Biochhnica et Biophysica Acta, 1130 (1992) 247-252
~3 1992 Elsevier Science Publishers B.V. All rights reserved 0167-4781/92/$05.00
247
BBAEXP 92358
Evolutionarily conserved structure of the 3' non-translated region of a Chinese hamster polyubiquitin gene Mitsuru Nenoi a, Kazuei Mita b and Sach~ko Ichimura i, a Trah~hlg School and t, Dh'i~iol~ q,f Bio'og), Nc~.h,m "l ,:~sstitute of Radiological Sciences. Chiha-.~hi (Japan)
(Received 29 ,',,~:ptember 1991)
Key words: Polyubiquilin gene; Seque,~ce homology: Evolntitm.'u'yconscrvatio,~; (Chinese hamster) From a V7 t) Chinese hamster genomie library, we isolated a chine ctmtaining a polyubiquitin gone (designated as CHUBI), and determined its nuclcolide sequence. The coding region of tile C l t U B I gcnc coqsisted of five direct repeats of tile ubiquitin unit with no spacer, followed by a single tyrosine residue. Northern hybridization analysis with a synthesized probe specific to the 3' non-translated region of the C H U B ! gone revealed thai it codes for a 1.14 kb mRNA. An cvidcnt homology to the hum'.m polyubiquitin gene UbB and the chicken Uhl gcnc was obscrvcd in the region corresponding to the full extent of the mature m R N A sequence, suggesting that these three genes belong to a common polyubiquitin gcnc subfamily, and that Ihc sequence in the 3' non-translated region of the C H U B I gent is unique to this subfamily.
Introduction
Ubiquitin is an evolutionarily conserved small protein of high intracellular abundance (reviewed in Ref. 1). Through its covalent conjugation to various intracellular protein substrates, ubiquitin has been shown to be involved in diverse cellular processes, such as ATPdependent proteolysis of abnormal or short-lived normal proteins [2], chromatin organization [3], stress response [4-8], DNA repair [9], cell cycle control [10,11], ribosome biogenesis [12] and programmed cell death [13]. Many eukaryotic cells have three classes of ubiquitin genes [1]; class 1 and class II genes code for a monomeric ubiquitin fused with ribosomal proteins of 52 and 76-81 amino acids, respectively, and class ill genes code for polyubiquitin precursors that contain tandem repeats of a 76 amino acids polypeptide of ubiquitin followed by a single additional C-terminal amino acid. We indicated previously that the codon usage patterns of class I and class II genes are different from that of class Ill genes [14]. Moreover, it has been reported that, unlike class Ill genes [4,5,16], class I and II genes are not heat-inducible [7,15], suggesting that the mechanism of expression of class I and II genes is different from that of class Ill genes, and also that the
Correspondence: M. Nenoi, Training School, National Institute of Radiological Sciences, 9-I, Anagawa-4-chome, Chiba-shi 260, Japan.
proteins encoded by these genes have different functions. Apparently, all higher eukaryotes have numerous actively transcribed polyubiquitin genes containing a different number of ubiquitin repeats. For instance, two polyubiquitin genes containing three and five repeats were reported in Dico,ostelium [17] and also two polyubiquitin loci were sequenced in humans (three and nine repeats, ternlcd UbB and UbC, respectively} [18,19]. It may be considered that each polyubiquitin gene has a separate function since not all polyubiquitin genes respond equally to various external stresses [21)]. in order to investigate the cellular role of each polyubiquitin gene, it is important to examine its evolutionary conservation among different species. From a V79 Chinese hamster genomic library, we isolated a clone containing a polyubiquitin genc (designated as CHUBI) that is actively transcribed in the cell. In the present report, we show that this gene is highly homologous to the human UbB gene and the chicken Ubl gene [26] in the 3' non-translated region. Materials and Methods
Construction and screening of the genomic librao,. A library was constructed by partial Sau3Al digestion of V79 Chinese hamster genomic DNA, ligation into BamHl digested phage L a m b d a D A S H 1I (STRATAGENE) and packaging into phage particles with Gigapack 1I Gold packaging extract (STRATA-
248
-176 -161 TGCTTA GTTTGGTGTT -160 -81 TTGAAATGCT TTAGCAGCTT GGAACCATGA CAAAACAGAT ACTGTGTTGT GAAGGAACGC GGGGGAGGGG CTTTCATTAG -80
-I
AGGTATTTTG TGGGLATCGA AATTTTTACC AGACATTTAA AATTACAAGT GGCACTTTTA CTTTTAAATT CAAGGTCAAA
Net Gin l i e Phe Val Lys Thr Leu Thr Giy Lys Thr l i e Thr Leu Giu Val Glu Pro Ser !
60
ATG CAA ATC TTC GTG AAG ACC CTG ACC GGC AAG ACC ATC ACC CTA GAG GTG GAG CCC AGT 229 288 457
516
685
744
.....
G
--T
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
G
I l l
~ l m
A
......
913
972
~ m m
I m
I 1 ~
. I .
I l l
I l l
! .
T
. . #
I l l
I m m
i i .
.
.
.
.
.
.
.
.
.
.
.
.
I
.
.
.
.
.
.
.
.
Asp Thr l i e Glu Ash Val Lys Ala Lys l i e Gin Asp Lys Glu Gly l i e Pro Pro Asp Gin 61 120 GAC ACC ATC GAA AAT GTC AAG GCC AAG ATC CAG GAT AAA GAG GGC ATC CCC CCC GAC CAG 289 348 517
576
745
804
973
1032
Gin Ars Leu l i e Phe Ala Gly Lys Gin Leu Glu Asp GIy Arg Thr Leu Ser Asp Tyr Asn 180 CAG CGA CTC ATC TTT GCC GGC AAG CAG CTG OAA GAT GGC CGC ACT CTT TCT GAT TAC AAC 349 408 t21
577
636
805
864
1033
i092
l i e Gin Lys Giu Ser Thr Leu His Leu Val Leu ArK Leu A r ; Gly Gly 181 228 ATC CAG AAA GAG TCC ACC CTG CAC CTG GTC CTC CGC CTC AGG GGT GGC 409 456 .
