DOI: 10.7589/2013-05-121
Journal of Wildlife Diseases, 50(2), 2014, pp. 288–296 # Wildlife Disease Association 2014
EVIDENCE OF PSITTACINE BEAK AND FEATHER DISEASE VIRUS SPILLOVER INTO WILD CRITICALLY ENDANGERED ORANGEBELLIED PARROTS (NEOPHEMA CHRYSOGASTER) Andrew Peters,1 Edward I. Patterson,1 Barry G. B. Baker,2 Mark Holdsworth,3 Subir Sarker,1 Seyed A. Ghorashi,1 and Shane R. Raidal1,4 1
School of Animal and Veterinary Sciences, E. H. Graham Centre for Agricultural Innovation, Charles Sturt University, Boorooma St., Wagga Wagga, New South Wales 2678, Australia 2 Institute of Marine and Antarctic Studies, University of Tasmania, Private Bag 22, Hobart, Tasmania 7001, Australia 3 Biodiversity Conservation Branch, Department of Primary Industries, Parks, Water and Environment, 134 Macquarie St., Hobart, Tasmania 7001, Australia 4 Corresponding author (email: [email protected])
We report the recent emergence of a novel beak and feather disease virus (BFDV) genotype in the last remaining wild population of the critically endangered Orange-bellied Parrot (Neophema chrysogaster). This virus poses a significant threat to the recovery of the species and potentially its survival in the wild. We used PCR to detect BFDV in the blood of three psittacine beak and feather disease (PBFD)–affected wild Orange-bellied Parrot fledglings captured as founders for an existing captive breeding recovery program. Complete BFDV genome sequence data from one of these birds demonstrating a 1,993-nucleotide-long read encompass the entire circular genome. Maximum-likelihood (ML) and neighbor-joining (NJ) phylogenetic analysis supported the solitary position of this viral isolate in a genetically isolated branch of BFDV. On Rep gene sequencing, a homologous genotype was present in a second wild orange-bellied parrot and the third bird was infected with a distantly related genotype. These viruses have newly appeared in a population that has been intensively monitored for BFDV for the last 13 yr. The detection of two distinct lineages of BFDV in the remnant wild population of Orange-bellied Parrots, consisting of fewer than 50 birds, suggests a role for other parrot species as a reservoir for infection by spillover into this critically endangered species. The potential for such a scenario to contribute to the extinction of a remnant wild animal population is supported by epidemiologic theory. Key words: Circovirus, PBFD, psittacine beak and feather disease, threatened species, wildlife disease.
ABSTRACT:
by histopathologic examination. Chronic latent infection with few clinical signs of feather pathology can occur in more resistant species such as lorikeets and neotropical parrots, with the latter seldom developing clinical PBFD. Nevertheless, affected birds are highly susceptible to secondary infections because of immunosuppression, and it is this aspect of the disease that can degrade flock health and immunologic fitness. The etiologic agent of PBFD, beak and feather disease virus (BFDV), is a member of the Circoviridae and one of the smallest viruses known to exist in terms of both physicochemical and genetic characteristics. BFDV has a relatively simple but compact circular single-stranded DNA (ssDNA) genome of approximately 2,000 nucleotides encoding two proteins, the
INTRODUCTION
Psittacine beak and feather disease (PBFD) is a chronic, debilitating, and ultimately fatal disease of Psittaciformes primarily involving the integument, alimentary, and immune systems of affected birds. In most psittacine bird species chronic infection and the development of clinical signs are associated with high levels of morbidity and eventual mortality. The disease can be expressed either acutely, ranging from sudden death, particularly in highly susceptible species such as the Gang Gang Cockatoo (Callocephalon fimbriatum), or with a chronic prolonged course of feather dystrophy ultimately leading to mortality (Perry, 1981). In Neophema and Psephotus parrots feather lesions may be subtle and best detectable 288
PETERS ET AL.—ORANGE-BELLIED PARROT, BEAK AND FEATHER DISEASE VIRUS
