. The FATP-4 siRNA target sequence was 50 -CCGCTTCGATGGCTACCTCAA. The FABP-5 (Fatty acid binding protein-5) siRNA target sequence was 50 AGGAGTTAATTAAGAGAATGA. The CD36 siRNA target sequence was 50 -CAGAACCTATTGATGGATTAA. Complexes of 5 nM FATP-1, FATP-3, FATP-4, FABP-5 or CD36 siRNA were formed by mixing siRNA with HiPerFect Reagent (Qiagen) and incubating for 10 min at 23°C. Cells were incubated with these complexes at 37°C, 5.0% CO2 for 48 h. Mock-treated cells underwent the same transfection process but were incubated with only the HiPerFect reagent. Total RNA was isolated with trizol reagent (Gibco, Rockville, MD, USA) to monitor FATP-1, FATP-3, FATP-4, FABP-5 and CD36 gene silencing and measure the effectiveness of transfection. Mock & siRNA transfected HBMEC were cultured on Transwellâ plates and then incubated apically with 0.1 mM [14C]ARA bound to albumin in a 1 : 1 molar ratio for 20 or 30 min and radioactivity incorporated into the basolateral medium detected as described above. Gene expression analysis HBMEC monolayers were incubated for up to 30 min plus or minus 0.1 mM ARA bound to BSA (1 : 1 molar ratio) in assay buffer. Controls contained BSA alone. At the end of each incubation period, cells were harvested and total RNA extracted and isolated using the RNeasyâ Plus Mini kit (Qiagen). Measurement of gene expression by quantitative analysis was carried out using a Mastercycler ep Realplex system (Eppendorf, Mississauga, ON, Canada). Human primers were designed by the OligoPerfectTM Designer software and synthesized by Invitrogen. Quantitative realtime RT PCR was carried out for analysis of gene expression using


870

S. Dalvi et al.

Table 1 Human primers used for gene expression analysis

Gene

Forward 50 -30

Reverse 50 -30

mPGES cPGES EP1 EP2 EP3 EP4 18S COX-1 COX-2 PGT MRP4

GGARACGACATGGAGACCATC ARAGGAGARATCTGGCCAGTCA TTGTCGGTATCATGGTGGTG CCACCTCATTCTCCTGGCTA AGCTTATGGGGATCATGTGC GACCTGTTGGGCACTTTGTT ARAACGGCTACCACATCCARAG CTTTTCCCTCARAGGGTCTCC TGAGCATCTACGGTTTGCTG GTGGTGAACCAGGAGGAAAA CCATCTGTGCCATGTTTGTC

GGARAGACCAGGARAGTGCATC ATCCTCATCACCACCCATGT ATGTACACCCARAGGGTCCAG TTCCTTTCGGGARAGAGGTTT TTTCTGCTTCTCCGTGTGTG AGGTAGCGCTCGACACTCAT CCTCCARATGGATCCTCGTTA AGGGACAGGTCTTGGTGTTG TGCTTGTCTGGARACARACTGC AGGAGTGGTCAATGGTGAGG ACTGAAACATCCCCATGAGC

Quantitect Probe RT PCR SYBR Green kit (Qiagen). PCR amplification of the housekeeping gene 18S rRNA was carried out as a control for sample loading and to allow normalization among samples. The samples were heated in the thermal cycler for 15 min at 95°C for reverse transcription, followed by 40 cycles of denaturation at 95°C for 15 s, annealing at 60°C for 30 s and extension at 72°C for 30 s. Relative gene expression was determined as previously described with 18S rRNA as control and represented as fold-change compared to 18S rRNA (Saini-Chohan et al. 2011). Primers used for the analysis are shown in Table 1. PGE2 analysis HBMEC monolayers were incubated for 30 min with assay buffer containing 0.1 mM ARA bound to BSA (1 : 1). A 200 lL aliquot was removed from the medium at various times. An equal amount of medium (minus ARA) was added to replenish the medium. A quantitative ELISA was performed for measurement of PGE2 in the 200 lL aliquot drawn from the medium as described by the manufacturer. The colorimetric end-point readings were taken at 405 nm on the PowerWaveX reader (Bio-Tek Instruments, Inc., Winooski, VT, USA). In other experiments, an internal standard mix consisting of 7.5–25 ng of deuterated standard (see below) was added to the 200 lL aliquot of cell culture media, acidified to pH < 3.0 with 1 N HCl, and applied to Strata-X SPE columns (Phenomenex, Torrance, CA, USA) pre-conditioned with methanol and water (pH 3). After loading, columns were washed in 10% methanol in water (pH 3) and samples eluted with 100% methanol. Liquid chromatography tandem mass spectrometry (LC MS/MS) was performed as described (Deems et al. 2007). Dried down samples were re-suspended in water/ acetonitrile/formic acid (70 : 30 : 0.02, v/v/v, solvent A) and PGE2 separated by reverse-phase HPLC using a C18 column (Luna, 250 9 2.0 mm; Phenomenex) at a flow rate of 300 lL/min. The column was equilibrated in solvent A and samples were eluted with a linear gradient from 0 to 20% solvent B (acetonitrile/isopropyl alcohol, 50 : 50; v/v) for 11 min, then increased to 100% by 13 min and held until 16 min, then dropped to 0% by 16 min and held until 19 min. The HPLC was coupled to a triple quadrupole tandem mass spectrometer (API 2000) with electrospray ionization source (Applied Biosystems, Concord, ON, Canada). PGE2 analysis was via multiplereaction monitoring in negative-ionization mode. Mass transitions of deuterated standard and PGE2 were as follows: PGE2-d4 (m/z 355? 275) for PGE2 (m/z 351?271). Quantification of PGE2 was determined as described (Deems et al. 2007). In some experiments,

