Published by the International Society of Protistologists
The Journal of
Eukaryotic Microbiology
Journal of Eukaryotic Microbiology ISSN 1066-5234
ORIGINAL ARTICLE
Evolution of the Germline Actin Gene in Hypotrichous Ciliates: Multiple Nonscrambled IESs at Extremely Conserved Locations in Two Urostylids Tianbing Chena, Zhenzhen Yia, Jie Huangb & Xiaofeng Lina a Laboratory of Protozoology, School of Life Science, South China Normal University, Guangzhou 510631, China b Key Laboratory of Aquatic Biodiversity and Conservation of Chinese Academy of Sciences, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan 430072, China
Keywords Actin; ciliates; macronuclear; MDS; micronuclear. Correspondence Z. Yi and X. Lin, Key Laboratory of Ecology and Environmental Science in Guangdong Higher Education, South China Normal University, Guangzhou 510631, China Telephone/Fax number: +86 (0) 20-85210644; e-mail: [email protected]; [email protected] Macronuclear (/Micronuclear) actin is abbreviated as MAC(/MIC)-actin. IESn-n + 1 represent the IES between MDSn and MDSn + 1.
ABSTRACT In hypotrichous ciliates, macronuclear chromosomes are gene-sized, and micronuclear genes contain short, noncoding internal eliminated segments (IESs) as well as macronuclear-destined segments (MDSs). In the present study, we characterized the complete macronuclear gene and two to three types of micronuclear actin genes of two urostylid species, i.e. Pseudokeronopsis rubra and Uroleptopsis citrina. Our results show that (1) the gain/loss of IES happens frequently in the subclass Hypotrichia (formerly Stichotrichia), and high fragmentation of germline genes does not imply for gene scrambling; and (2) the micronuclear actin gene is scrambled in the order Sporadotrichida but nonscrambled in the orders Urostylida and Stichotrichida, indicating the independent evolution of MIC-actin gene patterns in different orders of hypotrichs; (3) locations of MDS–IES junctions of micronuclear actin gene in coding regions are conserved among closely related species.
Received: 7 November 2013; revised 16 June 2014; accepted July 8, 2014. doi:10.1111/jeu.12158
CILIATES are unicellular eukaryotes characterized by the presence of cilia and nuclear dimorphism. Each cell contains two types of nuclei: a diploid germline micronucleus (MIC) which is transcriptionally inactive except during sexual conjugation, and a somatic macronucleus (MAC) which is the primary source of gene transcripts (Prescott 1994). The development of a new MAC from a MIC involves a series of chromosomal rearrangements, including DNA elimination, fragmentation, and amplification (Jahn and Klobutcher 2002; Prescott 1994). These rearrangements are extensive in three classes of ciliates: Armophorea, Phyllopharyngea, and Spirotrichea (the focus of this study). Transposons and most intergenic spacer DNA, as well as intragenic spacer DNA, termed internal eliminated segments (IESs) are extensively eliminated from zygotic chromosomes. In spirotrichous ciliates, the remaining DNA segments, called macronuclear-destined segments (MDSs), occupy only 2–5% of the germline genome (Jahn
188
and Klobutcher 2002; Prescott 1994). Assembly of these MDSs generates a MAC with up to 20,000,000 amplified gene-sized chromosomes in the class Spirotrichea (Baird and Klobutcher 1991; Prescott 1994). Macronuclear-destined segments within some micronuclear genes are scrambled in comparison to their linear arrangement in the macronucleus. It is estimated that approximately one-third of the genes in Hypotrichia sensu Adl et al. (2012) (formerly Stichotrichia sensu Lynn 2008), a subclass of Spirotrichea, are scrambled (Cavalcanti et al. 2005). Among them, three genes have been extensively studied: actin I (Dalby and Prescott 2004; Greslin et al. €llenbeck et al. 2006), a-telo1989; Hogan et al. 2001; Mo mere-binding protein (TEBP-a) (Mitcham et al. 1992; Prescott et al. 1998; Wong and Landweber 2006), and DNA polymerase a (DNA pol-a) (Chang et al. 2004, 2005; Hoffman and Prescott 1996, 1997; Landweber et al. 2000). However, conclusions about the evolution of these three
© 2014 The Author(s) Journal of Eukaryotic Microbiology © 2014 International Society of Protistologists Journal of Eukaryotic Microbiology 2015, 62, 188–195
Evolution of the Micronuclear Actin Gene
Chen et al.
genes vary. For example, it is reported that higher numbers of MDSs are present in species with scrambled micronuclear actin I (Hogan et al. 2001) and TEBP-a (Wong and Landweber 2006) than in species with nonscrambled genes. By contrast, extensive fragmentation does not imply for scrambling of the DNA poly-a gene (Chang et al. 2005). To get a better understanding about the evolutionary history of micronuclear genes within hypotrichous ciliates, we determined macronuclear and micronuclear structures of the actin gene from Pseudokeronopsis rubra and Uroleptopsis citrina, which represent a divergent group from previously studied species (Hogan et al. 2001) as defined by SSU rDNA trees (Huang et al. 2014; Yi and Song 2011). We compared our results with previous studies and discussed the evolution of micronuclear actin (MICactin) gene in hypotrichs. MATERIALS AND METHODS Cell culture and DNA extraction The cultures of P. rubra and U. citrina in this study were isolated from marine habitats in China and have been kept in culture since several years ago (described in Huang et al. 2010; Yi et al. 2008). Several cells were picked and cultures were established in autoclaved seawater with rice grains. Subsequently, cells were collected in a 1-liter beaker by filtering through a 20-lm filter to remove large particulate debris. Once cells settled at the bottom of the beaker, the supernatant was discarded and fresh autoclaved seawater was added. These steps were repeated several times to wash the cells and reduce the number of bacteria. After the final wash and removal of the supernatant, the ciliates were starved overnight to digest remaining bacteria within cells and then pelleted by centrifugation at 2655 g for 3 min before DNA extraction. Total genomic DNA of the two species was extracted using the DNeasy Blood & Tissue Kit (Qiagen, cat. no. 69506, Hilden, Germany). Micronuclear DNA was isolated from genomic DNA by gel electrophoresis following the method described in Katz et al. (2003), and purified using the QIAEX II Gel Extraction kit (Qiagen, cat. no. 20021). PCR and cloning Complete macronuclear actin I (MAC-actin) gene sequences of P. rubra and U. citrina were determined by telomere suppression PCR following procedures established by Chang et al. (2004). Conventional PCR aiming to amplify the complete sequences of micronuclear genes failed with gel isolated MIC-DNA or BAL-31 Nuclease (New England Biolabs, cat. no. M0213, Hitchin, UK)-treated MIC-DNA templates, and only macronuclear segments were obtained. We performed walking PCR (SiteFindingPCR) to amplify the MIC-actin segment 13-SFP3 (Fig. 1) of P. rubra (Tan et al. 2005). We also designed MIC-specific primers (Table 1) and paired them with MAC-based primers to amplify the segments 21–22, 23–25 (Fig. 1). For U.
citrina, the micronuclear segments 33–35, 34–35 (Fig. 1) were amplified using the SiteFinding-PCR products as templates. After obtaining the IES sequence, MIC-specific primers and MAC-based primers were used to recover the full length of these genes (Fig. 1). PCR products were cloned into the pMDTM18-T vector (Takara Biotechnology, Dalian, China). M13F and M13R sequencing primers and species-specific internal primers were used for sequencing in the Guangzhou branch of Beijing Genomics Institute (BGI, Beijing, China). Phylogenetic analyses Due to the high ambiguity of the noncoding sequence regions, only the coding sequences of the MAC-actin gene (Table S1), of which the micronuclear versions are available, were used in the phylogenetic analysis. A SSU rDNA tree was also constructed using sequences from GenBank (Table S1). Maximum likelihood analyses, employing the GTR (General Time Reversible) substitution model and 1,000 bootstrap replicates, were conducted via CIPRES Science Gateway (http://www.phylo.org/sub_sections/ portal) using RaxML-HPC v7.2.5 (Stamatakis et al. 2008). RESULTS MAC-actin gene Three and two overlapping PCR products of the MACactin gene were obtained from P. rubra and U. citrina, respectively (P-mac and U-mac, Fig. 1). One to five clones from each segment were sequenced to obtain consensus sequences. These have been submitted to GenBank under the accession numbers: KJ439789 (P. rubra), KJ439788 (U. citrina). Comparing sequences from different cloning products, 13 and 35 segregating sites are detected in the MAC-actin genes of P. rubra and U. citrina, respectively. For P. rubra, one occurs in the 50 leader region, three in the 30 trailer region, and nine in the CDS region. Of these polymorphisms, three are nonsynonymous. In U. citrina, three nucleotide polymorphisms occur in the 50 leader region, one in the 30 trailer region, and 31 fall into the CDS region, with seven being nonsynonymous. The complete MACactin chromosomes (excluding the telomere repeats) are 1,429 and 1,415 bp in P. rubra and U. citrina, respectively. They both encode a putative actin protein of 376 amino acids. Similar to other hypotrichous species, the 50 leader and 30 trailer are AT-rich in both species. MIC-actin gene Three patterns (P-mic-a, P-mic-b, and P-mic-c) of the MICactin gene were observed in P. rubra in the present study. P-mic-a was sequenced in full length by primers 21 and 25, located on the ends of the gene, while the other two patterns were only partially sequenced, likely due to the long insertions of IESs (Fig. 1). Multiple clones (2–5) of each PCR segment were sequenced. The consensus
© 2014 The Author(s) Journal of Eukaryotic Microbiology © 2014 International Society of Protistologists Journal of Eukaryotic Microbiology 2015, 62, 188–195
189
Evolution of the Micronuclear Actin Gene
Chen et al.