replication initiator protein (Rep) required for the initiation of replication and the capsid protein (Cap). The small genome of the virus facilitates whole-genome viral epidemiologic analysis. Like RNA and other ssDNA viruses, BFDV is prone to a high rate of genetic mutation, although the Rep gene is relatively conserved, which conveniently assists with diagnosing infection by PCR detection methods (Ypelaar et al., 1999). Within Psittaciformes, BFDV exhibits quasispecies characteristics with emerging geographic or host specificity demonstrable within various clades (Varsani et al., 2011) and the observed occurrence of closely related clades in highly divergent parrot species is evidence of host switching or host generalism in several BFDV lineages (Varsani et al., 2011; Julian et al., 2012; Kundu et al., 2012; Massaro et al., 2012). The Orange-bellied Parrot (Neophema chrysogaster) is a critically endangered, endemic psittacine bird of southeastern Australia (Higgins, 1999; BirdLife International, 2012). Fewer than 50 wild Orange-bellied Parrots are thought to exist (Pritchard, 2012). The species has been the subject of conservation efforts over the past three decades, including the management of a captive insurance population and release of captive-bred birds to bolster wild population (Orange-Bellied Parrot Recovery Team, 2013). There is a growing awareness that threatened species or those with limited distribution are at increased risk from disease. The emergence of avian malaria as a key threatening process for several species of Hawaiian land birds has been frequently given as an example of this process. Nevertheless, the magnitude of decline and extinction of species due to disease remains poorly characterized (Smith et al., 2006). Furthermore, epidemiologic theory suggests that infectious disease is only likely to extirpate a species under particular conditions that may not occur often (De Castro and Bolker, 2005). In other cases, rather than directly threatening remnant wild populations, disease
289
can impact recovery attempts. In Mauritius, captive breeding of the endangered (BirdLife International, 2012) Pink Pigeon (Nesoenas mayeri) has been hampered by morbidity and mortality caused by trichomonosis in squabs (Swinnerton et al., 2005; Bunbury et al., 2007, 2008). Psittacine beak and feather disease was recognized as a disease of concern in the first National Recovery Plan for the Orange-bellied Parrot (Brown, 1988) because the establishment of the captivebreeding program in 1985 was set back by an outbreak of the disease. It seems likely that PBFD was in the founders collected as juveniles from the wild and the outbreak was thought to have been exacerbated by poor siting of the breeding facility at Bridgewater, Tasmania, which experienced cold, damp winters. In 1989, the aviaries were relocated to more a favorable climatic area (Taroona, Tasmania), and PBFD appeared to be no longer a problem. Releases of birds to the wild were conducted in 1993 after PBFD was confirmed in one wild bird with clinical signs collected at Swan Island, Victoria. The disease disappeared from the captive and wild populations of Orange-bellied Parrots, despite intensive serologic and PCR surveillance since 2000 on all translocated birds, until 2006 when the disease emerged once more in captive birds. The wild infected birds described here are part of this more recent outbreak of clinical PBFD in Orange-bellied Parrots and are the first wild Orange-bellied Parrots to be affected by PBFD. In 2001 PBFD was listed as a key threat to at least 25 threatened Australian species or subspecies under the Australian Environment Protection and Biodiversity Conservation Act of 1999. Very little data exist implicating BFDV or other infectious disease in the decline of other Australian psittacine birds, despite suggestions that disease should be considered as a factor in the extinction of the Paradise Parrot (Psephotus pulcherrimus) (Garnett, 1992). Nevertheless, PBFD has been long recognized
290
JOURNAL OF WILDLIFE DISEASES, VOL. 50, NO. 2, APRIL 2014
TABLE 1. Primer pair combinations used in this study to amplify the full genome of beak and feather disease virus isolated from an Orange-bellied Parrot (Neophema chrysogaster). Segment
Repa Capb Cap-Repb Rep-Capb
Forward primer
Reverse primer
P2: AACCCTACAGACGGCGAG OBPCAPF: GAGGGCTGTAGTCTGTGTCG CAPFWD1: ACCGTCGAAAGGTGCCAGCG REPFWD1: CGGAGCTGTTGCTGCCGTGA
a
Described by Ypelaar et al. (1999).