the mass transition of isoPGE2 was examined. In addition, the purity of ARA used in the experiments was examined. In other experiments, ARA was incubated for 5 min with buffer in the absence of cells and mass transition examined. Representative chromatographs are shown in Figure S1. Western blot analysis HBMECs monolayers were incubated for 30 min plus or minus 0.1 mM ARA bound to BSA (1 : 1 molar ratio) in assay buffer. Controls contained BSA alone in assay buffer. Cells were harvested using cold ristocetin-induced platelet agglutination buffer (sc-24948; Santa Cruz Biotechnology, Inc.) according to the manufacturer’s instructions. The cell lysate was then centrifuged at 10 000 g for 10 min at 4°C. The supernatant containing total cellular proteins was stored at 80°C until use. Protein concentration was determined by the detergent compatible Bradford protein assay (Bio-Rad Laboratories, Hercules, CA, USA). Then, samples were solubilized in a 5 : 1 ratio with 6X sodium dodecyl sulfate sample buffer and boiled at 70°C for 10 min. Equal amounts of proteins (40 lg/lane for EP1 and EP3 and 70 lg/lane for EP2 and EP4) were loaded and separated by electrophoresis on 12% sodium dodecyl sulfate– polyacrylamide gel electrophoresis gel. The proteins were then transferred onto a polyvinylidene difluoride transfer membrane (Immobilon, Millipore, Bedford, MA, USA). The presence of transferred proteins on the membrane was confirmed by staining with Ponceau S (Sigma Chemical Company). Membranes were blocked for 2 h at 23°C with either 3% BSA (EP1 and EP3) or 5% non-fat milk (EP2 and EP4) in 0.1% Tween 20/Tris-buffered saline (TBS-T). Thereafter, membranes were incubated overnight at 4°C in blocking buffers with rabbit primary antibodies against EP1 (1 : 2000 dilution; Abcam Inc.), EP2 (1 : 800 dilution; Santa Cruz Biotechnology, Inc.), EP3 (1 : 1000 dilution; Santa Cruz Biotechnology, Inc.) and EP4 (1 : 100 dilution; Santa Cruz Biotechnology, Inc.). Expression of either cyclophillin (178397; Abcam Inc.) (for EP1, EP2 and EP4) or GAPDH (glyceraldehyde 3-phosphate dehydrogenase) (for EP3) (9485; Abcam Inc.) was used as loading controls. After several washes with TBS-T, membranes were incubated with horseradish peroxidase-linked monkey anti-rabbit antibody (1 : 5000; GE Healthcare Life Sciences, Mississauga, ON, Canada) at 23°C for 1 h. Protein bands in the membranes were then visualized by enhanced chemiluminescence. The relative intensities of the bands were analyzed by ImageJ software (National Institutes of Health, Bethesda, MD, USA).


Other determinations Protein was determined by the method of Lowry et al. (1951). All data were expressed as mean or mean SD unless otherwise indicated. Comparisons between the basal and experimental conditions were done using the Student’s t-test. Comparisons among the different groups were evaluated by one-way ANOVA followed by the Tukey test for multiple comparisons of the means. The % flux of FDX in Fig. 3(a) was analyzed using ANOVA with Student– Newman–Keul post hoc comparison of the means. The level of significance was defined as p < 0.05.

dpm in basolateral medium


600 000

(a)

Mock FATP-1 CD36

400 000

*

200 000

0 5

10

Results

20

30


Time (min) (b)

2 000 000

Mock FATP-3

1 500 000

FATP-4 FABP5

1 000 000 500 000 0 5

10

20

Time (min) 60

(c)

50 40

ng/mL

We previously demonstrated that transport of selected fatty acids across HBMEC monolayers was mediated, at least in part, by fatty acid transport proteins (Mitchell et al. 2009, 2011). However, it was unknown what role that fatty acids themselves play in transport. To test this, we examined ARA movement across HBMECs grown as a confluent monolayer on Transwellâ polycarbonate membranes. HBMECs were incubated apically with 0.1 mM [14C]ARA bound to BSA (1 : 1 molar ratio) and the radioactivity incorporated into the basolateral medium determined. [14C]ARA was incorporated into the basolateral medium with time of incubation (Fig. 1a). Previously, we demonstrated that siRNA knockdown of FATP-1, CD36, FATP-3, FATP-4 or FABP-5 attenuated movement of selective fatty acids across HBMECs (Mitchell et al. 2011). HBMECs monolayers were then incubated with FATP-1 or CD36 siRNA and permeability of [14C]ARA determined as previously described (Mitchell et al. 2009, 2011)., Incubation of HBMEC with FATP-1 or CD36 siRNA resulted in a 41% and 30% reduction in FATP-1 and CD36 protein levels, respectively, compared to mock transfected cells (Mitchell et al. 2011) (data not shown). Surprisingly, siRNA knockdown of FATP1 and CD36 did not alter [14C]ARA movement across HBMECs (Fig. 1a). HBMECs monolayers were then incubated with FATP-3 or FATP-4 or FABP-5 siRNA and permeability of [14C]ARA determined as described (Mitchell et al. 2011). Incubation of HBMEC with FATP-4 or FATP-5 siRNA resulted in a 39% and 32% decrease in FATP-4 and FABP-5 protein levels, respectively, compared to mock transfected cells (Mitchell et al. 2011) (data not shown). In addition, knockdown of FATP-3, FATP-4 and FABP-5 did not alter [14C]ARA movement across HBMECs (Fig. 1b). These data suggested that ARA movement across HBMECs might not involve fatty acid transport proteins. It was previously shown that the ARA metabolite PGE2 causes opening of the BBB (Jaworowicz et al. 1998; Mark et al. 2001; Turini and Dubois 2002). HBMEC were then incubated apically with 0.1 mM [14C]ARA bound to BSA (1 : 1 molar ratio) as above and formation of [14C]PGE2 determined after 10 min in the apical medium. We observed significant production of [14C]PGE2 (223 34 dpm/mg

871

30 20 10 0

0

2

5

10

30

Time (min) Fig. 1 [14C]ARA permeability across human brain microvascular endothelial cells (HBMEC) with fatty acid transport protein knockdown and PGE2 generation in arachidonic acid (ARA) incubated HBMEC. HBMEC were mock transfected (Mock) or transfected with FATP-1 or FATP-3 or FATP-4 or FABP-5 or CD36 siRNA for 48 h as described in Materials and methods. HBMEC were then incubated apically with 0.1 mM [1-14C]ARA bound to albumin (1 : 1 molar ratio) for up to 30 min (a) or 20 min (b) and radioactivity incorporated into the basolateral medium determined as described in Materials and methods. Data represents the mean SD of three experiments. (c) HBMEC were incubated with 0.1 mM ARA bound to albumin (1 : 1 molar ratio) for up to 30 min and PGE2 levels in the basolateral medium were determined as described in Materials and methods (Data represents the mean SD of three experiments).