Figure 1 Schematic representation of the MIC-actin and MAC-actin structures. MDSs are in blue and numbered, IESs of P-mic-a and U-mic-a are in yellow, IESs of P-mic-b and U-mic-b are in brown, P-mic-c is a recombinant of P-mic-a and P-mic-b, pointer sequences are in maroon. Black boxes represent telomeres, black dots mark the positions of start and stop codons. The IES between MDS3 and MDS 4 of P-mic-a is much shorter than that of P-mic-b and P-mic-c, and the absence sequences are labeled in white. P-mic-a, P-mic-b, P-mic-c: type a, b, c for micronuclear actin gene of Pseudokeronopsis rubra; U-mic-a, U-mic-b: type a, b for micronuclear actin gene of Uroleptopsis citrina; P-mac, U-mac: macronuclear actin gene of Pseudokeronopsis rubra and Uroleptopsis citrina, respectively.
sequences have been deposited in the GenBank database under the accession numbers: KJ439783 (P-mic-a), KJ439784 (P-mic-b), and KJ439785 (P-mic-c), respectively. P-mic-a consists of nine IESs and 10 MDSs in an orthodox order (Fig. 1). Direct repeats (pointers) ranged from 2 to 7 bp at the junctions of an IES and its adjacent MDSs, leaving one copy in the MAC chromosome (Fig. 1). The start codon (ATG) is present in MDS3 and the stop codon (TGA) appears in MDS9 (Fig. 1). Two of the nine IESs (IES2-3 and IES7-8) are small in size and have a low AT content. The other seven IESs are AT-rich (52.80–75.13%) (Table 2), which is consistent with earlier reported IESs in other hypotrichous ciliates. The structure of P-mic-b is similar to that of P-mic-a (Fig. 1). IES1-2 is identical in Pmic-a and P-mic-b, while the lengths and sequences of the other four IESs vary between these two patterns. For instance, IES3-4 of P-mic-a and P-mic-b is 121 and 202 bp long, respectively (Table 2). We also obtained a third pattern of the MIC-actin gene (P-mic-c), which might be generated by a recombination event that happened between P-mic-a and P-mic-b in the region of MDS3 (Fig. 1). However, we cannot exclude the possibility that P-mic-c is an artifact of PCR-mediated recombination. By comparison, the 50 -UTR of the MAC-actin gene (MDS1, MDS2, and 5 nt at the beginning of MDS3) is 97.7–98.9% similar between P-mic-a and P-mic-b. The sequence similarity of CDS (MDS4, MDS5, and main part of MDS3) is 98.7– 99.7%. However, the average IES sequence similarity between P-mic-a and P-mic-b is much lower, only 82.5% (Table 4).
190
In U. citrina, two patterns (U-mic-a, U-mic-b) of the MICactin gene have been determined by generating three and two overlapping PCR products, respectively. The full lengths of these two patterns were amplified using primers designed on both ends of the gene (31 and 35, Fig. 1). Multiple clones (3–4) of each segment were sequenced to obtain consensus sequences, which have been deposited into GenBank under the accession numbers: KJ439786 (Umic-a) and KJ439787 (U-mic-b). Both U-mic-a and U-mic-b are nonscrambled, consisting of six IESs and seven MDSs, with start codon (ATG) in MDS2 and stop codon (TGA) in MDS6 (Fig. 1). The MDSs in the 50 -UTRs and 30 UTRs of the MAC-actin gene are 96.3–97.5% and 98.0– 99.3% similar between U-mic-a and U-mic-b, respectively, while the MDSs in CDS are 96.6–98.2% similar (Table 4). All IESs of U-mic-a and U-mic-b are AT-rich (ranging from 69.06% to 79.35%, Table 3), and divergent in both lengths and sequences between these two patterns (Table 3). Pointers are 5–11 bp in U-mic-a and U-mic-b, and slight sequence variations are found among corresponding pairs of repeats (Table 3). Using U. citrina as a reference, positions of corresponding MDS–IES junctions in P. rubra and U. grandis shift no more than four and six sites, respectively (Fig. 2). Phylogenetic analyses and evolution of MIC-actin gene within Hypotrichia ciliates In the ML tree based on the MAC-actin CDS nucleotide sequences (Fig. 3, left), hypotrichous species are divided
© 2014 The Author(s) Journal of Eukaryotic Microbiology © 2014 International Society of Protistologists Journal of Eukaryotic Microbiology 2015, 62, 188–195
Evolution of the Micronuclear Actin Gene
Chen et al.
CDS, but the positions of Tetmemena, Uroleptus, and Urostyla are different in two trees. By mapping the MAC-actin structures on the phylogenetic tree, we found that all MIC-actin genes in the orders Urostylida and Stichotrichida are nonscrambled, while those in the order Sporadotrichida are scrambled. Genes in the order Stichotrichida have the least number of IESs, while those in the order Sporadotrichida possess the highest number of IESs. Although the gain/loss of IESs occurs frequently even within the same order, the positions of MDS–IES junctions are conserved especially in the CDS. The CDS within the order Urostylida contains six MDS– IES junction positions (U1–U6). The junction positions U1– U4 are conserved in Pseudokeronopsis and Uroleptopsis. The CDS within the family Oxytrichidae (order Sporadotrichida) has 11 MDS–IES junction positions (S1–S11). The junction positions S1–S5 are conserved in at least two species. The MAC-actin structures of all three populations of Oxytricha trifallax are identical, while distinct orthologs are detected for two populations of Stylonychia lemnae.
Table 1. Primer sequences used in this study Primer sequence 50 ?30
Primer name AP12
GTAATACGACTCACTATAGGGCACGCGTGGTCG ACGGCCCGGGCTGGTCCCCAAAACCCCAAAA CCCCAAAA GTAATACGACTCACTATAGGGC ACTATAGGGCACGCGTGGT GACACGCTACTCCAACACACCACCTCGCACA GCGTCCTCAACCTGCAGGBHGCTC GACACGCTACTCCAACACACCA CTCCAACACACCACCTCGCACA CACCTCGCACAGCGTCCTCAA ATCCACATKSHGGCGAAGGT ACCTTCGCCDSMATGTGGAT AACTGGGAYGAYATGGARAAGAT CCCGAGACGCAAGTTATTATTCC GTCCCTGTCCCTACCCTCCCAAT ATATGTCTTACAACCATCCACCTTC AGGGCGTCGTTCCCGGAAAAAGATAC CCCCGATAGACGCTTGTTACTATTC AGAGAGGTGTGCTAAAGATTGA GCAACTCCCTTGAGAAGAAGTATGA TATGAACTCCCAGACGGAAAGGT CATGGTGCCAAAAGATACGAGTTTG GACCTTTCCGTCTGGGAGTTCA GCAACTAACTTATAGATAACCTG
AP1 AP2 Sitefinder SFP1 SFP2 SFP3 11 12 13 21 22 23 25 31 32 33 34 35 36 37
DISCUSSION Evolutionary scheme of germline patterns
into four clades. The fully supported clade of Uroleptopsis and Pseudokeronopsis occupies the basal position, followed by Urostyla. Engelmanniella, a member of the order Stichotrichida, forms a separate branch, followed by Uroleptus, which is sister to the oxytrichids, however, this relationship is not strongly supported (62%). The oxytrichid clade is fully supported, although the monophyly of the genus Oxytricha is not validated. The topology of the SSU rDNA tree is mostly similar to that of the MAC-actin
The micronuclear actin gene is scrambled in all species of the order Sporadotrichida but not in the orders Urostylida and Stichotrichida (Fig. 3). The position of the MDS–IES junction in MIC-actin CDS is conserved within an order (Fig. 3). This indicates that while MIC-actin patterns are conserved within a given order/family. However, they evolve independently among different orders/families. In addition, the scrambling pattern of the MIC-actin gene and the MDS–IES junction positions of Uroleptus pisces, a genus with ambiguous taxonomic assignment but closely related to the family Oxytrichidae (Berger 2006; Foissner et al. 2004), is distinctively different to that of these oxytri-
Table 2. MIC-actin gene characteristics of MDSs, IESs, and pointer sequences of Pseudokeronopsis rubra
MDS n
Length of MDS n
Pointer sequence between MDS n and (n + 1)
1 2
62 41
TA ATTGT
3
a: GAGTACA b: GAGTAC ATC
5
a: 164 b: 163 a: 249 b: 250 222
6 7 8 9 10
97 132 138 160 164
GARCTGC GCG ATTGYCT TGAAT
4
CAGG
Length of IESs between MDS n and (n + 1)
IESs AT content (%)
IES Identity between type a and type b (%)
a: 17 b: 20 a: 121 b: 202 a: 335 b: 336 a: 125 b: 123 189 14 279 128
68.85 a: 35.29 b: 40.00 a: 71.07 b: 72.28 a: 70.15 b: 70.83 a: 52.80 b: 55.28 75.13 14.29 74.91 68.75
100 66.6 50 96.6 89.3
Length of MDS and IES includes one copy of pointer sequences. Nucleotide differences between types are listed separately. a: P-mic-a; b: P-micb. P-mic-c is a recombinant and not shown.