b
Designed and described in this study.
in Australian wild birds (Powell, 1903; Perry, 1981; Raidal et al., 1993), with the first record of an epidemic with PBFD-like syndrome occurring in Red-rumped Parrots (Psephotus haematonotus) from 1887 to 1888 in the Adelaide Hills, South Australia, which was blamed for the almost complete extirpation of the species from that area for more than 20 yr (Ashby, 1907). In New Zealand, Mauritius and South Africa PBFD is recognized as a threat to many threatened psittacine bird species (Heath et al., 2004; Ortiz-Catedral et al., 2009). We present evidence for the reemergence of BFDV and the presence of previously unidentified BFDV genotypes in the Orange-bellied Parrot. MATERIALS AND METHODS
A fledgling Orange-bellied Parrot was collected from the wild in southwestern Tasmania in January 2011 to contribute as a founder to the captive population. Routine sampling was carried out on this bird for a complete health assessment. Blood taken at the nest prior to collection was positive on PCR for BFDV, whereas feathers did not cause hemagglutination (HA) and no response was observed on hemagglutination inhibition (HI) assay of serum. The PBFD diagnostic assays were carried out by the Veterinary Diagnostic Laboratory, Charles Sturt University, following published methods (Ypelaar et al., 1999; Khalesi et al., 2005). These tests have formed the basis for intensive monitoring of wild Orange-bellied Parrots for BFDV since 2000. Two months later diagnostic assays for PBFD were repeated on this bird while it was held at an Orange-bellied Parrot captive breeding facility in Tasmania, yielding identical results and confirming ongoing infection. The PCR product from this diagnostic testing, covering a
P4: GTCACAGTCCTCCTTGTACC OBPCAPR: TACCGCAGACGTCACATCAG REPREV1: ACGGCAGCAACAGCTCCGTC CAPREV2: ACCCGCTGGCACCTTTCGAC
700-nucleotide segment of the Rep gene of BFDV, was purified with the use of a commercial kit (QIAquick PCR Purification kit, Qiagen, Shanghai, China) and sequenced by a commercial laboratory (AGRF Ltd., Sydney, NSW, Australia) with the use of a Sanger-based AB 3730xl unit (Applied Biosystems, Carlsbad, California, USA). The sequenced Rep gene and a published Cap gene from a captive BFDV-infected Orange-bellied Parrot in 2008 (GenBank accession KC121340) (Patterson et al., 2013) were used to design primer pairs covering the regions between these two genes in the circular genome of the virus (Table 1). Geneious 6.0.5 (Drummond et al., 2011) was used for primer design, and for subsequent alignments and phylogenetic analyses. Optimized cycling conditions for primer pair combinations described for the first time in this study were 95 C for 15 min, followed by 40 cycles of 95 C for 30 sec, annealing for 30 sec and 72 C for 2 min, followed by a final extension at 72 C for 5 min. Annealing temperatures were 60 C for the CapRep, 58 C for the Rep-Cap and 58 C for the Cap primer pair combinations. Heat-activated DNA polymerase was used (HotStarTaq, Qiagen) and the concentration of each primer in the reactions was 0.4 mM. The PCR amplification using the described primer pairs was carried out on DNA extracted (DNeasy Blood and Tissue kit, Qiagen) from whole blood from the infected Orange-bellied Parrot. The amplified products of 700–1,000 nucleotides were visualized with agar gel electrophoresis and purified from the sequence reaction before bidirectional sequencing with the amplifying primers as described above. Sequences were trimmed and bidirectionally aligned with the use of Sequencher v. 5.0.1 (Gene Codes Corp, Ann Arbor, Michigan, USA). Alignment and construction of the full genome sequence was carried out in a pairwise method with overlapping of between 265 and 394 nucleotides between the sequenced segments. Each aligned pair had no ambiguities
PETERS ET AL.—ORANGE-BELLIED PARROT, BEAK AND FEATHER DISEASE VIRUS