S. Dalvi et al.

872

protein) indicating that PGE2 may be generated by HBMEC incubated with [14C]ARA. We examined if incubation of HBMEC with ARA resulted in mass production of PGE2. HBMEC were incubated apically with 0.1 mM ARA bound to BSA (1 : 1 molar ratio) and formation of PGE2 determined by ELISA. Within 2 min approximately 14 ng/ mL of PGE2 was generated. This rapid generation of PGE2 was confirmed by a more sensitive mass spectrometry analysis. LC MS/MS analysis indicated that generation of PGE2 occurred rapidly by 2 min and peaked by 5 min followed by a drop in PGE2 level (Fig. 1c). Cyclooxygenase (COX) enzymes and prostaglandin E2 synthase (PGES) are required for the generation of PGE2. We examined if HBMEC expressed enzymes for synthesis of PGE2. HBMEC were incubated apically with 0.1 mM ARA bound to BSA (1 : 1 molar ratio) for up to 30 min and total RNA isolated and COX-1, COX-2, mPGES and cPGES mRNA expression determined. HBMEC exhibited mRNA expression of COX-1, COX-2, mPGES and cPGES and incubation of cells with ARA did not significantly alter the mRNA expression of these genes (Fig. 2a–d). The above data indicate that HBMECs have the ability to generate PGE2 COX-1

(a)

and that ARA incubation of these cells likely resulted in PGE2 synthesis mediated through COX enzymes and PGES. We examined if PGE2 directly increased HBMEC permeability and if inhibition of PGE2 synthesis could attenuate the ARA-mediated increase in HBMEC permeability. HBMECs were incubated in the absence or presence of 0.1 mM ARA bound to albumin (1 : 1 molar ratio), or ARA plus the specific COX-2 inhibitor celecoxib (10 lM) or PGE2 (10 ng/ mL) for up to 120 min and FDX movement across HBMEC determined. Addition of exogenous PGE2 alone resulted in increased FDX movement across HBMEC monolayers (Fig. 3a). Thus, ARA increased FDX movement across HBMEC monolayers and this was attenuated by addition of celecoxib. We examined [3H]ARA permeability in HBMEC incubated with COX inhibitors. HBMEC were incubated apically with 0.1 mM [3H]ARA bound to BSA (1 : 1 molar ratio) for up to 20 min in the absence or presence of the non-specific COX inhibitor indomethacin or NS-398 or celecoxib and [3H]ARA incorporated into the basolateral medium determined. The non-specific COX inhibitor indomethacin

Relative gene expression


1 0.8 0.6 0.4 0.2 0 0

2

5

COX-2

(b)

1.2

10

20

30

1.4 1.2 1 0.8 0.6 0.4 0.2 0 0

2

Time (min)

mPGES

1.4

10

20

30

Time (min)

cPGES

(d) 1.4

1.2



(c)

5

1 0.8 0.6 0.4 0.2 0 0

2

5

10

20

30

1.2 1 0.8 0.6 0.4 0.2 0 0

2

5

10

20

30

Time (min)

Time (min) Fig. 2 Cycloxygenase (COX)-1,-2, mPGES and cPGS mRNA expression in human brain microvascular endothelial cells (HBMEC). HBMEC were incubated with 0.1 mM arachidonic acid (ARA) bound to bovine serum albumin (BSA) (1 : 1 molar ratio) for up to 30 min

and total RNA was isolated and expression of COX-1 (a), COX-2 (b), mPGES (c) and cPGES (d) determined as described in Materials and methods. Data represents the mean SD of three experiments.



inhibited [3H]ARA incorporated into the basolateral medium by approximately 50% within 2 min of incubation, but this did not persist beyond 5 min of incubation (Fig. 3b). The presence of the specific COX-2 inhibitors NS-398 and celecoxib markedly and rapidly reduced [3H]ARA incorporated into the basolateral medium within 2 min and the reduction in [3H]ARA incorporation persisted for up to

20 min of incubation. We examined if exogenous ARA or PGE2 addition to HBMEC affected oleic acid permeability across HBMEC. HBMEC were incubated apically with 0.1 mM [1-14C]oleic acid bound to BSA (1 : 1 molar ratio) for up to 30 min in the absence or presence of 0.1 mM ARA or 10 ng/mL PGE2 and radioactivity incorporated into the basolateral medium determined. The presence of either ARA

* #

* #

* #

* #

* #

* #

(a)

(b)


***

**

** ** Time (min)

(c)


Fig. 3 Arachidonic acid (ARA) increases human brain microvascular endothelial cells (HBMEC) monolayer permeability and [3H]ARA permeability is attenuated by cycloxygenase (COX) inhibition and PGE2 increases oleate permeability. (a) HBMECs were incubated with 0.1 mM ARA bound to albumin (1 : 1 molar ratio) and FDX in the absence or presence of the specific COX-2 inhibitors NS-398 or celecoxib and FDX incorporation into the basolateral medium determined as described in Materials and methods. Values represent the mean SEM of three experiments per treatment group. *p < 0.05 compared to control; #p < 0.05, ARA or PGE2 compared to ARA+Celecoxib. (b) HBMEC were incubated apically with 0.1 mM [3H] ARA bound to bovine serum albumin (BSA) (1 : 1 molar ratio) for up to 30 min in the absence or presence of indomethacin or NS-398 or celecoxib and [3H]ARA incorporated into the basolateral medium determined. (c) HBMECs were incubated with 0.1 mM [1-14C]oleic acid bound to albumin (1 : 1 molar ratio) in the absence or presence of 0.1 mM ARA or 10 ng/mL PGE2 and radioactivity incorporated into the basolateral medium determined. Data represents the mean SD of three experiments. *p < 0.05.