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
637 865 ................................................ 1093
684 912 Tyr * * *
1160 TAT TAA TTCT TCAGTCTGCA 1161 1240 TTCCCAGTGG GCAATGGATG GCATTAATCT GCACTATAGC CATTTGCCCC AATTTAAGTT TAGAAAATCC AAGTTTCAGT 1241 • 1320 AATAGCTGAA CCTCTGTTAA AAATGTTAAT AAAGGTTTTG TTGCATGGTA AGCATACATG GTGTCATTTG TGAAGTTTCT 132! .,, 1400 ATGGTGGCTT GGGTGGGGGA CTTCCCCTAC TGTCTTTAGA GATTGGTATT TAACTAAAAT TTGCGTCACT TATGTCTTAG 140! 1427 CTGAGTTGGG AACTTCGTTT AAAAGTT . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
1140
249 GENE). Approx. 10~' phage were screened by the plaque-hybridization method using a ubiquitin-specific oligomer of 60 nucleotides [20]. DNA from a positive plaque was isolated by large scale preparation as riLescribed by Maniatis et al. [21]. After determination of the restriction map of the inserted DNA, a 2.3 kb DNA fragment containing the ubiquitin sequence was subcloned into the M13 veclor for sequence analysis. DNA sequence analysis. A series of deletion mutants containing inserted DNA of 0.3-1.3 kb were produced from the ubiquitin-specific clone by a modified method of Henikoff [22] and Yanish-Perron et al. [23]. They were sequenced with an automatic DNA sequencer (model 373, App~iied Biosystems). Northern anaA':ysis. Total RNA was purified from exponentially growing V79 Chinese hamster cells and HeLa cells by th~z LiCI/urea procedure [24] as previously described [20]. Northern analysis was performed using as a probe either the ubiquitin coding regionspecific 60met or a 30 nucleotide oligomer that is specific to the sequence in the 3' non-translated region of the CHUB1 gene (see Fig. 1). Hybridization procedure was the same as previously described [20]. Computer analysis of nucleotide sequence. Nucleotide sequence homologies between the CHUB1 gene and the human polyubiquitin gene UbB were analyzed using SDC GENETYX software (Software Development Co., Japan). This software contains a program to search for the alignment of two nucleotide sequences with maximum matches. Sum of the weighted factors given to each aligned , c l e o t i d e pair (match: - 1, mismatch: 1, gap of n bases: n + 2 ) was calculated, and the alignment with the least summation was determined. Results and Discussion
We sequenced 1603 bp of DNA within and around the ubiquitin coding region of the CHUB1 gene (Fig. 1). The coding region consists of five direct repeats of the monomeric ubiquitin sequence with no spacer DNA between repeats. The 76 amino acid unit sequences of the five repeats are identical, but there is degeneracy in the wobble position of some codons. The C-terminal ubiquitin repeat is followed by an additional tyrosine residue before the stop codon. A putative polyadenylation signal [25] is present 122 bp downstream from the stop codon. A pair of inverted repeats of 10 bp is
A ori. 0
V79 1
HeLa
B 2
3
mm
4 0 ori.
(--28S ~-l.8kb UbC'-)
~_ 18S
"-~ UbB hA-'* ?i"
~
i
Fig. 2. Northern hybridization analysis of total RNA from exponentially growing V79 Chinese hamster cells (A) and HeLa cells (B). The RNAs from both cells were electrophoresed on duplicate lanes, and two Northern filters identical to each other were prepared; one wa:, hybridized with the probe specific to the ubiquitin coding regio,a (lane I and 3), and the other was hybridized with the probe specific to the 3' ram-translated region of the CttUBI gene (hme 2 and 41. The positions of rRNA (18S and 28S) used as a molecular marker are indicated.
observed in the ubiquitin coding unit, suggesting a peculiar secondary structure of the transcript of this gene. In order to check the transcriptional activity of the CHUB1 gene, a Northern analysis was performed. Fig. 2A shows that the ubiquitin coding region-specific probe hybridized to four species of V79 Chinese hamster RNAs about 4.2 kb, 2.6 kb, 1.8 kb and 0.6 kb (lane 1). On the other hand, the probe specific to the 3' non-translated region of the CHUBI gene (1179-12(18 in Fig. 1) hybridized only to a single RNA species at the same location as the 1.8 kb species (lane 2). This result indicates that the 1.8 kb species is encoded by the CHUB1 gene. Fornace et al. [16] have published the nucleotide sequence of a Chinese hamster eDNA that contains two complete repeats of the monomeric ubiqditin sequence and a part of the third repeat. The cDNA contained, in the 5' non-translated region, a sequence specific to the 1.8 kb (estimated at 1.7 kb in their paper) transcript. A complete match in the DNA sequence of the first and the second ubiquitin unit is observed when comparing their result and our present result. However, the partial third unit of their eDNA was not identical to the third but to the fifth unit of the CHUB1 gene. it is unclear whether both genes are
Fig. I. Nucleotide sequence of a Chinese hamster polyubiquitin gene CHUBI (EMBL accession No. X60390). The A of the me:laitmine initiator codon of the first ubiquitin repeat unit is numbered + 1. The nucleotide sequence of the first ubiquitin unit (I-228) is given in full. and, in the following repeats, the identical nucleotide to the first repeat is indicated by a dash. ]'he amino acid sequence of ubiquitin is shown above Ihc first ubiquitin repeat. A pair of inverted repeats are underlined. The stop codon is indicated by an asterisk. The polyadenyb:tion signal AATAAA is doubly underlined. The putative polyadenylation site, by analogy from the human UbB gene, is indicated by an "~rrow head. The sequence hybridized with the ubiquitin coding region-specific probe is overlined, and the seque,'ee of the 3' non-translated region-specific probe was is doubly overlined.