and was used to generate a consensus sequence before aligning with the next sequence. Pairwise alignment used the inbuilt MAFFT v. 6.814b L-INS-i alignment algorithm in Geneious (Katoh et al., 2002). The full circovirus genome sequence constructed was aligned with the use of the same MAFFT algorithm against all full BFDV genomes available on GenBank (see Supplementary Material Table S1). A columbid circovirus (GenBank accession EU840176) and two porcine circovirus-1 (GenBank accessions NC_001792 and AF071879) strains were included as outgroups. Following alignment, NJ and ML phylogenetic analyses (Edwards and Cavalli-Sforza, 1964; Saitou and Nei, 1987) were carried out in Geneious. GTR with four categories was the optimal model of nucleotide substitution in jModelTest 2.1.3 (Darriba et al., 2012) and was used for ML, and Hasegawa, Kishino, and Yano (HKY) was used for the NJ method (Hasegawa et al., 1985). Each analysis was bootstrapped with 1,000 iterations and a majority consensus topology produced was produced for NJ. The BFDV Rep gene of two further unrelated wild circovirus PCR-positive Orange-bellied Parrots sampled in March and May of 2011 were amplified directly from blood with the use of the diagnostic PCR assay described above. These were sequenced and aligned against all full-genome sequences of BFDV available and a single Swift Parrot (Lathamus discolor) using the MAFFT L-INS-i algorithm implemented in Geneious. Aligned nucleotides with gaps were removed, leaving an alignment of the Rep gene only, and NJ and ML phylogenetics were performed as described for the full-genome analysis. HA and HI assays for BFDV antigen in feathers and antibodies to BFDV in serum were negative for these birds. RESULTS
Four overlapping sequence segments covering the entire genome of BFDV were successfully amplified from the extracted whole blood of the infected Orangebellied Parrot. The fully assembled genome of this circovirus strain (GenBank accession number KC693651) was 1,993 nucleotides long and circular, and had less than 95% pairwise homogeneity with all of the other 142 BFDV isolates for which a full genome sequence is available. ML and NJ consensus bootstrapped phylogenies
291
produced a similar topology, with the exception that ML resolved several internal branches that were polytomous with NJ (ML tree provided in Supplementary Material Figure S1). The BFDV isolates formed a clade divergent from columbid circovirus, as expected. The Orange-bellied Parrot strain of BFDV fell in its own branch in an unresolved polytomy of strains from diverse species including captive and wild South American, African, Asiatic and Australasian parrot species from Australia, Germany, Japan, New Caledonia, New Zealand, Portugal, South Africa, Thailand, the UK and the USA (see Figure 2 and Supplementary Material Table S1). The topology supports the divergence of the BFDV strain in the wild Orange-bellied Parrot from all other previously sequenced BFDV strains (Heath et al., 2004; Ortiz-Catedral et al., 2009; Varsani et al., 2011). ML and NJ trees of Rep gene sequences from the two other wild Orange-bellied Parrots suggested the inclusion of one (isolate CS12082720214, GenBank KC693653) in the same clade as the isolate described above. The Rep gene of this isolate was homologous with that of the isolate for which full-genome sequencing was achieved. The last isolate (CS12082720203, GenBank KC693652) exhibited 94.8% identity from the other two wild Orange-bellied Parrot isolates and fell into a separate clade containing a Long-billed Corella (Cacatua tenuirostris) and a Major Mitchell’s Cockatoo (Lophochroa leadbeateri) isolate, both from Australia. Although these Rep genes can be used to infer genotypic difference from known BFDV genotypes, they are not valid for phylogenetic inference (Varsani et al., 2011). DISCUSSION
We demonstrated unique genotypes of BFDV infecting wild Orange-bellied Parrots, most likely representing recent introductions to the species considering the absence of BFDV in wild Orange-bellied
292
JOURNAL OF WILDLIFE DISEASES, VOL. 50, NO. 2, APRIL 2014
FIGURE 1. Outline of the genome of beak and feather disease virus (BFDV) isolated from an Orangebellied Parrot, illustrating the Rep (red) and Cap (dark blue) genes and four primer pairs (green, yellow, magenta, and cyan, respectively) used to perform full genome sequencing.