873

60 000

*

Oleate +AA

*

+PGE2

40 000

20 000

*

0

5


10

20

Time (min)

30

874

S. Dalvi et al.

or PGE2 increased incorporation of [1-14C]oleic acid into the basolateral medium by 30 min of incubation (Fig. 3c). The above studies confirmed that exogenous ARA increases permeability across HBMEC and this was as a result of the action of PGE2. The action of PGE2 is mediated by PGE2 receptors. We examined if HBMEC expressed PGE2 receptors and if the levels of PGE2 receptors were altered by incubation with ARA. HBMEC were incubated apically with 0.1 mM ARA bound to BSA (1 : 1 molar ratio) for up to 30 min and total RNA isolated and expression of EP1, EP2, EP3, and EP4 receptors determined. HBMEC exhibited the presence of all four PGE2 receptors (Fig. 4a and b). Western blot analysis confirmed the presence of EP1, EP2, EP3, EP4 receptors in HBMEC (Fig. 5a and b). Incubation of HBMEC for 30 min with ARA did not alter the protein expression of EP2 (~ 71 kDa), EP3 (~ 78 kDa) and EP4 (~ 53 kDa) but surprisingly increased the protein expression of the EP1 receptor (~ 38 kDa) by approximately 30%. The above data suggested that the ARA-mediated effect on membrane permeability might be mediated through PGE2 receptors. We examined if EP receptor activation was indeed responsible for ARA permeability across HBMECs.

EP1

The objective of this study was to examine the role of ARA on the permeability of HBMEC monolayers. The behavior of HBMECs in culture indicates that they retain many properties important to the formation of the BBB (Goldstein and Betz 1983; Dorovini-Zis et al. 1987). Confluent HBMECs on Transwellâ inserts have been used as a model for the study of in vitro BBB transport (Miller et al. 1992; Cecchelli

EP2

(b)

1.4

1.4 1.2 1 0.8 0.6 0.4 0.2 0

1.2 1 0.8 0.6 0.4 0.2 0

0

2

5

10

20

30

EP3

0

1.2 1 0.8 0.6 0.4 0.2 0 0

2

5

2

5

10

20

30

Fig. 4 Human brain microvascular endothelial cells (HBMEC) express EP1–4 receptors. HBMECs were incubated in the absence or presence of 0.1 mM arachidonic acid (ARA) bound to albumin (1 : 1 molar ratio) for up to 30 min. Total RNA was isolated and

10

20

30

EP4

(d)


(c)


Discussion



(a)

HBMEC monolayers were incubated apically with 0.1 mM [3H]ARA bound to BSA (1 : 1 molar ratio) for 60 min in the absence or presence of specific EP receptor antagonists and radioactivity incorporated into the basolateral medium determined. The specific EP3 and EP4 receptor antagonists, L-798,106 and CAY1058, respectively, attenuated [3H]ARA movement across HBMEC (Fig. 5c). Addition of EP1 or EP2 receptor antagonists, sc19220 or PF04418948, did not alter [3H]ARA movement across the monolayer. In summary, our results indicate that ARA increases permeability of the HBMEC monolayer, in part, via increased production of PGE2, which acts upon EP3 and EP4 receptors to mediate the increase in permeability.

3 2.5 2 1.5 1 0.5 0 0

2

5

10

20

30

mRNA expression of EP1 (a), EP2 (b), EP3 (c), EP4 (d) receptors determined as described in Materials and methods. Data represents the mean SD of three experiments.



et al. 1999; Gumbleton and Audus 2001). Previously we demonstrated that the transport of various fatty acids across confluent HBMEC monolayers was, in part, mediated by fatty acid transport proteins (Mitchell et al. 2009, 2011). To directly assess ARA permeability across this in vitro BBB, we incubated HBMEC apically with radiolabeled ARA and examined radioactivity incorporated into the basolateral medium in cells in which FATP-1, CD36, FATP-3, FATP4, FABP-5 were knocked down using siRNA. In contrast to what we had previously reported for other long chain fatty acids, knock down of these fatty acid transport proteins did not alter ARA permeability. Incubation of HBMEC with ARA appeared to increase permeability of the HBMEC monolayer as indicated by an increased flux of FDX into the basolateral medium. Thus, ARA appeared to readily increase its own paracellular permeability across the HBMEC monolayer.

(a)

Control

+ARA

875

ARA is a precursor for the formation of various bioactive molecules, including PGE2. Increase in the permeability of the BBB mediated by PGE2 is well documented (de Vries et al. 1996; Jaworowicz et al. 1998; Stanimirovic and Satoh 2000; Mark et al. 2001). We postulated that the increase in HBMEC monolayer permeability caused by ARA could be because of the production of PGE2. COX enzymes catalyze the formation of PGE2 from ARA. HBMECs exhibited expression of COX enzymes and PGE2 synthase and incubation with ARA resulted in rapid generation of PGE2. Thus, HBMEC have the ability to generate PGE2 from ARA. We observed significant formation of radioactive PGE2 in HBMECs incubated with radioactive ARA. In addition, significant PGE2 mass, as assessed by both ELISA and LC MS/MS analysis, was generated within 2 min of incubation of HBMECs with ARA and this correlated with increased permeability of HBMECs as measured by increased flux of

(b)

EP1-38 kDa

*

EP2-71 kDa

EP3-78 kDa

EP4-53 kDa

(c)

Fig. 5 Arachidonic acid (ARA) increases EP1 protein levels and EP3 and EP4 receptor antagonists attenuate ARA-mediated human brain microvascular endothelial cells (HBMEC) monolayer permeability. HBMECs were incubated in the absence or presence of 0.1 mM ARA bound to albumin (1 : 1 molar ratio) for 30 min. (a) Cells lysates were prepared and protein expression of PGE2 receptor subtype proteins (EP1–4) analyzed by western blot analysis. EP receptors molecular mass are indicated on left with cyclophilin-loading control shown below.