250 identical to each other or not. Baker and Board [18] have pointed out that, owing to the long inverted repeats in the ubiquitin coding unit (163-172 and 184-193 for the first repeat), this m R N A can form a loop.stem,bubble-stem structure by pairing between the inverted repeats of different units, that could cause the precise deletion of one complete coding unit in reverse transcription synthesis of the cDNA from the mRNA template. We checked the nucleotide sequence homology between the CHUB1 gene and the human polyubiquitin gene UbB as Fornace etal. have pointed out sequence similarity in a part of the 5' non-translated region of the eDNA and the UbB gene [16]. Fig. 3 shows an excellent homology between the C H U B I gene and the UbB gene not only in the ubiquitin coding region but also in part of 5' and 3' non-translated regions; 22 in 25 bp in the 5' region and 147 in 165 bp in the 3' region were identical to the corresponding regions of the UbB gene after introduction of gaps to optimize the homology. Fig. 2B shows that the probe specific to the 3' non-translated region of the C H U B I gene uniquely hybridized to the UbB gene transcript of HeLa cells, indicating that the sequence in the 3' non-translated region of the C H U B I gene is specific only to the UbB gene. The 5' non-translated region of the UbB gene contains an intron sequence upstream from - 7 (Ref. 18; Fig, 3), Thus, the 5' non-translated region of the UbB
5'
Non-Translated
Region
CHUBI
-25
ttttacttttaaattcaagGTCAAA
UbB:
-23
..............
Ubl:
-24
--e-tta-R-ttt
3'
Non-Translated
CHUBI: UbB: UbI:
CHUBI: UbB: Ubl:
gene that shows homology to the C H U B I gene extends to 17 bp upstream from the 3' splicing site in the intron sequence. On the other hand, the homologous 3' non-translated region extends to 18 bp downstream from the polyadenylation site (the polyadenylation site of the UbB gene is located at 833 (Ref. 18; Fig. 1)). Consequently, the region of the UbB gene homologous to the CHUB1 gene almost precisely matches the mature mRNA sequence with 17-18 bp extra bases at both ends. As the chicken polyubiquitin gene Ubl contains an intron at exactly the same location in the 5' non-translated region [26] as that of the UbB gene (7 bp upstream from the first ubiquitin coding unit), it is tempting to hypothesize that both the Ubl gene and the UbB gene evolved from a common precursor. Then we checked the nucleotide sequence homology (Fig. 3). A high homology was observed in the 3' non-translated region after introduction of gaps; 105 matches in 165 bp. Considering the long evolutionary distance between Chinese hamster and chicken, it is evident that both genes are evolutionarily correlated. An evolutionary conservation between two homologous genes in different species can be quantitatively discussed by using the 'sequence difference' as a parameter. The sequence difference is the frequency of nucleotide substitution per site for non-coding regions, or per synonymous site for coding regions. The sequence difference in coding regions and intron regions
t .........
.......
-I 1
A--C
-I
Resion
1147 TTCTTCAGTC T GCATTCCCAGTGGG CAATGGATGG 691 . . . . . . . . . . A-G . . . . . . G. . . . . CC --G . . . . . . . . . . . 919
--G . . . . .
A
---G--TTGTCAA-CAAG---C-CA-CACATTG-GTGT
I199 GCCATTTGCCCCAAT 744 . . . . . . . . . . . . . . C 975
-T .
.
.
.
.
CATTAATCTGCACTATA 1198 C. . . . . . . . . . . 743
T---GTC
......
G--
974
TTAAGTTTAGAAAATCCAAG TTTCAGTAATAGCTGAAC CT 1253 ............. T-A . . . . . . . . . . . . . . . . . . . . . . . 797 ....
A. . . . . .
G ....
C---A
.....
CT .....
T-TG-
1026
CHUBI : 1254 CTGTTAAAAATGTTAATAAAGGTTT
TGTTGCATGGTAAGCATACATGGTGTCATTTGT 1311
UbB:
C. . . . . . . . . . . . . . . . .
UbI:
798
....
1027
A ....
C ................... G .....
C ........
T---TC
.......
CAT . . . . .
T-
T. . . . . . . . . . . --T
. . . . . . .
851 1079
Fig, 3. Comparison of nucleotide sequencesin 5' and 3' non-translated region betweenthe Chinese hamster CHUBI gene, the human UbB gene and the chicken Ubl gene. Gaps were introduced to optimize the homology.Nucleotidesof the UbB gene and the Ubl gene that are identical to the corresponding nucleotide of the CHUBI gene are indicated by a dash. Numbering is as in Fig. 1 for all three sequences.The intron in the 5' non-translated region of both the UbB gene and the Ubl gene is typed in lower case, and the corresponding region of the CHUBI gene is also typed in lowercase.