Parrots during intensive serologic and PCR surveillance since 2000. It has been suggested that because of the significant negative selection occurring at the Rep gene of these viruses, it is necessary to examine their phylogenetic relationships based on full genome sequences (Varsani et al., 2011). Nevertheless, the significant distance observed at the Rep gene of the third isolate examined is sufficient to confirm that the three wild Orange-bellied Parrots were infected with at least two separate isolates of BFDV. The distant phylogenetic isolation of the circovirus genotype for which the full genome was sequenced is likely to be a result of recombination, genetic isolation of this lineage of BFDV in the Orangebellied Parrot as a host, or due to the lack of phylogenetic resolution and poor
sampling density among BFDV strains in wild Australian parrots. The ability of circoviruses to persist in the environment for prolonged periods and their demonstrated ability to infect closely related hosts makes the former proposition unlikely. The possibility that identical or closely related BFDV lineages are found in other parrots in Australia but simply remain so far undetected is far more likely. The disease is common throughout all of Australia (Ashby, 1907; Raidal et al., 1993) and there is evidence for it occurring in wild Budgerigars (Melopsittacus undulatus) in 1936 when an outbreak was described near Blackall, Queensland. Many more isolates of circovirus from wild Australian parrots need to be analyzed to provide a more complete understanding on the phylogenies currently being examined.
PETERS ET AL.—ORANGE-BELLIED PARROT, BEAK AND FEATHER DISEASE VIRUS
293
The threshold susceptible population size required to maintain BFDV endemically in psittacine populations is unknown but, with less than 50 individuals, the wild population of Orange-bellied Parrots is almost certainly too small to maintain one, let alone two, BFDV genotypes on its own (Raidal et al., 1993, 1998; Swinton et al., 1998). Nevertheless, the three wild birds we investigated represent more than 6% of the wild population of this species. In endemically infected flocks high antibody prevalence balanced by low disease prevalence reflects self-sustaining cycles of infection and immunologic stimulation, which supports the development and maintenance of flock immunity (Raidal et al., 1993). The absence of detectable antibody in the blood of wild Orangebellied Parrots also supports the absence of endemic BFDV in this species. For more than two decades, over which the Orange-bellied Parrot has retained a very small remnant wild population, the species has probably lost some endemic pathogens and it is likely that the flock behaves as a metapopulation for the newly discovered BFDV genotypes and perhaps further strains. The BFDV genotypes we detected currently infecting the species are likely to be the result of spillover through contact with other psittacine birds, because the species is known to forage in mixed flocks. High titers of BFDV are excreted in feces and feather material by infected birds and BFDV virions are capable of surviving in the environment of nest hollows for long periods. Like other circoviruses, BFDV is resilient and can readily withstand temperatures of 80–85 C, r
FIGURE 2. Maximum-likelihood (ML) tree of all available full genomes of beak and feather disease virus (BFDV). Branching with greater than 50% support over 1,000 bootstraps is shown, and sup
ported subtrees are collapsed. Internal branches resolved with ML, but not present on neighborjoining (NJ) reconstruction of the same data, are shown with an asterisk. A scale bar is included (nucleotide substitutions/site). The porcine circovirus strains used as a root are not shown. CoCV: columbid circovirus. For the complete ML phylogram see Figure S1, on-line supporting material.