© 2014 The Author(s) Journal of Eukaryotic Microbiology © 2014 International Society of Protistologists Journal of Eukaryotic Microbiology 2015, 62, 188–195
191
Evolution of the Micronuclear Actin Gene
Chen et al.
Table 3. MIC-actin gene characteristics of MDSs, IESs, and pointer sequences of U. citrina
MDS n
Length of MDS n
Pointer sequence between MDS n and (n + 1)
1
99
2
4
a: 165 b: 166 a: 249 b: 248 313
a: YTGTTT b: TTGTTT a: GATGAGTACAT b: GAGTACATT a: AYCCA b: ATCCA GTATGAA
5
138
GCGAT
6
298
a: GAATT b: GRATT
7
153
3
Length of IESs between MDS n and (n + 1) 104 a: b: a: b: a: b: a: b: a: b:
411 423 139 197 276 218 178 171 138 147
IESs AT content (%) a: b: a: b: a: b: a: b: a: b: a: b:
72.12 71.15 75.91 78.01 69.06 72.59 79.35 77.52 70.22 69.59 77.54 76.19
IES identity between type a and type b (%) 53.5 65 36.4 60.6 64.7 64.8
Length of MDS and IES includes one copy of pointer sequences. Nucleotide differences between types are listed separately. a: U-mic-a; b: Umic-b.
Figure 2 Comparison of the locations of MIC-actin MDS, pointer, and IES in three hypotrichous species. IES sequences and most MDS sequences are not shown due to limited space, and lengths of each IES and MDS are listed in Tables 2 and 3. MDS, pointer, and IES are in red, green, and blue colors, respectively. Conserved pointer sequences between two species are underlined. P-mic-a: type a for micronuclear actin gene of Pseudokeronopsis rubra; U-mic-a: type a for micronuclear actin gene of Uroleptopsis citrina; U. grand: Urostyla grandis.
chids (Dalby and Prescott 2004) (Fig. 3). Our results do not support the previous conclusion that the scrambling pattern of MIC-actin is conserved within the subclass Hypotrichia (Hogan et al. 2001). Moreover, in the subclass Hypotrichia, all reported scrambled micronuclear TEBP-a (Mitcham et al. 1992; Prescott et al. 1998; Wong and Landweber 2006) and DNA pol-a genes (Chang et al. 2004, 2005; Hoffman and Prescott 1996, 1997; Landweber et al. 2000) are in the order Sporadotrichida, while those two genes in Urostylida are nonscrambled. Furthermore, for the micronuclear TEBP-a (Chang et al. 2005; Wong and Landweber 2006) and DNA pol-a (Chang et al. 2005) genes, only few MDS–IES junctions at conserved locations are detected in both nonscrambled (order Urostylida) and scrambled (order Sporadotrichida) species. Therefore, we propose that all micronuclear genes of the
192
hypotrichous germline may have evolved independently in different orders/families. Because only two/three urostylid and one/none stichotrich MIC genes have been examined (Fig. 3, Chang et al. 2005; Wong and Landweber 2006), the evolutionary patterns suggested here should be verified by examining the MIC genes of more species in these groups. More MIC gene patterns of orders Urostylida and Stichotrichia are suggested to be investigated in future studies. The numbers and positions of IESs of actin gene varied even within a given order/family (Fig. 3), indicating that IESs are unstable elements that are inserted and removed continually (DuBois and Prescott 1997). The total numbers of MDSs are 3–10 and 7–16 in the order Urostylida (nonscrambled) and Sporadotrichida (scrambled), respectively (Fig. 3). It is clear that extensive fragmentation of the
© 2014 The Author(s) Journal of Eukaryotic Microbiology © 2014 International Society of Protistologists Journal of Eukaryotic Microbiology 2015, 62, 188–195
Evolution of the Micronuclear Actin Gene
Chen et al.
Figure 3 MAC actin ML tree constructed using all three nucleotide positions in the CDS (left), and corresponding SSU rDNA tree (right). Schematic illustration of the MIC-actin structures and pointer distribution of all 14 hypotrichs is shown. Species classification follows modified systems of Lynn (2008) and Adl et al. (2012). MDSs are numbered, and the scrambled and inverted ones are underlined and in red, respectively. Positions of start and stop codons are marked by black dots. Conserved locations of the MDS–IES junctions are in pink rectangles (U1–U4), and U5–U6 are nonconserved locations in Urostylida. S1–S5 indicates the conserved locations of the MDS–IES junctions in Sporadotrichida, and S6–S10 are nonconserved locations.
MIC-actin gene does not imply for scrambling. This is consistent with previous report that the micronuclear DNA pol-a gene of some earlier diverging hypotrichous species is not scrambled, but either highly or moderately fragmented (Chang et al. 2005). By contrast, Hogan et al. (2001) proposed that continuous addition of IESs produces MIC-actin genes with scrambled MDSs, and Wong and Landweber (2006) arrived at the same conclusion for the micronuclear TEBP-a gene. As two more species with nonscrambled MIC-actin genes (P. rubra and U. citrina) are observed in this study, the viewpoint that the addition of IESs produces MIC-actin genes with scrambled MDSs seems to be an artifact of the low sampling of nonscrambled taxa. As revealed in previous investigation (Wong and Landweber 2006), IESs can vastly differ in their sizes and sequences across species in both scrambled and nonscrambled species (Tables 2, 3). It is difficult to infer evolutionary patterns using IESs sequences. However, positions of MDS–IES junctions are conserved and could provide some evolutionary information (Fig. 3). We found positions of MDS–IES junctions between nonscrambled urostylid species are more tightly conserved than those among scrambled sporadotrichid species (Fig. 3), indicat-
ing that the order Sporadotrichida (scrambled) undergoes more frequent IESs insertion and deletion events. Considering that the order Urostylida (nonscrambled) occupies a basal position in the Hypotrichia, it might mean that frequent IESs insertion and deletion is a recent event, and it produces scrambled MIC-actin genes. Epigenetic effects on genome evolution Previous studies have found that UTRs of actin genes have a much higher rate of nucleotide substitution when compared to that of CDSs, both at the interspecies and interpopulation levels (Croft et al. 2003; Dalby and Prescott €llenbeck et al. 2006). This 2004; Katz and Kovner 2010; Mo is because that nucleotide diversity is much higher in CDS than UTRs due to gene selection pressure. By contrast, MDS sequence differences in CDS and UTR are similar among different actin gene copies within populations of P. rubra or U. citrina (Table 4), or within the same individual of Sterkiella nova or O. trifallax (DuBois and Prescott 1997), although both IES sequences and length divergences are detected between different copies of germline genes (Tables 3, 4; Dalby and Prescott 2004). We hypothesize that the proposed macronuclear
© 2014 The Author(s) Journal of Eukaryotic Microbiology © 2014 International Society of Protistologists Journal of Eukaryotic Microbiology 2015, 62, 188–195
193
Evolution of the Micronuclear Actin Gene
Chen et al.