251 TABLE I
Sequence difference between the Chin,,se hamster CHUBI gene and the human UbB gene The sequence difference was evaluated according to Miyata et al. [27]. Chinese hamster CHUBI gene intron ( - 176 to - 26) Human UbB gene intron ( - 1 7 6 - - 24) coding 1st 2nd 3rd
coding 1st
2nd
3rd
4th
5th
0.51 0.43 0.27
0.51 0.60 0.39
0.43 0.51 0.33
0.51 0.60 0.39
0.54 0.46 0.29
mean
3' non-lranslated 11147-1311)
11.71
0.45
mean
3' non-translated (691-851)
has been reported to be almost constant regardless of the types of genes compared; 0.48 + 0.02 between the rodent and the primate [27]. We calculated the sequence difference between the CHUBI gene and the UbB gene for the three regions; the portion of the 5' intron without an apparent homology, the ubiquitin coding region, and the 3' non-translated region containing the apparent homology. The results corrected for the multiple substitution [27] are represented in Table I. The sequence difference in the coding region (0.45) was comparable to the value reported for other genes (0.48 + 0.02), but a considerably small value was observed in the 3' non-translated region. This agrees with the results obtained for the a-globin, /3-globin, preproinsulin and growth hormone genes [27]. In addition, a relatively higher homology in the 3' portion of the 3' non-translated region compared to the 5' portion, observed in these four genes, is also observed in the 3' non-translated region of the CHUB1, the UbB and the Ubl genes (Fig. 3). These phenomena are considered to be general features of evolutionarily correlated genes in different species. On the other hand, the sequence difference was fairly large in the intron region. However, it is unclear whether the intron region of the CHUB1 gene and the UbB gene are evolutionarily uncorrelated, because the sequence difference of this region was strongly affected by the condition for searching for the maximum matching between the two sequences. The high sequence conservation observed in the 3' non-translated region may suggest a specific function for this region in the regulation of gene expression. For example, a computer analysis showed that the mRNAs of all three genes are capable of forming a similar stem-loop secondary structure in the 3' non-coding region .(data not shown). The observations described above imply that the Chinese hamster CHUB1 gene, the human UbB gene and the chicken Ubl gene belong
0.11
to a polyubiquitin gene subfamily with a common origin. it was previously shown that while the human UbC gene is inducible by external stresses such as ultraviolet light and treatment with phorbol ester, induction of the UbB gene by these agents is not observable [20]. In addition, our preliminary data show a similar difference in the response to ultraviolet light between the two Chinese hamster polyubiquitin genes coding for the 1.8 kb and 2.6 kb transcripts. These observations indicate a different mechanism of gene regulation for each polyubiquitin gent. Therefore, it is tempting to speculate that each polyubiquitin gene, separately conserved through evolution, has different functions. It has been speculated that polyubiquitin precursors encoded by different polyubiquitin genes may be selectively processed by a specific ubiquitin C-terminal hydrolase [18]. This idea accords with the fact that the C-terminal amino acids of the precursors encoded by the CHUB1 gene and the Ubl gene (tyrosine) and the UbB gene (cysteine) are both classified as non-charged polar amino acids. It is likely that a common ubiquitin C-terminal hydrolase may recognize these amino acid residues and cleave them to activate specifically this subfamily in the ubiquitin conjugation system.
Acknowledgements The authors thank Dr. lain L. Cartwright, University of Cincinnati College of Medicine, for reading thc manuscript. This work was supported by a grant-in-aid for scientific research from the Ministry of Education, Science and Culture of Japan.
References I Jentsch, S., Seufert, W. and Hauser, H, (1991) Biochim. Biophys. Aeta 1089, 124-139.
252 2 3 4 5
Hershko. A. (1988) J. Biol. Chem. 263, 15237-15240. Rechsteiner, M. (1988) Ubiquitin, Plenum Press, New York. Bond, U. and Schlesinger, M.J. (1985) Mol. Cell. Biol. 5, 949-956. Finley, D.. Ozkaynak, E. and Varshavsky, A. (1987) Ce!l 48, 1035-1046. 6 Latchman. D.S,, Estridge, J.K. and Kemp, L.M, (1987) Nucleic Acids Res, 15, 7283-7293. 7 Miiller-Taubcnberger, A., Hagmann, J., Noegel, A. and Gerisch, G, (1988) J. Cell Sci. 90, 51-58. 8 Treger, J,M., Heichman, K.A. and McEntee, K. (1988) Mol. Cell. Biol. 8, 1132-1136. 9 Jentsch, S,, McGrath, J.P. and Varshavsky, A. (1987) Nature 329, 131-134. I0 Goebk M.G., Yochem, J,) Jentsch, S., McGralb, J,P., Varshavsky, A, and Byers, B. (1988) Science 241, 1331-1335. I | Glotzer, M,, Murray, A,W, and Kirschner, M,W, (1991) Nature 349, 132-138. 12 Finley, D,, Barrel, B, and Varshavsky, A. (1989) Nature 338, 3~-401, 13 Schwartz, L,M,, Myer, A,, Ko~, L., Engelstein, M, and Maier, C, (1990) Neuron 5, 411-419, 14 Mira, K,, lchimura, S, and Ncnoi. M, (1991) 5. Mol. Evol. 33, 216-225,
15 Lee, H., Simon, J.A. and Lis, J.T. (1988) Mol. Cell. Biol. 8, 4727-4735. 16 Fornace Jr, A.J., Alamo Jr, I., Hollander, M.C. and Lamoreaux, E. (1989) Nucleic Acids Res. 17, 1215-1230. 17 Giorda, R. and Ennis, H.L. (i987) Mol. Cell. Biol. 7, 2097-2103. 18 Baker, R.T. and Board, P.G. (1987) Nucleic Acids Res. 15, 443 -463. 19 Wiborg, O., Pedersen, M.S., Wind, A., Berglund, L.E., Marcker, K.A. and Vuust, J. (1985) EMBO J. 4, 755-759. 20 Nenoi, M. {|992) Int. J. Radiat. Biol,, in press. 21 Maniatis, T., Fritsch, E.F. and Sambrook, J. (1982) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor University Press, Cold Spring Harbor, 22 henikoff, S. (1984) Gene 28, 351-359. 23 Yanisch-Perron, C., Vieira, J. and Messing, J. (1985) Gene 33, 103-119. 24 Applebaum, W , James, T.C., Wreschner, D.H. and Tara, J.R. (1981) Biochem. J. 193. 209-216. 25 Proudfoot, N.J. and Brownlee, G.G. (1976) Nature 263, 211-214. 26 Bond, U, and Sehlesinger, M.J, (1986) Mol. Cell. Biol. 6, 46{)24610. 27 Miyata, T., Yasunaga, T. and Nishida, T. ( 1980} Proc. Nail. Acad. Sci. USA 77, 7328-7332.