Representative blots are depicted. (b) Relative expression of EP receptor subtypes. (c) HBMEC were incubated apically with 0.1 mM [3H]ARA (ARA) bound to albumin (1 : 1 molar ratio) for 60 min in the absence (1) or presence of the specific EP receptor antagonists sc19220 (2), PF04418948 (3), L798,106 (4). or CẠY10598 (5), EP1–4 antagonists, respectively, and radioactivity incorporated into the basolateral medium determined as described in Materials and methods. Data represents the mean SEM of three experiments. *p < 0.05.


S. Dalvi et al.

876


(a)

1.4 1.2 1 0.8 0.6 0.4 0.2 0 0

2

5

10

20

30

20

30

Time (min) Relative gene expression

(b)

1.2 1 0.8 0.6 0.4 0.2 0 0

2

5

10

Time (min) Fig. 6 Human brain microvascular endothelial cells (HBMEC) express MRP4 and prostaglandin transporter (PGT). HBMEC were incubated for up to 30 min plus or minus 0.1 mM arachidonic acid (ARA) bound to bovine serum albumin (BSA) (1 : 1 molar ratio). Total RNA was isolated and MRP4 and PGT mRNA expression determined as described in Materials and methods. (a) MRP4. (b) PGT. Data represents the mean SD of three experiments.

FDX and increased permeability of oleic acid. The rapid generation of PGE2 was observed within 2 min of ARA incubation, peaked by 5 min and gradually decreased for the remainder of the 30 min incubation. This gradual reduction in PGE2 was likely mediated by metabolism of PGE2. Indeed, HBMECs expressed both MRP4 which extrudes PGE2 as well as prostaglandin transporter which has a high affinity for PGE2 and is responsible for its uptake and metabolism (Fig. 6). The above data indicated that exogenous ARA addition to HBMEC monolayers leads to an immediate, marked increase in the production of PGE2 and this likely facilitates permeability of the monolayer. Non-steroidal anti-inflammatory drugs work by inhibiting COX, leading to a decrease in the production of inflammatory prostaglandins. COX exists in two main isoforms, COX-1 and COX-2. COX-1 is expressed constitutively whereas COX-2 is highly inducible and is expressed during inflammatory and neoplastic states (Jaworowicz et al. 1998; Engblom et al. 2002; Turini and Dubois 2002). Both nonspecific COX inhibitors such as indomethacin and COX-2

specific inhibitors, including celecoxib have shown promise in the treatment of most forms of brain injury, most likely through their effect on PGE2 production (Dubois et al. 1998; Turini and Dubois 2002). In the present study, indomethacin incubation resulted in a 50% reduction in radioactive ARA movement across the HBMEC monolayer. Interestingly, the specific COX-2 inhibitors celecoxib and NS-398 also markedly reduced radioactive ARA movement across the HBMEC monolayer. It has been suggested that COX-1 is responsible for the immediate biosynthesis of prostaglandins, whereas the effect of COX-2 on prostaglandin production is delayed and lasts several hours (Kudo and Murakami 2005). Although inducible, it should be noted constitutive expression of low levels of COX-2 in bovine brain microvessel endothelial cells has been reported (Mark et al. 2001). In the present study, we observed an immediate decrease in ARA-mediated FDX permeability of the HBMEC monolayer in the presence of the specific COX-2 inhibitors, suggesting that COX-2 may also have an immediate effect on PGE2 production in these cells. In addition, the reduction in FDX permeability observed with celecoxib and NS-398 was much greater than that observed with indomethacin. Thus, the majority of the ARA-mediated permeability of HBMECs is likely mediated by COX-2 generation of PGE2. PGE2 is known to exert its effects by binding to G proteincoupled seven-transmembrane spanning receptors located in the plasma membrane and nuclear membrane (Bhattacharya et al. 1998; Funk 2001). Four subtypes of specific PGE2 receptors exist; EP1–4 (Dubois et al. 1998; McCoy et al. 2002; Hata and Breyer 2004). HBMECs expressed all four subtypes of PGE2 receptors and the level of EP2–4 mRNA expression remained relatively constant with ARA incubation. Surprisingly, EP1 receptor protein levels were increased by approximately 30% after 30 min incubation with ARA. The remarkably rapid protein induction mediated by ARA is not uncommon; a 2 h incubation with ARA was shown to rapidly increase COX-2 protein expression by almost 2.5fold in a PC3 human prostate cancer cell line (HughesFulford et al. 2006). In addition, high levels of COX-2 results in an increase in EP1 expression because of posttranscriptional interaction between COX-2 and the receptor (Sood et al. 2014). These observations are in agreement with the results of our study as the increase in EP1 receptor was only observed at the translational level. PGE2 was previously shown to be responsible for opening of the BBB (Mark et al. 2001). We anticipated that ARA may have mediated the increase in HBMEC monolayer permeability via PGE2 action on its receptors. EP1 is known to be a contractile type of receptor (Coleman et al. 1994). Activation of EP1 receptor lead to activation of the G-protein Gq that resulted in an increase in intracellular Ca+2 necessary for cellular contraction (Coleman et al. 1994; Bos et al. 2004). EP2 is considered a relaxant receptor and leads to