Table 4. Sequence similarity (%) of different MDS and IES regions in MIC-actin gene MIC-actin gene correspond to Pseudokeronopsis rubra Uroleptopsis citrina
50 UTR
CDS
30 UTR
IES (average)
97.7–98.9
98.7–99.7
–
82.5
96.3–97.5
96.6–98.2
98.0–99.3
61.2
RNA-mediated mechanism in O. trifallax (Nowacki et al. 2008) could explain why CDS and UTR are similar among different actin gene copies within populations or individuals. Conjugation between individuals of a given population could result in the two genomes communicating through RNA templates (Nowacki et al. 2008). Micronuclear sequence variation in both UTR and CDS would affect their matching with RNA templates from the old macronucleus during sexual conjugation, restricting the variation rate at a similarly low level. Therefore, the sequence divergence of the UTR is not much higher than that of the CDS within a population/individual. On the other hand, barriers of genetic exchange between different populations (geographic or reproductive isolation) result in a faster evolutionary rate in the noncoding MDS regions, but lower sequence variations in CDS at interspecific and interpopulation levels due to different selective pressures. CONCLUSION In summary, we can draw the following conclusions: (1) the gain or loss of IES is frequent in the subclass Hypotrichia (formerly Stichotrichia), and extensive fragmentation of MIC genes does not always accompany gene scrambling; (2) although the MIC-actin gene is scrambled in species of the order Sporadotrichida, it is nonscrambled in Urostylida and Stichotrichida, which suggests that the MIC-actin gene patterns of hypotrichs may be the result of an independent evolutionary event in different orders; (3) the positions of MDS–IES junctions are largely conserved within orders/families. ACKNOWLEDGMENTS This work was supported by the Natural Science Foundation of China (project no. 31030059, 41006098, 31222050, 31172041). Many thanks are due to Dr. Laura Katz, Smith College, for her protocol on micronuclear DNA extraction, and Dr. Rebecca A. Zufall, University of Houston, for her constructive suggestions on the Manuscript. And we also €der-Kypke, University of Guelph, thank Dr. Michaela Stru Canada, and Dr. Eleni Gentekaki, Dalhousie University, Canada, who improved the English; and two anonymous reviewers and the editor, who give us a lot of constructive suggestions. LITERATURE CITED Adl, S. M., Simpson, A. R., Lane, C. E., Lukes, J., Bass, D., Bowser, S., Brown, M. W., Burki, F., Dunthorn, M., Hampl, V.,
194
Heiss, A., Hoppenrath, M., Lara, E., Gall, L., Lynn, D. H., Mcmanus, H., Mitchell, E., Mozley-Stanridge, S. E., Parfrey, L., Pawloski, J., Rueckert, S., Shadwick, L., Schoch, C. L., Smirnov, A. & Spiegel, F. 2012. The revised classification of eukaryotes. J. Eukaryot. Microbiol., 59:429–493. Baird, S. E. & Klobutcher, L. A. 1991. Differential DNA amplification and copy number control in the hypotrichous ciliate Euplotes crassus. J. Protozool., 38:136–140. Berger, H. 2006. Monograph of the Urostyloidea (Ciliophora, Hypotricha). Monogr. Biol., 85:1–1303. Cavalcanti, A. R. O., Clarke, T. H. & Landweber, L. F. 2005. MDS_IES_DB: a database of macronuclear and micronuclear genes in spirotrichous ciliates. Nucleic Acids Res., 33:D396– D398. Chang, W. J., Stover, N. A., Addis, V. M. & Landweber, L. F. 2004. A micronuclear locus containing three protein-coding genes remains linked during macronuclear development in the spirotrichous ciliate Holosticha. Protist, 155:245–255. Chang, W. J., Bryson, P. D., Liang, H., Shin, M. K. & Landweber, L. F. 2005. The evolutionary origin of a complex scrambled gene. Proc. Natl Acad. Sci. U. S. A., 102:15149–15154. Croft, K. E., Dalby, A. B., Hogan, D. J., Orr, K. E., Hewitt, E. A., Africa, R. J., DuBois, M. L. & Prescott, D. M. 2003. Macronuclear molecules encoding actins in spirotrichs. J. Mol. Evol., 56:341–350. Dalby, A. B. & Prescott, D. M. 2004. The scrambled actin I gene in Uroleptus pisces. Chromosoma, 112:247–254. DuBois, M. L. & Prescott, D. M. 1997. Volatility of internal eliminated segments in germ line genes of hypotrichous ciliates. Mol. Cell. Biol., 17:326–337. Foissner, W., Moon-van der Staay, S., van der Staay, G., Hackstein, J., Krautgartner, W. & Berger, H. 2004. Reconciling classical and molecular phylogenies in the stichotrichines (Ciliophora, Spirotrichea), including new sequences from some rare species. Eur. J. Protistol., 4:265–281. Greslin, A. F., Prescott, D. M., Oka, Y., Loukin, S. H. & Chappell, J. C. 1989. Reordering of nine exons is necessary to form a functional actin gene in Oxytricha nova. Proc. Natl Acad. Sci. USA, 86:6264–6268. Hoffman, D. C. & Prescott, D. M. 1996. The germline gene encoding DNA polymerase a in the hypotrichous ciliate Oxytricha nova is extremely scrambled. Nucleic Acids Res., 24:3337–3340. Hoffman, D. C. & Prescott, D. M. 1997. Phylogenetic relationships among hypotrichous ciliates determined with the macronuclear gene encoding the large, catalytic subunit of DNA polymerase alpha. J. Mol. Evol., 45:301–310. Hogan, D. J., Hewitt, E. A., Orr, K. E., Prescott, D. M. & Muller, K. M. 2001. Evolution of IESs and scrambling in the actin I gene in hypotrichous ciliates. Proc. Natl Acad. Sci. USA, 98:15101–15106. Huang, J., Chen, Z., Song, W. & Berger, H. 2014. Three-gene based phylogeny of the Urostyloidea (Protista, Ciliophora, Hypotricha), with notes on classification of some core taxa. Mol. Phylogenet. Evol., 70:337–347. Huang, J., Yi, Z., Al-Farraj, S. A. & Song, W. 2010. Phylogenetic positions and taxonomic assignments of the systematically controversial genera, Spirotrachelostyla, Uroleptopsis and Tunicothrix (Protozoa, Ciliophora, Stichotrichia) based on small subunit rRNA gene sequences. Syst. Biodiv., 8:409–416. Jahn, C. L. & Klobutcher, L. A. 2002. Genome remodeling in ciliated protozoa. Annu. Rev. Microbiol., 56:489–520. Katz, L. A. & Kovner, A. M. 2010. Alternative processing of scrambled genes generates protein diversity in the ciliate Chilodonella uncinata. J. Zool. Exp., 314:480–488.
© 2014 The Author(s) Journal of Eukaryotic Microbiology © 2014 International Society of Protistologists Journal of Eukaryotic Microbiology 2015, 62, 188–195
Evolution of the Micronuclear Actin Gene
Chen et al.
Katz, L. A., Lasek-Nesselquist, E. & Snoeyenbos-West, O. L. 2003. Structure of the micronuclear alpha-tubulin gene in the phyllopharyngean ciliate Chilodonella uncinata: implications for the evolution of chromosomal processing. Gene, 315:15–19. Landweber, L. F., Kuo, T.-C. & Curtis, E. A. 2000. Evolution and assembly of an extremely scrambled gene. Proc. Natl Acad. Sci. USA, 97:3298–3303. Lynn, D. H. 2008. The Ciliated Protozoa: Characterization, Classification, and Guide to the Literature, 3rd edn. Springer, Dordrecht. Mitcham, J. L., Lynn, A. J. & Prescott, D. M. 1992. Analysis of a scrambled gene: the gene encoding alpha-telomere-binding protein in Oxytricha nova. Genes Dev., 6:788–800. €llenbeck, M., Cavalcanti, A. R. O., Jo €nsson, F., Lipps, H. J. & Mo Landweber, L. F. 2006. Interconversion of germline-limited and somatic DNA in a scrambled gene. J. Mol. Evol., 63:69–73. Nowacki, M., Vijayan, V., Zhou, Y., Schotanus, K., Doak, T. G. & Landweber, L. F. 2008. RNA-mediated epigenetic programming of a genome-rearrangement pathway. Nature, 451:153–158. Prescott, D. M. 1994. The DNA of ciliated protozoa. Microbiol. Rev., 58:233–267. Prescott, J. D., DuBois, M. L. & Prescott, D. M. 1998. Evolution of the scrambled germline gene encoding alpha-telomere binding protein in three hypotrichous ciliates. Chromosoma, 107:293–303. Stamatakis, A., Hoover, P. & Rougemont, J. 2008. A rapid bootstrap algorithm for the RAxML web servers. Syst. Biol., 57:758–771.
Tan, G., Gao, Y., Shi, M., Zhang, X., He, S., Chen, Z. & An, C. 2005. SiteFinding-PCR: a simple and efficient PCR method for chromosome walking. Nucleic Acids Res., 33:e122. Wong, L. C. & Landweber, L. F. 2006. Evolution of programmed DNA rearrangements in a scrambled gene. Mol. Biol. Evol., 23:756–763. Yi, Z., Chen, Z., Warren, A., Roberts, D., Al-Rasheid, K., Miao, M., Gao, S., Shao, C. & Song, W. 2008. Molecular phylogeny of Pseudokeronopsis (Protozoa, Ciliophora, Urostylida), with reconsideration of three closely related species at inter- and intraspecific levels inferred from the small subunit ribosomal RNA gene and the ITS1-5.8S-ITS2 region sequences. J. Zool., 275:268–275. Yi, Z. & Song, W. 2011. Evolution of the order Urostylida (Protozoa, Ciliophora): new hypotheses based on multi-gene information and identification of localized incongruence. PLoS ONE, 6: e17471.
SUPPORTING INFORMATION Additional Supporting Information may be found in the online version of this article: Table S1. GenBank accession numbers of phylogenetic trees. Newly published sequences in the present paper are in bold.