~3 1992 Elsevier Science Publishers B.V. All rights reserved 0167-4781/92/$05.00
247
BBAEXP 92358
Evolutionarily conserved structure of the 3' non-translated region of a Chinese hamster polyubiquitin gene Mitsuru Nenoi a, Kazuei Mita b and Sach~ko Ichimura i, a Trah~hlg School and t, Dh'i~iol~ q,f Bio'og), Nc~.h,m "l ,:~sstitute of Radiological Sciences. Chiha-.~hi (Japan)
(Received 29 ,',,~:ptember 1991)
Key words: Polyubiquilin gene; Seque,~ce homology: Evolntitm.'u'yconscrvatio,~; (Chinese hamster) From a V7 t) Chinese hamster genomie library, we isolated a chine ctmtaining a polyubiquitin gone (designated as CHUBI), and determined its nuclcolide sequence. The coding region of tile C l t U B I gcnc coqsisted of five direct repeats of tile ubiquitin unit with no spacer, followed by a single tyrosine residue. Northern hybridization analysis with a synthesized probe specific to the 3' non-translated region of the C H U B ! gone revealed thai it codes for a 1.14 kb mRNA. An cvidcnt homology to the hum'.m polyubiquitin gene UbB and the chicken Uhl gcnc was obscrvcd in the region corresponding to the full extent of the mature m R N A sequence, suggesting that these three genes belong to a common polyubiquitin gcnc subfamily, and that Ihc sequence in the 3' non-translated region of the C H U B I gent is unique to this subfamily.
Introduction
Ubiquitin is an evolutionarily conserved small protein of high intracellular abundance (reviewed in Ref. 1). Through its covalent conjugation to various intracellular protein substrates, ubiquitin has been shown to be involved in diverse cellular processes, such as ATPdependent proteolysis of abnormal or short-lived normal proteins [2], chromatin organization [3], stress response [4-8], DNA repair [9], cell cycle control [10,11], ribosome biogenesis [12] and programmed cell death [13]. Many eukaryotic cells have three classes of ubiquitin genes [1]; class 1 and class II genes code for a monomeric ubiquitin fused with ribosomal proteins of 52 and 76-81 amino acids, respectively, and class ill genes code for polyubiquitin precursors that contain tandem repeats of a 76 amino acids polypeptide of ubiquitin followed by a single additional C-terminal amino acid. We indicated previously that the codon usage patterns of class I and class II genes are different from that of class Ill genes [14]. Moreover, it has been reported that, unlike class Ill genes [4,5,16], class I and II genes are not heat-inducible [7,15], suggesting that the mechanism of expression of class I and II genes is different from that of class Ill genes, and also that the
Correspondence: M. Nenoi, Training School, National Institute of Radiological Sciences, 9-I, Anagawa-4-chome, Chiba-shi 260, Japan.
proteins encoded by these genes have different functions. Apparently, all higher eukaryotes have numerous actively transcribed polyubiquitin genes containing a different number of ubiquitin repeats. For instance, two polyubiquitin genes containing three and five repeats were reported in Dico,ostelium [17] and also two polyubiquitin loci were sequenced in humans (three and nine repeats, ternlcd UbB and UbC, respectively} [18,19]. It may be considered that each polyubiquitin gene has a separate function since not all polyubiquitin genes respond equally to various external stresses [21)]. in order to investigate the cellular role of each polyubiquitin gene, it is important to examine its evolutionary conservation among different species. From a V79 Chinese hamster genomic library, we isolated a clone containing a polyubiquitin genc (designated as CHUBI) that is actively transcribed in the cell. In the present report, we show that this gene is highly homologous to the human UbB gene and the chicken Ubl gene [26] in the 3' non-translated region. Materials and Methods
Construction and screening of the genomic librao,. A library was constructed by partial Sau3Al digestion of V79 Chinese hamster genomic DNA, ligation into BamHl digested phage L a m b d a D A S H 1I (STRATAGENE) and packaging into phage particles with Gigapack 1I Gold packaging extract (STRATA-
248
-176 -161 TGCTTA GTTTGGTGTT -160 -81 TTGAAATGCT TTAGCAGCTT GGAACCATGA CAAAACAGAT ACTGTGTTGT GAAGGAACGC GGGGGAGGGG CTTTCATTAG -80
-I
AGGTATTTTG TGGGLATCGA AATTTTTACC AGACATTTAA AATTACAAGT GGCACTTTTA CTTTTAAATT CAAGGTCAAA
Net Gin l i e Phe Val Lys Thr Leu Thr Giy Lys Thr l i e Thr Leu Giu Val Glu Pro Ser !
60
ATG CAA ATC TTC GTG AAG ACC CTG ACC GGC AAG ACC ATC ACC CTA GAG GTG GAG CCC AGT 229 288 457
516
685
744
.....
G
--T
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
G
I l l
~ l m
A
......
913
972
~ m m
I m
I 1 ~
. I .
I l l
I l l
! .
T
. . #
I l l
I m m
i i .
.
.
.
.
.
.
.
.
.
.
.
.
I
.
.
.
.
.
.
.
.
Asp Thr l i e Glu Ash Val Lys Ala Lys l i e Gin Asp Lys Glu Gly l i e Pro Pro Asp Gin 61 120 GAC ACC ATC GAA AAT GTC AAG GCC AAG ATC CAG GAT AAA GAG GGC ATC CCC CCC GAC CAG 289 348 517
576
745
804
973
1032
Gin Ars Leu l i e Phe Ala Gly Lys Gin Leu Glu Asp GIy Arg Thr Leu Ser Asp Tyr Asn 180 CAG CGA CTC ATC TTT GCC GGC AAG CAG CTG OAA GAT GGC CGC ACT CTT TCT GAT TAC AAC 349 408 t21
577
636
805
864
1033
i092
l i e Gin Lys Giu Ser Thr Leu His Leu Val Leu ArK Leu A r ; Gly Gly 181 228 ATC CAG AAA GAG TCC ACC CTG CAC CTG GTC CTC CGC CTC AGG GGT GGC 409 456 .