downstream effects via stimulation of Gs and increased cAMP production. EP3 is an inhibitory receptor and leads to decreases in intracellular cAMP as a result of coupling with Gi (Funk 2001). EP4 is a versatile and unique receptor in that in contrast to the traditional view of it being ‘another EP2 receptor’, recent evidence suggested that it could also be coupled to the inhibitory G protein (Gi) (Yokoyama et al. 2013). ARA and PGE2-mediated EP4 receptor activation resulted in vasoconstriction of rat intrapulmonary arteries (Yan et al., 2013). In addition, EP1 and EP3 receptors were reported to be responsible for the PGE2-mediated constriction of porcine cerebral vessels (Jadhav et al. 2004). In rats with a leaky BBB caused by ischemic insult, EP1 receptor antagonist was shown to be effective in reducing BBB leakage (Fukumoto et al. 2010). The mechanism was suggested to be the ability of EP1 receptor antagonist to decrease src activation, a pathway that normally would lead to tyrosine phosphorylation of the endothelial junctional proteins that may weaken the tight junctions (Fukumoto et al. 2010). In our study, only EP3 and EP4 receptor antagonists attenuated [3H]ARA movement across HBMEC monolayers. The differences between the above studies in which EP1 activation mediates vessel constriction and our study may be related to time of incubation with prostaglandins, the model system used, tissue and species differences (Bhattacharya et al. 1998; Dumont et al. 1998), and the membrane versus perinuclear localization of certain EP receptor subtypes (Bhattacharya et al. 1998). Furthermore, PGE2 is known to have opposing actions depending on its interaction with different EP receptor subtypes that are coupled to different signal transduction pathways (Li et al. 1994; Negishi et al. 1995) and HBMECs expressed all four receptors. We examined the purity of the ARA used in this study and as expected no metabolites were observed in the commercial ARA (Fig. S1a). However, incubation of ARA in buffer alone for 5 min at 37°C resulted in a small amount (4.8 ng/ mL) of PGE2/isoPGE2 generated (Fig. S1b). This level was approximately 10% of what was observed when HBMECs were incubated with ARA (47.1 ng/mL) (Fig. S1c, S1d). Since isoPGE2 and PGE2 have the same parent/product ions and chromatograph very closely together, it is possible, that in addition to PGE2, isoPGE2 could be at least partially responsible for the observed increase in permeability of HBMECs. In summary, our data indicate that ARA increases the permeability of HBMEC monolayers via increased production of PGE2 (and possibly isoPGE2), a compound that is documented to facilitate opening of the BBB through activation of the EP3 and EP4 receptors. Our observations in HBMECs may, in part, explain why there is such a rapid influx of ARA into the brain upon plasma infusion with ARA as previously reported (Rapoport et al. 2001; Duncan and Bazinet 2010), and extends the observation that the uptake of

877

ARA may be mediated, in part, by its consumption (Basselin et al. 2012). Such consumption might be driven by both neurons and astrocytes.

Acknowledgments and conflict of interest disclosure The authors wish to thank Joy Gauthier for technical assistance. This work was supported by CIHR, HSFC, NSERC grants (to H.M.A, D.W.M. and G.M.H). R.W.M. was the recipient of an MHRC studentship. S.D. and H.N. are the recipients of GETS stipends from the University of Manitoba. G.M.H. is a Canada Research Chair in Molecular Cardiolipin Metabolism. The authors have no conflicts of interest to declare. All experiments were conducted in compliance with the ARRIVE guidelines.

Supporting information Additional supporting information may be found in the online version of this article at the publisher's web-site: Figure S1. LC MS/MS chromatogram of ARA and HBMEC treated with ARA.

References Abbott N. J., Ronnback L. and Hansson E. (2006) Astrocyte-endothelial interactions at the blood–brain barrier. Nat. Rev. Neurosci. 7, 41– 53. Balabanov R. and Dore-Duffy P. (1998) Role of the CNS microvascular pericyte in the blood-brain barrier. J. Neurosci. Res. 53, 637–644. Ballabh P., Braun A. and Nedergard M. (2004) The blood-brain barrier: an overview: structure, regulation and clinical implications. Neurobiol. Dis. 16, 1–13. Basselin M., Ramadan E. and Rappoport S. I. (2012) Imaging brain signal transduction and metabolism via arachidonic and docosahexaenoic acid in animals and humans. Brain Res. Bull. 87, 154–171. Bhattacharya M., Peri K. G., Almazan G., Ribeiro-da-Silva A., Shichi H., Durocher Y., Abramovitz M., Hou X., Varma D. R. and Chemtob S. (1998) Nuclear localization of prostaglandin E2 receptors. Proc. Natl Acad. Sci. USA 95, 15792–15797. Bos C. L., Richel D. J., Ritsema T., Peppelenbosch M. P. and Versteeg H. H. (2004) Prostanoids and prostanoid receptors in signal transduction. Int. J. Biochem. Cell Biol. 36, 1187–1205. Bosetti F. (2007) Arachidonic acid metabolism in brain physiology and pathology: lessons from genetically altered mouse models. J. Neurochem. 102, 577–586. Cecchelli R., Dehouck B., Descamps L., Fenart L., Buee-Scherrer V., Duhem C., Lundquist S., Rentfel M., Torpier G. and Dehouck M. P. (1999) In vitro model for evaluating drug transport across the blood-brain barrier. Adv. Drug Deliv. Rev. 36, 165–178. Chan P. H., Fishman R. A., Caronna J., Schmidley J. W., Prioleau G. and Lee J. (1983) Induction of brain edema following intracerebral injection of arachidonic acid. Ann. Neurol. 13, 625–632. Chan P. H., Fishman R. A., Longar S., Chen S. and Yu A. (1985) Cellular and molecular effects of polyunsaturated fatty acids in brain ischemia and injury. Prog. Brain Res. 63, 227–236.