© 2014 The Author(s) Journal of Eukaryotic Microbiology © 2014 International Society of Protistologists Journal of Eukaryotic Microbiology 2015, 62, 188–195
195
The Journal of
Eukaryotic Microbiology
Journal of Eukaryotic Microbiology ISSN 1066-5234
ORIGINAL ARTICLE
Evolution of the Germline Actin Gene in Hypotrichous Ciliates: Multiple Nonscrambled IESs at Extremely Conserved Locations in Two Urostylids Tianbing Chena, Zhenzhen Yia, Jie Huangb & Xiaofeng Lina a Laboratory of Protozoology, School of Life Science, South China Normal University, Guangzhou 510631, China b Key Laboratory of Aquatic Biodiversity and Conservation of Chinese Academy of Sciences, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan 430072, China
Keywords Actin; ciliates; macronuclear; MDS; micronuclear. Correspondence Z. Yi and X. Lin, Key Laboratory of Ecology and Environmental Science in Guangdong Higher Education, South China Normal University, Guangzhou 510631, China Telephone/Fax number: +86 (0) 20-85210644; e-mail: [email protected]; [email protected] Macronuclear (/Micronuclear) actin is abbreviated as MAC(/MIC)-actin. IESn-n + 1 represent the IES between MDSn and MDSn + 1.
ABSTRACT In hypotrichous ciliates, macronuclear chromosomes are gene-sized, and micronuclear genes contain short, noncoding internal eliminated segments (IESs) as well as macronuclear-destined segments (MDSs). In the present study, we characterized the complete macronuclear gene and two to three types of micronuclear actin genes of two urostylid species, i.e. Pseudokeronopsis rubra and Uroleptopsis citrina. Our results show that (1) the gain/loss of IES happens frequently in the subclass Hypotrichia (formerly Stichotrichia), and high fragmentation of germline genes does not imply for gene scrambling; and (2) the micronuclear actin gene is scrambled in the order Sporadotrichida but nonscrambled in the orders Urostylida and Stichotrichida, indicating the independent evolution of MIC-actin gene patterns in different orders of hypotrichs; (3) locations of MDS–IES junctions of micronuclear actin gene in coding regions are conserved among closely related species.
Received: 7 November 2013; revised 16 June 2014; accepted July 8, 2014. doi:10.1111/jeu.12158
CILIATES are unicellular eukaryotes characterized by the presence of cilia and nuclear dimorphism. Each cell contains two types of nuclei: a diploid germline micronucleus (MIC) which is transcriptionally inactive except during sexual conjugation, and a somatic macronucleus (MAC) which is the primary source of gene transcripts (Prescott 1994). The development of a new MAC from a MIC involves a series of chromosomal rearrangements, including DNA elimination, fragmentation, and amplification (Jahn and Klobutcher 2002; Prescott 1994). These rearrangements are extensive in three classes of ciliates: Armophorea, Phyllopharyngea, and Spirotrichea (the focus of this study). Transposons and most intergenic spacer DNA, as well as intragenic spacer DNA, termed internal eliminated segments (IESs) are extensively eliminated from zygotic chromosomes. In spirotrichous ciliates, the remaining DNA segments, called macronuclear-destined segments (MDSs), occupy only 2–5% of the germline genome (Jahn
188
and Klobutcher 2002; Prescott 1994). Assembly of these MDSs generates a MAC with up to 20,000,000 amplified gene-sized chromosomes in the class Spirotrichea (Baird and Klobutcher 1991; Prescott 1994). Macronuclear-destined segments within some micronuclear genes are scrambled in comparison to their linear arrangement in the macronucleus. It is estimated that approximately one-third of the genes in Hypotrichia sensu Adl et al. (2012) (formerly Stichotrichia sensu Lynn 2008), a subclass of Spirotrichea, are scrambled (Cavalcanti et al. 2005). Among them, three genes have been extensively studied: actin I (Dalby and Prescott 2004; Greslin et al. €llenbeck et al. 2006), a-telo1989; Hogan et al. 2001; Mo mere-binding protein (TEBP-a) (Mitcham et al. 1992; Prescott et al. 1998; Wong and Landweber 2006), and DNA polymerase a (DNA pol-a) (Chang et al. 2004, 2005; Hoffman and Prescott 1996, 1997; Landweber et al. 2000). However, conclusions about the evolution of these three
© 2014 The Author(s) Journal of Eukaryotic Microbiology © 2014 International Society of Protistologists Journal of Eukaryotic Microbiology 2015, 62, 188–195
Evolution of the Micronuclear Actin Gene
Chen et al.
genes vary. For example, it is reported that higher numbers of MDSs are present in species with scrambled micronuclear actin I (Hogan et al. 2001) and TEBP-a (Wong and Landweber 2006) than in species with nonscrambled genes. By contrast, extensive fragmentation does not imply for scrambling of the DNA poly-a gene (Chang et al. 2005). To get a better understanding about the evolutionary history of micronuclear genes within hypotrichous ciliates, we determined macronuclear and micronuclear structures of the actin gene from Pseudokeronopsis rubra and Uroleptopsis citrina, which represent a divergent group from previously studied species (Hogan et al. 2001) as defined by SSU rDNA trees (Huang et al. 2014; Yi and Song 2011). We compared our results with previous studies and discussed the evolution of micronuclear actin (MICactin) gene in hypotrichs. MATERIALS AND METHODS Cell culture and DNA extraction The cultures of P. rubra and U. citrina in this study were isolated from marine habitats in China and have been kept in culture since several years ago (described in Huang et al. 2010; Yi et al. 2008). Several cells were picked and cultures were established in autoclaved seawater with rice grains. Subsequently, cells were collected in a 1-liter beaker by filtering through a 20-lm filter to remove large particulate debris. Once cells settled at the bottom of the beaker, the supernatant was discarded and fresh autoclaved seawater was added. These steps were repeated several times to wash the cells and reduce the number of bacteria. After the final wash and removal of the supernatant, the ciliates were starved overnight to digest remaining bacteria within cells and then pelleted by centrifugation at 2655 g for 3 min before DNA extraction. Total genomic DNA of the two species was extracted using the DNeasy Blood & Tissue Kit (Qiagen, cat. no. 69506, Hilden, Germany). Micronuclear DNA was isolated from genomic DNA by gel electrophoresis following the method described in Katz et al. (2003), and purified using the QIAEX II Gel Extraction kit (Qiagen, cat. no. 20021). PCR and cloning Complete macronuclear actin I (MAC-actin) gene sequences of P. rubra and U. citrina were determined by telomere suppression PCR following procedures established by Chang et al. (2004). Conventional PCR aiming to amplify the complete sequences of micronuclear genes failed with gel isolated MIC-DNA or BAL-31 Nuclease (New England Biolabs, cat. no. M0213, Hitchin, UK)-treated MIC-DNA templates, and only macronuclear segments were obtained. We performed walking PCR (SiteFindingPCR) to amplify the MIC-actin segment 13-SFP3 (Fig. 1) of P. rubra (Tan et al. 2005). We also designed MIC-specific primers (Table 1) and paired them with MAC-based primers to amplify the segments 21–22, 23–25 (Fig. 1). For U.
citrina, the micronuclear segments 33–35, 34–35 (Fig. 1) were amplified using the SiteFinding-PCR products as templates. After obtaining the IES sequence, MIC-specific primers and MAC-based primers were used to recover the full length of these genes (Fig. 1). PCR products were cloned into the pMDTM18-T vector (Takara Biotechnology, Dalian, China). M13F and M13R sequencing primers and species-specific internal primers were used for sequencing in the Guangzhou branch of Beijing Genomics Institute (BGI, Beijing, China). Phylogenetic analyses Due to the high ambiguity of the noncoding sequence regions, only the coding sequences of the MAC-actin gene (Table S1), of which the micronuclear versions are available, were used in the phylogenetic analysis. A SSU rDNA tree was also constructed using sequences from GenBank (Table S1). Maximum likelihood analyses, employing the GTR (General Time Reversible) substitution model and 1,000 bootstrap replicates, were conducted via CIPRES Science Gateway (http://www.phylo.org/sub_sections/ portal) using RaxML-HPC v7.2.5 (Stamatakis et al. 2008). RESULTS MAC-actin gene Three and two overlapping PCR products of the MACactin gene were obtained from P. rubra and U. citrina, respectively (P-mac and U-mac, Fig. 1). One to five clones from each segment were sequenced to obtain consensus sequences. These have been submitted to GenBank under the accession numbers: KJ439789 (P. rubra), KJ439788 (U. citrina). Comparing sequences from different cloning products, 13 and 35 segregating sites are detected in the MAC-actin genes of P. rubra and U. citrina, respectively. For P. rubra, one occurs in the 50 leader region, three in the 30 trailer region, and nine in the CDS region. Of these polymorphisms, three are nonsynonymous. In U. citrina, three nucleotide polymorphisms occur in the 50 leader region, one in the 30 trailer region, and 31 fall into the CDS region, with seven being nonsynonymous. The complete MACactin chromosomes (excluding the telomere repeats) are 1,429 and 1,415 bp in P. rubra and U. citrina, respectively. They both encode a putative actin protein of 376 amino acids. Similar to other hypotrichous species, the 50 leader and 30 trailer are AT-rich in both species. MIC-actin gene Three patterns (P-mic-a, P-mic-b, and P-mic-c) of the MICactin gene were observed in P. rubra in the present study. P-mic-a was sequenced in full length by primers 21 and 25, located on the ends of the gene, while the other two patterns were only partially sequenced, likely due to the long insertions of IESs (Fig. 1). Multiple clones (2–5) of each PCR segment were sequenced. The consensus
© 2014 The Author(s) Journal of Eukaryotic Microbiology © 2014 International Society of Protistologists Journal of Eukaryotic Microbiology 2015, 62, 188–195
189
Evolution of the Micronuclear Actin Gene
Chen et al.