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
637 865 ................................................ 1093
684 912 Tyr * * *
1160 TAT TAA TTCT TCAGTCTGCA 1161 1240 TTCCCAGTGG GCAATGGATG GCATTAATCT GCACTATAGC CATTTGCCCC AATTTAAGTT TAGAAAATCC AAGTTTCAGT 1241 • 1320 AATAGCTGAA CCTCTGTTAA AAATGTTAAT AAAGGTTTTG TTGCATGGTA AGCATACATG GTGTCATTTG TGAAGTTTCT 132! .,, 1400 ATGGTGGCTT GGGTGGGGGA CTTCCCCTAC TGTCTTTAGA GATTGGTATT TAACTAAAAT TTGCGTCACT TATGTCTTAG 140! 1427 CTGAGTTGGG AACTTCGTTT AAAAGTT . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
1140
249 GENE). Approx. 10~' phage were screened by the plaque-hybridization method using a ubiquitin-specific oligomer of 60 nucleotides [20]. DNA from a positive plaque was isolated by large scale preparation as riLescribed by Maniatis et al. [21]. After determination of the restriction map of the inserted DNA, a 2.3 kb DNA fragment containing the ubiquitin sequence was subcloned into the M13 veclor for sequence analysis. DNA sequence analysis. A series of deletion mutants containing inserted DNA of 0.3-1.3 kb were produced from the ubiquitin-specific clone by a modified method of Henikoff [22] and Yanish-Perron et al. [23]. They were sequenced with an automatic DNA sequencer (model 373, App~iied Biosystems). Northern anaA':ysis. Total RNA was purified from exponentially growing V79 Chinese hamster cells and HeLa cells by th~z LiCI/urea procedure [24] as previously described [20]. Northern analysis was performed using as a probe either the ubiquitin coding regionspecific 60met or a 30 nucleotide oligomer that is specific to the sequence in the 3' non-translated region of the CHUB1 gene (see Fig. 1). Hybridization procedure was the same as previously described [20]. Computer analysis of nucleotide sequence. Nucleotide sequence homologies between the CHUB1 gene and the human polyubiquitin gene UbB were analyzed using SDC GENETYX software (Software Development Co., Japan). This software contains a program to search for the alignment of two nucleotide sequences with maximum matches. Sum of the weighted factors given to each aligned , c l e o t i d e pair (match: - 1, mismatch: 1, gap of n bases: n + 2 ) was calculated, and the alignment with the least summation was determined. Results and Discussion
We sequenced 1603 bp of DNA within and around the ubiquitin coding region of the CHUB1 gene (Fig. 1). The coding region consists of five direct repeats of the monomeric ubiquitin sequence with no spacer DNA between repeats. The 76 amino acid unit sequences of the five repeats are identical, but there is degeneracy in the wobble position of some codons. The C-terminal ubiquitin repeat is followed by an additional tyrosine residue before the stop codon. A putative polyadenylation signal [25] is present 122 bp downstream from the stop codon. A pair of inverted repeats of 10 bp is
A ori. 0
V79 1
HeLa
B 2
3
mm
4 0 ori.
(--28S ~-l.8kb UbC'-)
~_ 18S
"-~ UbB hA-'* ?i"
~
i
Fig. 2. Northern hybridization analysis of total RNA from exponentially growing V79 Chinese hamster cells (A) and HeLa cells (B). The RNAs from both cells were electrophoresed on duplicate lanes, and two Northern filters identical to each other were prepared; one wa:, hybridized with the probe specific to the ubiquitin coding regio,a (lane I and 3), and the other was hybridized with the probe specific to the 3' ram-translated region of the CttUBI gene (hme 2 and 41. The positions of rRNA (18S and 28S) used as a molecular marker are indicated.
observed in the ubiquitin coding unit, suggesting a peculiar secondary structure of the transcript of this gene. In order to check the transcriptional activity of the CHUB1 gene, a Northern analysis was performed. Fig. 2A shows that the ubiquitin coding region-specific probe hybridized to four species of V79 Chinese hamster RNAs about 4.2 kb, 2.6 kb, 1.8 kb and 0.6 kb (lane 1). On the other hand, the probe specific to the 3' non-translated region of the CHUBI gene (1179-12(18 in Fig. 1) hybridized only to a single RNA species at the same location as the 1.8 kb species (lane 2). This result indicates that the 1.8 kb species is encoded by the CHUB1 gene. Fornace et al. [16] have published the nucleotide sequence of a Chinese hamster eDNA that contains two complete repeats of the monomeric ubiqditin sequence and a part of the third repeat. The cDNA contained, in the 5' non-translated region, a sequence specific to the 1.8 kb (estimated at 1.7 kb in their paper) transcript. A complete match in the DNA sequence of the first and the second ubiquitin unit is observed when comparing their result and our present result. However, the partial third unit of their eDNA was not identical to the third but to the fifth unit of the CHUB1 gene. it is unclear whether both genes are
Fig. I. Nucleotide sequence of a Chinese hamster polyubiquitin gene CHUBI (EMBL accession No. X60390). The A of the me:laitmine initiator codon of the first ubiquitin repeat unit is numbered + 1. The nucleotide sequence of the first ubiquitin unit (I-228) is given in full. and, in the following repeats, the identical nucleotide to the first repeat is indicated by a dash. ]'he amino acid sequence of ubiquitin is shown above Ihc first ubiquitin repeat. A pair of inverted repeats are underlined. The stop codon is indicated by an asterisk. The polyadenyb:tion signal AATAAA is doubly underlined. The putative polyadenylation site, by analogy from the human UbB gene, is indicated by an "~rrow head. The sequence hybridized with the ubiquitin coding region-specific probe is overlined, and the seque,'ee of the 3' non-translated region-specific probe was is doubly overlined.