294
JOURNAL OF WILDLIFE DISEASES, VOL. 50, NO. 2, APRIL 2014
which may lead to the long-term contamination of nest hollows, perhaps for many years. The oral or cloacal transmission and environmental persistence of BFDV, as well as the predisposition of young birds to become infected, suggests a potentially significant role of shared nest hollows in facilitating spillover, allowing abundant parrot species to act as reservoirs for circovirus infection in very sparse or small populations of species such as the Orangebellied Parrot. An analogous situation has been documented in Mauritius, where BFDV transmission occurs between invasive and abundant Rose-ringed Parakeets (Psittacula krameri) and the endemic, endangered Echo Parakeet (Psittacula echo) (Kundu et al., 2012). The existence of reservoirs for BFDV in wild parrots throughout Tasmania is highly likely. The discovery of two divergent circovirus genotypes with different host affinities in two sibling Swift Parrot nestlings that had died acutely from PBFD in Tasmania demonstrates the likelihood of infection following shared nest-hollow use by different parrot species (Khalesi et al., 2005). The Swift Parrot is uniquely analogous to the Orange-bellied Parrot in that it is a small endangered migratory psittacine that breeds in nest hollows in Tasmania. The species has been observed reusing nest hollows (Stojanovic et al., 2012) when flowering conditions are favorable. It is not surprising that PBFD infects birds through shared nest hollows, for although a degree of host specificity is seen in psittacine circoviruses, considerable host generalism is also observed in several lineages (Varsani et al., 2011; Kundu et al., 2012; Massaro et al., 2012). Furthermore, the likely prolonged environmental persistence of circovirus virions (Raidal and Cross, 1994; Yilmaz and Kaleta, 2004) provides a mechanism by which transmission can occur in otherwise ecologically disconnected species. This is of particular significance in Australia, where 47 species of psittacine birds nest in tree hollows (Gibbons and Lindenmayer,
2002). At least four of these—the Sulphurcrested Cockatoo (Cacatua galerita), Little Corella (Cacatua sanguine), Galah (Eolophus roseicapillus), and Rainbow Lorikeet (Trichoglossus haematodus)—have expanded their range and population, and are known to occupy hollows used by other psittacine species. Cacatua galerita, the Sulphur-crested Cockatoo, was the first species in which PBFD was described and is known to maintain a high prevalence of antibody to BFDV in wild populations (Raidal et al., 1993). The role of natural and artificial nest hollows in the transmission of BFDV and other viruses (Raidal et al., 1998; Mackie et al., 2003) in wild Australian psittacine birds needs to be much better characterized. Although emerging infectious diseases of wildlife are receiving increasing attention as a potential cause of species extinction or endangerment (Daszak et al., 2000; Harvell et al., 2002), there remains limited evidence that infectious disease is a significant threatening process for the vast majority of the world’s endangered species (perhaps with the exception of amphibians) (Smith et al., 2006). This is in part because of the epidemiologic limitations on pathogen maintenance in small populations (De Castro and Bolker, 2005). There are, however, some circumstances under which, in theory at least, pathogens can lead to the extinction of their host. Key among these are 1) the introduction of a novel pathogen into a new host species; 2) the pre-epidemic host population is small; and 3) the use of other abiotic or biotic reservoirs by the pathogen (De Castro and Bolker, 2005; Smith et al., 2006). It is possible that the emergence of PBFD in Orange-bellied Parrots represents a scenario incorporating all of these conditions. There is an urgent need to identify potential reservoir hosts for BFDV infection in southeastern Australia. This may be achieved through spatial and temporal analysis of full-genome phylogenies of PBFD in Orange-bellied Parrots and
PETERS ET AL.—ORANGE-BELLIED PARROT, BEAK AND FEATHER DISEASE VIRUS