Figure 1 Schematic representation of the MIC-actin and MAC-actin structures. MDSs are in blue and numbered, IESs of P-mic-a and U-mic-a are in yellow, IESs of P-mic-b and U-mic-b are in brown, P-mic-c is a recombinant of P-mic-a and P-mic-b, pointer sequences are in maroon. Black boxes represent telomeres, black dots mark the positions of start and stop codons. The IES between MDS3 and MDS 4 of P-mic-a is much shorter than that of P-mic-b and P-mic-c, and the absence sequences are labeled in white. P-mic-a, P-mic-b, P-mic-c: type a, b, c for micronuclear actin gene of Pseudokeronopsis rubra; U-mic-a, U-mic-b: type a, b for micronuclear actin gene of Uroleptopsis citrina; P-mac, U-mac: macronuclear actin gene of Pseudokeronopsis rubra and Uroleptopsis citrina, respectively.
sequences have been deposited in the GenBank database under the accession numbers: KJ439783 (P-mic-a), KJ439784 (P-mic-b), and KJ439785 (P-mic-c), respectively. P-mic-a consists of nine IESs and 10 MDSs in an orthodox order (Fig. 1). Direct repeats (pointers) ranged from 2 to 7 bp at the junctions of an IES and its adjacent MDSs, leaving one copy in the MAC chromosome (Fig. 1). The start codon (ATG) is present in MDS3 and the stop codon (TGA) appears in MDS9 (Fig. 1). Two of the nine IESs (IES2-3 and IES7-8) are small in size and have a low AT content. The other seven IESs are AT-rich (52.80–75.13%) (Table 2), which is consistent with earlier reported IESs in other hypotrichous ciliates. The structure of P-mic-b is similar to that of P-mic-a (Fig. 1). IES1-2 is identical in Pmic-a and P-mic-b, while the lengths and sequences of the other four IESs vary between these two patterns. For instance, IES3-4 of P-mic-a and P-mic-b is 121 and 202 bp long, respectively (Table 2). We also obtained a third pattern of the MIC-actin gene (P-mic-c), which might be generated by a recombination event that happened between P-mic-a and P-mic-b in the region of MDS3 (Fig. 1). However, we cannot exclude the possibility that P-mic-c is an artifact of PCR-mediated recombination. By comparison, the 50 -UTR of the MAC-actin gene (MDS1, MDS2, and 5 nt at the beginning of MDS3) is 97.7–98.9% similar between P-mic-a and P-mic-b. The sequence similarity of CDS (MDS4, MDS5, and main part of MDS3) is 98.7– 99.7%. However, the average IES sequence similarity between P-mic-a and P-mic-b is much lower, only 82.5% (Table 4).
190
In U. citrina, two patterns (U-mic-a, U-mic-b) of the MICactin gene have been determined by generating three and two overlapping PCR products, respectively. The full lengths of these two patterns were amplified using primers designed on both ends of the gene (31 and 35, Fig. 1). Multiple clones (3–4) of each segment were sequenced to obtain consensus sequences, which have been deposited into GenBank under the accession numbers: KJ439786 (Umic-a) and KJ439787 (U-mic-b). Both U-mic-a and U-mic-b are nonscrambled, consisting of six IESs and seven MDSs, with start codon (ATG) in MDS2 and stop codon (TGA) in MDS6 (Fig. 1). The MDSs in the 50 -UTRs and 30 UTRs of the MAC-actin gene are 96.3–97.5% and 98.0– 99.3% similar between U-mic-a and U-mic-b, respectively, while the MDSs in CDS are 96.6–98.2% similar (Table 4). All IESs of U-mic-a and U-mic-b are AT-rich (ranging from 69.06% to 79.35%, Table 3), and divergent in both lengths and sequences between these two patterns (Table 3). Pointers are 5–11 bp in U-mic-a and U-mic-b, and slight sequence variations are found among corresponding pairs of repeats (Table 3). Using U. citrina as a reference, positions of corresponding MDS–IES junctions in P. rubra and U. grandis shift no more than four and six sites, respectively (Fig. 2). Phylogenetic analyses and evolution of MIC-actin gene within Hypotrichia ciliates In the ML tree based on the MAC-actin CDS nucleotide sequences (Fig. 3, left), hypotrichous species are divided
© 2014 The Author(s) Journal of Eukaryotic Microbiology © 2014 International Society of Protistologists Journal of Eukaryotic Microbiology 2015, 62, 188–195
Evolution of the Micronuclear Actin Gene
Chen et al.
CDS, but the positions of Tetmemena, Uroleptus, and Urostyla are different in two trees. By mapping the MAC-actin structures on the phylogenetic tree, we found that all MIC-actin genes in the orders Urostylida and Stichotrichida are nonscrambled, while those in the order Sporadotrichida are scrambled. Genes in the order Stichotrichida have the least number of IESs, while those in the order Sporadotrichida possess the highest number of IESs. Although the gain/loss of IESs occurs frequently even within the same order, the positions of MDS–IES junctions are conserved especially in the CDS. The CDS within the order Urostylida contains six MDS– IES junction positions (U1–U6). The junction positions U1– U4 are conserved in Pseudokeronopsis and Uroleptopsis. The CDS within the family Oxytrichidae (order Sporadotrichida) has 11 MDS–IES junction positions (S1–S11). The junction positions S1–S5 are conserved in at least two species. The MAC-actin structures of all three populations of Oxytricha trifallax are identical, while distinct orthologs are detected for two populations of Stylonychia lemnae.
Table 1. Primer sequences used in this study Primer sequence 50 ?30
Primer name AP12
GTAATACGACTCACTATAGGGCACGCGTGGTCG ACGGCCCGGGCTGGTCCCCAAAACCCCAAAA CCCCAAAA GTAATACGACTCACTATAGGGC ACTATAGGGCACGCGTGGT GACACGCTACTCCAACACACCACCTCGCACA GCGTCCTCAACCTGCAGGBHGCTC GACACGCTACTCCAACACACCA CTCCAACACACCACCTCGCACA CACCTCGCACAGCGTCCTCAA ATCCACATKSHGGCGAAGGT ACCTTCGCCDSMATGTGGAT AACTGGGAYGAYATGGARAAGAT CCCGAGACGCAAGTTATTATTCC GTCCCTGTCCCTACCCTCCCAAT ATATGTCTTACAACCATCCACCTTC AGGGCGTCGTTCCCGGAAAAAGATAC CCCCGATAGACGCTTGTTACTATTC AGAGAGGTGTGCTAAAGATTGA GCAACTCCCTTGAGAAGAAGTATGA TATGAACTCCCAGACGGAAAGGT CATGGTGCCAAAAGATACGAGTTTG GACCTTTCCGTCTGGGAGTTCA GCAACTAACTTATAGATAACCTG
AP1 AP2 Sitefinder SFP1 SFP2 SFP3 11 12 13 21 22 23 25 31 32 33 34 35 36 37
DISCUSSION Evolutionary scheme of germline patterns
into four clades. The fully supported clade of Uroleptopsis and Pseudokeronopsis occupies the basal position, followed by Urostyla. Engelmanniella, a member of the order Stichotrichida, forms a separate branch, followed by Uroleptus, which is sister to the oxytrichids, however, this relationship is not strongly supported (62%). The oxytrichid clade is fully supported, although the monophyly of the genus Oxytricha is not validated. The topology of the SSU rDNA tree is mostly similar to that of the MAC-actin
The micronuclear actin gene is scrambled in all species of the order Sporadotrichida but not in the orders Urostylida and Stichotrichida (Fig. 3). The position of the MDS–IES junction in MIC-actin CDS is conserved within an order (Fig. 3). This indicates that while MIC-actin patterns are conserved within a given order/family. However, they evolve independently among different orders/families. In addition, the scrambling pattern of the MIC-actin gene and the MDS–IES junction positions of Uroleptus pisces, a genus with ambiguous taxonomic assignment but closely related to the family Oxytrichidae (Berger 2006; Foissner et al. 2004), is distinctively different to that of these oxytri-
Table 2. MIC-actin gene characteristics of MDSs, IESs, and pointer sequences of Pseudokeronopsis rubra
MDS n
Length of MDS n
Pointer sequence between MDS n and (n + 1)
1 2
62 41
TA ATTGT
3
a: GAGTACA b: GAGTAC ATC
5
a: 164 b: 163 a: 249 b: 250 222
6 7 8 9 10
97 132 138 160 164
GARCTGC GCG ATTGYCT TGAAT
4
CAGG
Length of IESs between MDS n and (n + 1)
IESs AT content (%)
IES Identity between type a and type b (%)
a: 17 b: 20 a: 121 b: 202 a: 335 b: 336 a: 125 b: 123 189 14 279 128
68.85 a: 35.29 b: 40.00 a: 71.07 b: 72.28 a: 70.15 b: 70.83 a: 52.80 b: 55.28 75.13 14.29 74.91 68.75
100 66.6 50 96.6 89.3
Length of MDS and IES includes one copy of pointer sequences. Nucleotide differences between types are listed separately. a: P-mic-a; b: P-micb. P-mic-c is a recombinant and not shown.