878

S. Dalvi et al.

Coleman R. A., Smith W. L. and Narumiya S. (1994) International Union of Pharmacology classification of prostanoid receptors: properties, distribution, and structure of the receptors and their subtypes. Pharmacol. Rev. 46(2), 205–229. Dalvi S., On N., Nguyen H., Pogorzelec M., Miller D. W. and Hatch G. M. (2014) The blood brain barrier: regulation of fatty acid and drug transport, in Neurochemistry, (Heinbockel T., ed.), pp. 1–58. InTech Publishing Co., Rijeka, Croatia. Deems R., Buczynski M. W., Bowers-Gentry R., Harkewicz R. and Dennis E. A. (2007) Detection and quantitation of eicosanoids via high performance liquid chromatography-electrospray ionizationmass spectrometry. Methods Enzymol. 432, 59–82. Dorovini-Zis K., Bowman P. D., Betz A. L. and Goldstein G. W. (1987) Formation of a barrier by brain microvessel endothelial cells in culture. Fed. Proc. 46, 2521–2522. Dubois R. N., Abramson S. B., Crofford L., Gupta R. A., Simon L. S., van de Putte L. B. A. and Lipsky P. E. (1998) Cyclooxygenase in biology and disease. FASEB J. 12, 1063–1073. Dumont I., Peri K. G., Hardy P., Hou X., Martinez-Bermudez A. K., Molotchnikoff S., Varma D. R. and Chemtob S. (1998) PGE2, via EP3 receptors, regulates brain nitric oxide synthase in the perinatal period. Am. J. Physiol. 275, R1812–R1821. Duncan R. E. and Bazinet R. P. (2010) Brain arachidonic acid uptake and turnover: implications for signalling and bipolar disorder. Curr. Opin. Clin. Nutr. Metab. Care 13, 130–138. Engblom D., Ek M., Saha S., Ericsson-Dahlstrand A., Jakobsson P. and Blomqvist A. (2002) Prostaglandins as inflammatory messengers across the blood-brain barrier. J. Mol. Med. 80, 5–15. Fukumoto K., Takagi N., Yamamoto R., Moriyama Y., Takeo S. and Tanonaka K. (2010) Prostanoid EP1 receptor antagonist reduces blood-brain barrier leakage after cerebral ischemia. Eur. J. Pharmacol. 640(1–3), 82–86. Funk C. D. (2001) Prostaglandins and leukotrienes: advances in eicosanoid biology. Science 294, 1871–1875. Gloor S. M., Wachtel M., Bolliger M. F., Ishihara H., Landmann R. and Frei K. (2001) Molecular and cellular permeability control at the blood-brain barrier. Brain Res. Rev. 36, 258–264. Goldstein G. W. and Betz A. L. (1983) Recent advances in understanding brain capillary function. Ann. Neurol. 14, 389–395. Gumbleton M. and Audus K. L. (2001) Progress and limitations in the use of in vitro cell cultures to serve as a permeability screen for the blood-brain barrier. J. Pharm. Sci. 90, 1681–1698. Hamilton J. A. (2007) New insights into the roles of proteins and lipids in membrane transport of fatty acids. Prostaglandins Leukot. Essent. Fatty Acids 77, 355–361. Hata A. N. and Breyer R. M. (2004) Pharmacology and signaling of prostaglandin receptors: multiple roles in inflammation and immune modulation. Pharmacol. Ther. 103, 147–166. Hawkins B. T. and Davis T. P. (2005) The blood-brain barrier/ neurovascular unit in health and disease. Pharmacol. Rev. 57, 173–185. Huber J. D., Egleton R. D. and Davis T. P. (2001) Molecular physiology and pathophysiology of tight junctions in the blood-brain barrier. Trends Neurosci. 24, 719–725. Hughes-Fulford M., Li C. F., Boonyaratanakornkit J. and Sayyah S. (2006) Arachidonic acid activates phosphatidylinositol 3-kinase signaling and induces gene expression in prostate cancer. Cancer Res. 66(3), 1427–1433. Jadhav V., Jabre A., Lin S. Z. and Lee T. J. (2004) EP1- and EP3-receptors mediate prostaglandin E2-induced constriction of porcine large cerebral arteries. J. Cereb. Blood Flow Metab. 24, 1305–1316. Jaworowicz D. J., Korytko P. J., Lakhman S. S. and Boje K. M. K. (1998) Nitric oxide and prostaglandin E2 formation parallels

blood-brain barrier disruption in an experimental rat model of bacterial meningitis. Brain Res. Bull. 46, 541–546. Katsuki H. and Okuda S. (1995) Arachidonic acid as a neurotoxic and neurotrophic substance. Prog. Neurobiol. 46, 607–636. Kokoglu E., Tuter Y., Sandikci K. S., Yazici Z., Ulakoglu E. Z., Sonmez H. and Ozyurt E. (1998) Prostaglandin E2 levels in human brain tumor tissues and arachidonic acid levels in the plasma membrane of human brain tumors. Cancer Lett. 132, 17–21. Kudo I. and Murakami M. (2005) Prostaglandin E synthase, a terminal enzyme for prostaglandin E2 biosynthesis. J. Biochem. Mol. Biol. 38, 633–638. Li D. Y., Varma D. R. and Chemtob S. (1994) Ontogenic increase in PGE2 and PGF2a receptor density in brain microvessels of pigs. Br. J. Pharmacol. 112, 59–64. Lowry O. H., Rosebrough N. J., Farr A. L. and Randall R. J. (1951) Protein measurement with the Folin phenol reagent. J. Biol. Chem. 193, 265–275. Mark K. S., Trickler W. J. and Miller D. W. (2001) Tumor necrosis factor-alpha induces cyclooxygenase-2 expression and prostaglandin release in brain microvessel endothelial cells. J. Pharmacol. Exp. Ther. 297, 1051–1058. McCoy J. M., Wicks J. R. and Audoly L. P. (2002) The role of prostaglandin E2 receptors in the pathogenesis of rheumatoid arthritis. J. Clin. Invest. 110, 651–658. Miller D. W., Audus K. L. and Borchardt R. T. (1992) Application of cultured endothelial cells of the brain microvasculature in the study of the blood-brain barrier. J. Tiss. Cult. Method 14, 217–224. Mitchell R. W. and Hatch G. M. (2011) Fatty acid transport into the brain: of fatty acid fables and lipid tails. Prostaglandins Leukot. Essent. Fatty Acids 85, 293–302. Mitchell R. W., Edmundson C. L., Miller D. W. and Hatch G. M. (2009) On the mechanism of oleate transport across human microvessel endothelial cells. J. Neurochem. 110, 1049–1057. Mitchell R. W., On N. H., Del Bigio M. R., Miller D. W. and Hatch G. M. (2011) Fatty acid transport protein expression in human brain and potential role in fatty acid transport across human brain microvessel endothelial cells. J. Neurochem. 117, 735–746. Moore S. A., Yoder E., Murphy S., Dutton G. R. and Spector A. A. (1991) Astrocytes, not neurons, produce docosahexaenoic acid (22:6x-3) and arachidonic acid (20:4x-6). J. Neurochem. 56, 518– 524. Needleman P., Turk J., Jakschik B. A., Morrison A. R. and Lefkowith J. B. (1986) Arachidonic acid metabolism. Annu. Rev. Biochem. 55, 69–102. Negishi M., Sugimoto Y. and Ichikawa A. (1995) Prostaglandin E receptors. J. Lipid Mediat. Cell Signal. 12, 379–391. Pestel S., Jungermann K. and Scheiferdecker H. L. (2005) Re-evaluation of thin layer chromatography as an alternative method for the quantification of prostaglandins from rat Kupffer cells. Prostaglandins Other Lipid Mediat. 75, 123–139. Rapoport S. I. (2008) Arachidonic acid and the brain. J. Nutr. 138, 2515–2520. Rapoport S. I., Chang M. C. J. and Spector A. A. (2001) Delivery and turnover of plasma-derived essential PUFAs in mammalian brain. J. Lipid Res. 42, 678–685. Rubin L. L., Hall D. E., Porter S. et al. (1991) A cell culture model of the blood-brain barrier. J. Cell Biol. 115, 1725–1735. Saini-Chohan H. K., Dakshinamurti S., Taylor W. A., Shen G. X., Murphy R., Sparagna G. C. and Hatch G. M. (2011) Persistent pulmonary hypertension results in reduced tetralinoleoylcardiolipin and mitochondrial complex II + III during the development of right ventricular hypertrophy in the