250 identical to each other or not. Baker and Board [18] have pointed out that, owing to the long inverted repeats in the ubiquitin coding unit (163-172 and 184-193 for the first repeat), this m R N A can form a loop.stem,bubble-stem structure by pairing between the inverted repeats of different units, that could cause the precise deletion of one complete coding unit in reverse transcription synthesis of the cDNA from the mRNA template. We checked the nucleotide sequence homology between the CHUB1 gene and the human polyubiquitin gene UbB as Fornace etal. have pointed out sequence similarity in a part of the 5' non-translated region of the eDNA and the UbB gene [16]. Fig. 3 shows an excellent homology between the C H U B I gene and the UbB gene not only in the ubiquitin coding region but also in part of 5' and 3' non-translated regions; 22 in 25 bp in the 5' region and 147 in 165 bp in the 3' region were identical to the corresponding regions of the UbB gene after introduction of gaps to optimize the homology. Fig. 2B shows that the probe specific to the 3' non-translated region of the C H U B I gene uniquely hybridized to the UbB gene transcript of HeLa cells, indicating that the sequence in the 3' non-translated region of the C H U B I gene is specific only to the UbB gene. The 5' non-translated region of the UbB gene contains an intron sequence upstream from - 7 (Ref. 18; Fig, 3), Thus, the 5' non-translated region of the UbB
5'
Non-Translated
Region
CHUBI
-25
ttttacttttaaattcaagGTCAAA
UbB:
-23
..............
Ubl:
-24
--e-tta-R-ttt
3'
Non-Translated
CHUBI: UbB: UbI:
CHUBI: UbB: Ubl:
gene that shows homology to the C H U B I gene extends to 17 bp upstream from the 3' splicing site in the intron sequence. On the other hand, the homologous 3' non-translated region extends to 18 bp downstream from the polyadenylation site (the polyadenylation site of the UbB gene is located at 833 (Ref. 18; Fig. 1)). Consequently, the region of the UbB gene homologous to the CHUB1 gene almost precisely matches the mature mRNA sequence with 17-18 bp extra bases at both ends. As the chicken polyubiquitin gene Ubl contains an intron at exactly the same location in the 5' non-translated region [26] as that of the UbB gene (7 bp upstream from the first ubiquitin coding unit), it is tempting to hypothesize that both the Ubl gene and the UbB gene evolved from a common precursor. Then we checked the nucleotide sequence homology (Fig. 3). A high homology was observed in the 3' non-translated region after introduction of gaps; 105 matches in 165 bp. Considering the long evolutionary distance between Chinese hamster and chicken, it is evident that both genes are evolutionarily correlated. An evolutionary conservation between two homologous genes in different species can be quantitatively discussed by using the 'sequence difference' as a parameter. The sequence difference is the frequency of nucleotide substitution per site for non-coding regions, or per synonymous site for coding regions. The sequence difference in coding regions and intron regions
t .........
.......
-I 1
A--C
-I
Resion
1147 TTCTTCAGTC T GCATTCCCAGTGGG CAATGGATGG 691 . . . . . . . . . . A-G . . . . . . G. . . . . CC --G . . . . . . . . . . . 919
--G . . . . .
A
---G--TTGTCAA-CAAG---C-CA-CACATTG-GTGT
I199 GCCATTTGCCCCAAT 744 . . . . . . . . . . . . . . C 975
-T .
.
.
.
.
CATTAATCTGCACTATA 1198 C. . . . . . . . . . . 743
T---GTC
......
G--
974
TTAAGTTTAGAAAATCCAAG TTTCAGTAATAGCTGAAC CT 1253 ............. T-A . . . . . . . . . . . . . . . . . . . . . . . 797 ....
A. . . . . .
G ....
C---A
.....
CT .....
T-TG-
1026
CHUBI : 1254 CTGTTAAAAATGTTAATAAAGGTTT
TGTTGCATGGTAAGCATACATGGTGTCATTTGT 1311
UbB:
C. . . . . . . . . . . . . . . . .
UbI:
798
....
1027
A ....
C ................... G .....
C ........
T---TC
.......
CAT . . . . .
T-
T. . . . . . . . . . . --T
. . . . . . .
851 1079
Fig, 3. Comparison of nucleotide sequencesin 5' and 3' non-translated region betweenthe Chinese hamster CHUBI gene, the human UbB gene and the chicken Ubl gene. Gaps were introduced to optimize the homology.Nucleotidesof the UbB gene and the Ubl gene that are identical to the corresponding nucleotide of the CHUBI gene are indicated by a dash. Numbering is as in Fig. 1 for all three sequences.The intron in the 5' non-translated region of both the UbB gene and the Ubl gene is typed in lower case, and the corresponding region of the CHUBI gene is also typed in lowercase.