© 2014 The Author(s) Journal of Eukaryotic Microbiology © 2014 International Society of Protistologists Journal of Eukaryotic Microbiology 2015, 62, 188–195
191
Evolution of the Micronuclear Actin Gene
Chen et al.
Table 3. MIC-actin gene characteristics of MDSs, IESs, and pointer sequences of U. citrina
MDS n
Length of MDS n
Pointer sequence between MDS n and (n + 1)
1
99
2
4
a: 165 b: 166 a: 249 b: 248 313
a: YTGTTT b: TTGTTT a: GATGAGTACAT b: GAGTACATT a: AYCCA b: ATCCA GTATGAA
5
138
GCGAT
6
298
a: GAATT b: GRATT
7
153
3
Length of IESs between MDS n and (n + 1) 104 a: b: a: b: a: b: a: b: a: b:
411 423 139 197 276 218 178 171 138 147
IESs AT content (%) a: b: a: b: a: b: a: b: a: b: a: b:
72.12 71.15 75.91 78.01 69.06 72.59 79.35 77.52 70.22 69.59 77.54 76.19
IES identity between type a and type b (%) 53.5 65 36.4 60.6 64.7 64.8
Length of MDS and IES includes one copy of pointer sequences. Nucleotide differences between types are listed separately. a: U-mic-a; b: Umic-b.
Figure 2 Comparison of the locations of MIC-actin MDS, pointer, and IES in three hypotrichous species. IES sequences and most MDS sequences are not shown due to limited space, and lengths of each IES and MDS are listed in Tables 2 and 3. MDS, pointer, and IES are in red, green, and blue colors, respectively. Conserved pointer sequences between two species are underlined. P-mic-a: type a for micronuclear actin gene of Pseudokeronopsis rubra; U-mic-a: type a for micronuclear actin gene of Uroleptopsis citrina; U. grand: Urostyla grandis.
chids (Dalby and Prescott 2004) (Fig. 3). Our results do not support the previous conclusion that the scrambling pattern of MIC-actin is conserved within the subclass Hypotrichia (Hogan et al. 2001). Moreover, in the subclass Hypotrichia, all reported scrambled micronuclear TEBP-a (Mitcham et al. 1992; Prescott et al. 1998; Wong and Landweber 2006) and DNA pol-a genes (Chang et al. 2004, 2005; Hoffman and Prescott 1996, 1997; Landweber et al. 2000) are in the order Sporadotrichida, while those two genes in Urostylida are nonscrambled. Furthermore, for the micronuclear TEBP-a (Chang et al. 2005; Wong and Landweber 2006) and DNA pol-a (Chang et al. 2005) genes, only few MDS–IES junctions at conserved locations are detected in both nonscrambled (order Urostylida) and scrambled (order Sporadotrichida) species. Therefore, we propose that all micronuclear genes of the
192
hypotrichous germline may have evolved independently in different orders/families. Because only two/three urostylid and one/none stichotrich MIC genes have been examined (Fig. 3, Chang et al. 2005; Wong and Landweber 2006), the evolutionary patterns suggested here should be verified by examining the MIC genes of more species in these groups. More MIC gene patterns of orders Urostylida and Stichotrichia are suggested to be investigated in future studies. The numbers and positions of IESs of actin gene varied even within a given order/family (Fig. 3), indicating that IESs are unstable elements that are inserted and removed continually (DuBois and Prescott 1997). The total numbers of MDSs are 3–10 and 7–16 in the order Urostylida (nonscrambled) and Sporadotrichida (scrambled), respectively (Fig. 3). It is clear that extensive fragmentation of the
© 2014 The Author(s) Journal of Eukaryotic Microbiology © 2014 International Society of Protistologists Journal of Eukaryotic Microbiology 2015, 62, 188–195
Evolution of the Micronuclear Actin Gene
Chen et al.
Figure 3 MAC actin ML tree constructed using all three nucleotide positions in the CDS (left), and corresponding SSU rDNA tree (right). Schematic illustration of the MIC-actin structures and pointer distribution of all 14 hypotrichs is shown. Species classification follows modified systems of Lynn (2008) and Adl et al. (2012). MDSs are numbered, and the scrambled and inverted ones are underlined and in red, respectively. Positions of start and stop codons are marked by black dots. Conserved locations of the MDS–IES junctions are in pink rectangles (U1–U4), and U5–U6 are nonconserved locations in Urostylida. S1–S5 indicates the conserved locations of the MDS–IES junctions in Sporadotrichida, and S6–S10 are nonconserved locations.
MIC-actin gene does not imply for scrambling. This is consistent with previous report that the micronuclear DNA pol-a gene of some earlier diverging hypotrichous species is not scrambled, but either highly or moderately fragmented (Chang et al. 2005). By contrast, Hogan et al. (2001) proposed that continuous addition of IESs produces MIC-actin genes with scrambled MDSs, and Wong and Landweber (2006) arrived at the same conclusion for the micronuclear TEBP-a gene. As two more species with nonscrambled MIC-actin genes (P. rubra and U. citrina) are observed in this study, the viewpoint that the addition of IESs produces MIC-actin genes with scrambled MDSs seems to be an artifact of the low sampling of nonscrambled taxa. As revealed in previous investigation (Wong and Landweber 2006), IESs can vastly differ in their sizes and sequences across species in both scrambled and nonscrambled species (Tables 2, 3). It is difficult to infer evolutionary patterns using IESs sequences. However, positions of MDS–IES junctions are conserved and could provide some evolutionary information (Fig. 3). We found positions of MDS–IES junctions between nonscrambled urostylid species are more tightly conserved than those among scrambled sporadotrichid species (Fig. 3), indicat-
ing that the order Sporadotrichida (scrambled) undergoes more frequent IESs insertion and deletion events. Considering that the order Urostylida (nonscrambled) occupies a basal position in the Hypotrichia, it might mean that frequent IESs insertion and deletion is a recent event, and it produces scrambled MIC-actin genes. Epigenetic effects on genome evolution Previous studies have found that UTRs of actin genes have a much higher rate of nucleotide substitution when compared to that of CDSs, both at the interspecies and interpopulation levels (Croft et al. 2003; Dalby and Prescott €llenbeck et al. 2006). This 2004; Katz and Kovner 2010; Mo is because that nucleotide diversity is much higher in CDS than UTRs due to gene selection pressure. By contrast, MDS sequence differences in CDS and UTR are similar among different actin gene copies within populations of P. rubra or U. citrina (Table 4), or within the same individual of Sterkiella nova or O. trifallax (DuBois and Prescott 1997), although both IES sequences and length divergences are detected between different copies of germline genes (Tables 3, 4; Dalby and Prescott 2004). We hypothesize that the proposed macronuclear
© 2014 The Author(s) Journal of Eukaryotic Microbiology © 2014 International Society of Protistologists Journal of Eukaryotic Microbiology 2015, 62, 188–195
193
Evolution of the Micronuclear Actin Gene
Chen et al.