neonatal pig heart. Am. J. Physiol. Heart Circ. Physiol. 301, H1415–H1424. Sood R., Flint-Ashtamker G., Borenstein D. and Barki-Harrington L. (2014) Upregulation of prostaglandin receptor EP1 expression involves its association with cyclooxygenase-2. PLoS ONE 9(3), e91018. Stanimirovic D. and Satoh K. (2000) Inflammatory mediators of cerebral endothelium: a role in ischemic brain inflammation. Brain Pathol. 10, 113–126. Turini M. E. and Dubois R. N. (2002) Cyclooxygenase-2: a therapeutic target. Annu. Rev. Med. 53, 35–57. de Vries H. E., Blom-Roosemalen M. C. M., de Boer A. G., van Berkel T. J. C., Breimer D. D. and Kuiper J. (1996) Effect of endotoxin on

879

permeability of bovine cerebral endothelial cell layers in vitro. J. Pharmacol. Exp. Ther. 277, 1418–1423. Williams J. R., Leaver H. A., Ironside J. W., Miller E. P., Whittle I. R. and Gregor A. (1998) Apoptosis in human primary brain tumours: actions of arachidonic acid. Prostaglandins Leukot. Essent. Fatty Acids 58, 193–200. Yan G., Wang Q., Shi H., Han Y., Ma G., Tang C. and Gu Y. (2013) Regulation of rat intrapulmonary arterial tone by arachidonic acid and prostaglandin E2 during hypoxia. PLoS ONE. 8, e73839. Yokoyama U., Iwatsubo K., Umemura M., Fujita T. and Ishikawa Y. (2013) The prostanoid EP4 receptor and its signaling pathway. Pharmacol. Rev. 65, 1010–1052.


Prostaglandin E2 prevents hyperosmolar-induced human mast cell activation through prostanoid receptors EP2 and EP4.

Opposing effects of prostaglandin E2 receptors EP3 and EP4 on mouse and human β-cell survival and proliferation.

Prostaglandin E2 Inhibits NLRP3 Inflammasome Activation through EP4 Receptor and Intracellular Cyclic AMP in Human Macrophages.

Prostaglandin E2 promotes human CD34+ cells homing through EP2 and EP4 in vitro.

Prostaglandin I2 and prostaglandin E2 modulate human intrarenal artery contractility through prostaglandin E2-EP4, prostacyclin-IP, and thromboxane A2-TP receptors.

Potentiation of bradykinin-induced vascular permeability increase by prostaglandin E2 and arachidonic acid in rabbit skin.

EP4 receptors.

Mechanism of prostaglandin E2-induced arachidonic acid release in osteoblast-like cells: independence from phosphoinositide hydrolysis.

Prostaglandin E2-induced arachidonic acid release and catecholamine secretion from cultured bovine adrenal chromaffin cells.

Activation of prostaglandin E2-EP4 signaling reduces chemokine production in adipose tissue.

Prostaglandin E2 EP4 Receptor Activation Attenuates Neuroinflammation and Early Brain Injury Induced by Subarachnoid Hemorrhage in Rats.

Prostaglandin E2 and vascular endothelial growth factor A mediate angiogenesis of human ovarian follicular endothelial cells.

Prostaglandin E2 Reduces Cardiac Contractility via EP3 Receptor.

EP4 receptors in human amnion fibroblasts: Implications for parturition.

The Prostaglandin E2-EP3 Receptor Axis Regulates Anaplasma phagocytophilum-Mediated NLRC4 Inflammasome Activation.

Increased concentrations of nonesterified arachidonic acid, 12L-hydroxy-5,8,10,14-eicosatetraenoic acid, prostaglandin E2, and prostaglandin F2alpha in epidermis of psoriasis.

Prostaglandin E2-EP3 signaling induces inflammatory swelling by mast cell activation.

Rostral Ventrolateral Medulla EP3 Receptor Mediates the Sympathoexcitatory and Pressor Effects of Prostaglandin E2 in Conscious Rats.

Paricalcitol attenuates lipopolysaccharide-induced inflammation and apoptosis in proximal tubular cells through the prostaglandin E2 receptor EP4.

Prostaglandin E2 facilitates subcellular translocation of the EP4 receptor in neuroectodermal NE-4C stem cells.

Characterization of atrial natriuretic peptide receptors in brain microvessel endothelial cells.

Therapeutic effects of human gingiva-derived mesenchymal stromal cells on murine contact hypersensitivity via prostaglandin E2-EP3 signaling.

Hyperthermic effects of arachidonic acid, prostaglandin E2 and F2alpha in rats.

Permeability of bovine brain microvessel endothelial cells in vitro: barrier tightening by a factor released from astroglioma cells.