251 TABLE I
Sequence difference between the Chin,,se hamster CHUBI gene and the human UbB gene The sequence difference was evaluated according to Miyata et al. [27]. Chinese hamster CHUBI gene intron ( - 176 to - 26) Human UbB gene intron ( - 1 7 6 - - 24) coding 1st 2nd 3rd
coding 1st
2nd
3rd
4th
5th
0.51 0.43 0.27
0.51 0.60 0.39
0.43 0.51 0.33
0.51 0.60 0.39
0.54 0.46 0.29
mean
3' non-lranslated 11147-1311)
11.71
0.45
mean
3' non-translated (691-851)
has been reported to be almost constant regardless of the types of genes compared; 0.48 + 0.02 between the rodent and the primate [27]. We calculated the sequence difference between the CHUBI gene and the UbB gene for the three regions; the portion of the 5' intron without an apparent homology, the ubiquitin coding region, and the 3' non-translated region containing the apparent homology. The results corrected for the multiple substitution [27] are represented in Table I. The sequence difference in the coding region (0.45) was comparable to the value reported for other genes (0.48 + 0.02), but a considerably small value was observed in the 3' non-translated region. This agrees with the results obtained for the a-globin, /3-globin, preproinsulin and growth hormone genes [27]. In addition, a relatively higher homology in the 3' portion of the 3' non-translated region compared to the 5' portion, observed in these four genes, is also observed in the 3' non-translated region of the CHUB1, the UbB and the Ubl genes (Fig. 3). These phenomena are considered to be general features of evolutionarily correlated genes in different species. On the other hand, the sequence difference was fairly large in the intron region. However, it is unclear whether the intron region of the CHUB1 gene and the UbB gene are evolutionarily uncorrelated, because the sequence difference of this region was strongly affected by the condition for searching for the maximum matching between the two sequences. The high sequence conservation observed in the 3' non-translated region may suggest a specific function for this region in the regulation of gene expression. For example, a computer analysis showed that the mRNAs of all three genes are capable of forming a similar stem-loop secondary structure in the 3' non-coding region .(data not shown). The observations described above imply that the Chinese hamster CHUB1 gene, the human UbB gene and the chicken Ubl gene belong
0.11
to a polyubiquitin gene subfamily with a common origin. it was previously shown that while the human UbC gene is inducible by external stresses such as ultraviolet light and treatment with phorbol ester, induction of the UbB gene by these agents is not observable [20]. In addition, our preliminary data show a similar difference in the response to ultraviolet light between the two Chinese hamster polyubiquitin genes coding for the 1.8 kb and 2.6 kb transcripts. These observations indicate a different mechanism of gene regulation for each polyubiquitin gent. Therefore, it is tempting to speculate that each polyubiquitin gene, separately conserved through evolution, has different functions. It has been speculated that polyubiquitin precursors encoded by different polyubiquitin genes may be selectively processed by a specific ubiquitin C-terminal hydrolase [18]. This idea accords with the fact that the C-terminal amino acids of the precursors encoded by the CHUB1 gene and the Ubl gene (tyrosine) and the UbB gene (cysteine) are both classified as non-charged polar amino acids. It is likely that a common ubiquitin C-terminal hydrolase may recognize these amino acid residues and cleave them to activate specifically this subfamily in the ubiquitin conjugation system.
Acknowledgements The authors thank Dr. lain L. Cartwright, University of Cincinnati College of Medicine, for reading thc manuscript. This work was supported by a grant-in-aid for scientific research from the Ministry of Education, Science and Culture of Japan.
References I Jentsch, S., Seufert, W. and Hauser, H, (1991) Biochim. Biophys. Aeta 1089, 124-139.
252 2 3 4 5
Hershko. A. (1988) J. Biol. Chem. 263, 15237-15240. Rechsteiner, M. (1988) Ubiquitin, Plenum Press, New York. Bond, U. and Schlesinger, M.J. (1985) Mol. Cell. Biol. 5, 949-956. Finley, D.. Ozkaynak, E. and Varshavsky, A. (1987) Ce!l 48, 1035-1046. 6 Latchman. D.S,, Estridge, J.K. and Kemp, L.M, (1987) Nucleic Acids Res, 15, 7283-7293. 7 Miiller-Taubcnberger, A., Hagmann, J., Noegel, A. and Gerisch, G, (1988) J. Cell Sci. 90, 51-58. 8 Treger, J,M., Heichman, K.A. and McEntee, K. (1988) Mol. Cell. Biol. 8, 1132-1136. 9 Jentsch, S,, McGrath, J.P. and Varshavsky, A. (1987) Nature 329, 131-134. I0 Goebk M.G., Yochem, J,) Jentsch, S., McGralb, J,P., Varshavsky, A, and Byers, B. (1988) Science 241, 1331-1335. I | Glotzer, M,, Murray, A,W, and Kirschner, M,W, (1991) Nature 349, 132-138. 12 Finley, D,, Barrel, B, and Varshavsky, A. (1989) Nature 338, 3~-401, 13 Schwartz, L,M,, Myer, A,, Ko~, L., Engelstein, M, and Maier, C, (1990) Neuron 5, 411-419, 14 Mira, K,, lchimura, S, and Ncnoi. M, (1991) 5. Mol. Evol. 33, 216-225,
15 Lee, H., Simon, J.A. and Lis, J.T. (1988) Mol. Cell. Biol. 8, 4727-4735. 16 Fornace Jr, A.J., Alamo Jr, I., Hollander, M.C. and Lamoreaux, E. (1989) Nucleic Acids Res. 17, 1215-1230. 17 Giorda, R. and Ennis, H.L. (i987) Mol. Cell. Biol. 7, 2097-2103. 18 Baker, R.T. and Board, P.G. (1987) Nucleic Acids Res. 15, 443 -463. 19 Wiborg, O., Pedersen, M.S., Wind, A., Berglund, L.E., Marcker, K.A. and Vuust, J. (1985) EMBO J. 4, 755-759. 20 Nenoi, M. {|992) Int. J. Radiat. Biol,, in press. 21 Maniatis, T., Fritsch, E.F. and Sambrook, J. (1982) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor University Press, Cold Spring Harbor, 22 henikoff, S. (1984) Gene 28, 351-359. 23 Yanisch-Perron, C., Vieira, J. and Messing, J. (1985) Gene 33, 103-119. 24 Applebaum, W , James, T.C., Wreschner, D.H. and Tara, J.R. (1981) Biochem. J. 193. 209-216. 25 Proudfoot, N.J. and Brownlee, G.G. (1976) Nature 263, 211-214. 26 Bond, U, and Sehlesinger, M.J, (1986) Mol. Cell. Biol. 6, 46{)24610. 27 Miyata, T., Yasunaga, T. and Nishida, T. ( 1980} Proc. Nail. Acad. Sci. USA 77, 7328-7332.