Table 4. Sequence similarity (%) of different MDS and IES regions in MIC-actin gene MIC-actin gene correspond to Pseudokeronopsis rubra Uroleptopsis citrina
50 UTR
CDS
30 UTR
IES (average)
97.7–98.9
98.7–99.7
–
82.5
96.3–97.5
96.6–98.2
98.0–99.3
61.2
RNA-mediated mechanism in O. trifallax (Nowacki et al. 2008) could explain why CDS and UTR are similar among different actin gene copies within populations or individuals. Conjugation between individuals of a given population could result in the two genomes communicating through RNA templates (Nowacki et al. 2008). Micronuclear sequence variation in both UTR and CDS would affect their matching with RNA templates from the old macronucleus during sexual conjugation, restricting the variation rate at a similarly low level. Therefore, the sequence divergence of the UTR is not much higher than that of the CDS within a population/individual. On the other hand, barriers of genetic exchange between different populations (geographic or reproductive isolation) result in a faster evolutionary rate in the noncoding MDS regions, but lower sequence variations in CDS at interspecific and interpopulation levels due to different selective pressures. CONCLUSION In summary, we can draw the following conclusions: (1) the gain or loss of IES is frequent in the subclass Hypotrichia (formerly Stichotrichia), and extensive fragmentation of MIC genes does not always accompany gene scrambling; (2) although the MIC-actin gene is scrambled in species of the order Sporadotrichida, it is nonscrambled in Urostylida and Stichotrichida, which suggests that the MIC-actin gene patterns of hypotrichs may be the result of an independent evolutionary event in different orders; (3) the positions of MDS–IES junctions are largely conserved within orders/families. ACKNOWLEDGMENTS This work was supported by the Natural Science Foundation of China (project no. 31030059, 41006098, 31222050, 31172041). Many thanks are due to Dr. Laura Katz, Smith College, for her protocol on micronuclear DNA extraction, and Dr. Rebecca A. Zufall, University of Houston, for her constructive suggestions on the Manuscript. And we also €der-Kypke, University of Guelph, thank Dr. Michaela Stru Canada, and Dr. Eleni Gentekaki, Dalhousie University, Canada, who improved the English; and two anonymous reviewers and the editor, who give us a lot of constructive suggestions. LITERATURE CITED Adl, S. M., Simpson, A. R., Lane, C. E., Lukes, J., Bass, D., Bowser, S., Brown, M. W., Burki, F., Dunthorn, M., Hampl, V.,
194
Heiss, A., Hoppenrath, M., Lara, E., Gall, L., Lynn, D. H., Mcmanus, H., Mitchell, E., Mozley-Stanridge, S. E., Parfrey, L., Pawloski, J., Rueckert, S., Shadwick, L., Schoch, C. L., Smirnov, A. & Spiegel, F. 2012. The revised classification of eukaryotes. J. Eukaryot. Microbiol., 59:429–493. Baird, S. E. & Klobutcher, L. A. 1991. Differential DNA amplification and copy number control in the hypotrichous ciliate Euplotes crassus. J. Protozool., 38:136–140. Berger, H. 2006. Monograph of the Urostyloidea (Ciliophora, Hypotricha). Monogr. Biol., 85:1–1303. Cavalcanti, A. R. O., Clarke, T. H. & Landweber, L. F. 2005. MDS_IES_DB: a database of macronuclear and micronuclear genes in spirotrichous ciliates. Nucleic Acids Res., 33:D396– D398. Chang, W. J., Stover, N. A., Addis, V. M. & Landweber, L. F. 2004. A micronuclear locus containing three protein-coding genes remains linked during macronuclear development in the spirotrichous ciliate Holosticha. Protist, 155:245–255. Chang, W. J., Bryson, P. D., Liang, H., Shin, M. K. & Landweber, L. F. 2005. The evolutionary origin of a complex scrambled gene. Proc. Natl Acad. Sci. U. S. A., 102:15149–15154. Croft, K. E., Dalby, A. B., Hogan, D. J., Orr, K. E., Hewitt, E. A., Africa, R. J., DuBois, M. L. & Prescott, D. M. 2003. Macronuclear molecules encoding actins in spirotrichs. J. Mol. Evol., 56:341–350. Dalby, A. B. & Prescott, D. M. 2004. The scrambled actin I gene in Uroleptus pisces. Chromosoma, 112:247–254. DuBois, M. L. & Prescott, D. M. 1997. Volatility of internal eliminated segments in germ line genes of hypotrichous ciliates. Mol. Cell. Biol., 17:326–337. Foissner, W., Moon-van der Staay, S., van der Staay, G., Hackstein, J., Krautgartner, W. & Berger, H. 2004. Reconciling classical and molecular phylogenies in the stichotrichines (Ciliophora, Spirotrichea), including new sequences from some rare species. Eur. J. Protistol., 4:265–281. Greslin, A. F., Prescott, D. M., Oka, Y., Loukin, S. H. & Chappell, J. C. 1989. Reordering of nine exons is necessary to form a functional actin gene in Oxytricha nova. Proc. Natl Acad. Sci. USA, 86:6264–6268. Hoffman, D. C. & Prescott, D. M. 1996. The germline gene encoding DNA polymerase a in the hypotrichous ciliate Oxytricha nova is extremely scrambled. Nucleic Acids Res., 24:3337–3340. Hoffman, D. C. & Prescott, D. M. 1997. Phylogenetic relationships among hypotrichous ciliates determined with the macronuclear gene encoding the large, catalytic subunit of DNA polymerase alpha. J. Mol. Evol., 45:301–310. Hogan, D. J., Hewitt, E. A., Orr, K. E., Prescott, D. M. & Muller, K. M. 2001. Evolution of IESs and scrambling in the actin I gene in hypotrichous ciliates. Proc. Natl Acad. Sci. USA, 98:15101–15106. Huang, J., Chen, Z., Song, W. & Berger, H. 2014. Three-gene based phylogeny of the Urostyloidea (Protista, Ciliophora, Hypotricha), with notes on classification of some core taxa. Mol. Phylogenet. Evol., 70:337–347. Huang, J., Yi, Z., Al-Farraj, S. A. & Song, W. 2010. Phylogenetic positions and taxonomic assignments of the systematically controversial genera, Spirotrachelostyla, Uroleptopsis and Tunicothrix (Protozoa, Ciliophora, Stichotrichia) based on small subunit rRNA gene sequences. Syst. Biodiv., 8:409–416. Jahn, C. L. & Klobutcher, L. A. 2002. Genome remodeling in ciliated protozoa. Annu. Rev. Microbiol., 56:489–520. Katz, L. A. & Kovner, A. M. 2010. Alternative processing of scrambled genes generates protein diversity in the ciliate Chilodonella uncinata. J. Zool. Exp., 314:480–488.
© 2014 The Author(s) Journal of Eukaryotic Microbiology © 2014 International Society of Protistologists Journal of Eukaryotic Microbiology 2015, 62, 188–195
Evolution of the Micronuclear Actin Gene
Chen et al.
Katz, L. A., Lasek-Nesselquist, E. & Snoeyenbos-West, O. L. 2003. Structure of the micronuclear alpha-tubulin gene in the phyllopharyngean ciliate Chilodonella uncinata: implications for the evolution of chromosomal processing. Gene, 315:15–19. Landweber, L. F., Kuo, T.-C. & Curtis, E. A. 2000. Evolution and assembly of an extremely scrambled gene. Proc. Natl Acad. Sci. USA, 97:3298–3303. Lynn, D. H. 2008. The Ciliated Protozoa: Characterization, Classification, and Guide to the Literature, 3rd edn. Springer, Dordrecht. Mitcham, J. L., Lynn, A. J. & Prescott, D. M. 1992. Analysis of a scrambled gene: the gene encoding alpha-telomere-binding protein in Oxytricha nova. Genes Dev., 6:788–800. €llenbeck, M., Cavalcanti, A. R. O., Jo €nsson, F., Lipps, H. J. & Mo Landweber, L. F. 2006. Interconversion of germline-limited and somatic DNA in a scrambled gene. J. Mol. Evol., 63:69–73. Nowacki, M., Vijayan, V., Zhou, Y., Schotanus, K., Doak, T. G. & Landweber, L. F. 2008. RNA-mediated epigenetic programming of a genome-rearrangement pathway. Nature, 451:153–158. Prescott, D. M. 1994. The DNA of ciliated protozoa. Microbiol. Rev., 58:233–267. Prescott, J. D., DuBois, M. L. & Prescott, D. M. 1998. Evolution of the scrambled germline gene encoding alpha-telomere binding protein in three hypotrichous ciliates. Chromosoma, 107:293–303. Stamatakis, A., Hoover, P. & Rougemont, J. 2008. A rapid bootstrap algorithm for the RAxML web servers. Syst. Biol., 57:758–771.
Tan, G., Gao, Y., Shi, M., Zhang, X., He, S., Chen, Z. & An, C. 2005. SiteFinding-PCR: a simple and efficient PCR method for chromosome walking. Nucleic Acids Res., 33:e122. Wong, L. C. & Landweber, L. F. 2006. Evolution of programmed DNA rearrangements in a scrambled gene. Mol. Biol. Evol., 23:756–763. Yi, Z., Chen, Z., Warren, A., Roberts, D., Al-Rasheid, K., Miao, M., Gao, S., Shao, C. & Song, W. 2008. Molecular phylogeny of Pseudokeronopsis (Protozoa, Ciliophora, Urostylida), with reconsideration of three closely related species at inter- and intraspecific levels inferred from the small subunit ribosomal RNA gene and the ITS1-5.8S-ITS2 region sequences. J. Zool., 275:268–275. Yi, Z. & Song, W. 2011. Evolution of the order Urostylida (Protozoa, Ciliophora): new hypotheses based on multi-gene information and identification of localized incongruence. PLoS ONE, 6: e17471.
SUPPORTING INFORMATION Additional Supporting Information may be found in the online version of this article: Table S1. GenBank accession numbers of phylogenetic trees. Newly published sequences in the present paper are in bold.
© 2014 The Author(s) Journal of Eukaryotic Microbiology © 2014 International Society of Protistologists Journal of Eukaryotic Microbiology 2015, 62, 188–195
195