other Australian psittacine birds, especially those that share ecological space with this species. The re-emergence of BFDV in the wild Orange-bellied Parrot population is also a reminder that, even if infectious disease rarely is solely responsible for the extinction of a species, for populations that are critically endangered, emergent or introduced pathogens can present a significant risk. Indeed, Orangebellied Parrots are also at risk from several other pathogens such as avian polyomavirus (Raidal et al., 1998) that are capable of causing catastrophically high mortality (Harris, 2006) and could result in the extinction of the few remaining birds through stochastic processes. It is crucial therefore that management of critically endangered species is highly attentive to the risks of infectious disease. SUPPLEMENTARY MATERIAL
Supplementary Material for this article is online at http://dx.doi.org/10.7589/2013-05-121. ACKNOWLEDGMENTS
We acknowledge contributions of Peter Copley, Sheryl Hamilton, Jocelyn Hockley, Rupert Baker, Neil Murray, and Kristy Penrose of the Orange-bellied Parrot Recovery Team. This research was supported under Australian Research Council’s Discovery Projects funding scheme (DP1095408) and also would not have been possible without the foresight of Nicolai Bonne and Margaret Sharp, who archived samples and extracted DNA. LITERATURE CITED Ashby E. 1907. Parakeets moulting. Emu 6:193–194. BirdLife International. 2012. IUCN Red List of Threatened Species. Version 2013.1. www.iucn redlist.org. Accessed August 2013. Brown PB. 1988. A captive breeding program for Orange-bellied parrots. Aust Aviculture 42:165– 175. Bunbury N, Jones CG, Greenwood AG, Bell DJ. 2007. Trichomonas gallinae in Mauritian columbids: Implications for an endangered endemic. J Wildl Dis 43:399–407. Bunbury N, Jones CG, Greenwood AG, Bell DJ. 2008. Epidemiology and conservation implications of Trichomonas gallinae infection in the
295
endangered Mauritian pink pigeon. Biol Conserv 141:153–161. Darriba D, Taboada GL, Doallo R, Posada D. 2012. jModelTest 2: More models, new heuristics and parallel computing. Nat Methods 9:772. Daszak P, Cunningham AA, Hyatt AD. 2000. Emerging infectious diseases of wildlife: Threats to biodiversity and human health. Science 287: 443–449. De Castro F, Bolker B. 2005. Mechanisms of diseaseinduced extinction. Ecol Lett 8:117–126. Drummond AJ, Ashton B, Buxton S, Cheung M, Cooper A, Duran C, Field M, Heled J, Kearse M, Markowitz S, et al. 2011. Geneious v5.6. http://www.geneious.com/. Accessed December 2013. Edwards AWF, Cavalli-Sforza LL. 1964. Reconstruction of evolutionary trees. In: Phenetic and phylogenetic classification, McNeill J, Heywood VH, editors. Systematics Association, London, UK, pp. 67–76. Garnett S. 1992. Threatened and extinct birds of Australia. RAOU Report 82, Royal Australasian Ornithologists’ Union and Australian National Parks and Wildlife Service, Moonee Ponds, Australia. Gibbons P, Lindenmayer D. 2002. Tree hollows and wildlife conservation in Australia. CSIRO Publishing, Collingwood, Australia, 211 pp. Harris J. 2006. Pathology, diagnostics, implications and strategies in a breeding colony of Orangebellied Parrots (Neophema chrysogaster). In: Proceedings: Australian Committee Association of Avian Veterinarians, Cross G, editor. Association of Avian Veterinarians, Australian Committee, Sydney, Australia, pp. 143–145. Harvell CD, Mitchell CE, Ward JR, Altizer S, Dobson AP, Ostfeld RS, Samuel MD. 2002. Climate warming and disease risks for terrestrial and marine biota. Science 296:2158–2162. Hasegawa M, Kishino H, Yano T-A. 1985. Dating of the human–ape splitting by a molecular clock of mitochondrial DNA. J Mol Evol 22:160–174. Heath L, Martin DP, Warburton L, Perrin M, Horsfield W, Kingsley C, Rybicki EP, Williamson AL. 2004. Evidence of unique genotypes of beak and feather disease virus in southern Africa. J Virol 78:9277–9284. Higgins PJ, editor. 1999. Handbook of Australian, New Zealand and Antarctic birds. Volume 4: Parrots to Dollarbird. Oxford University Press, Melbourne, Australia, 1248 pp. Julian L, Lorenzo A, Chenuet JP, Bonzon M, Marchal C, Vignon L, Collings DA, Walters M, Jackson B, Varsani A. 2012. Evidence of multiple introductions of beak and feather disease virus into the Pacific islands of Nouvelle-Caledonie (New Caledonia). J Gen Virol 93:2466–2472. Katoh K, Misawa K, Kuma KA¨, Miyata T. 2002. MAFFT: A novel method for rapid multiple
296
JOURNAL OF WILDLIFE DISEASES, VOL. 50, NO. 2, APRIL 2014
sequence alignment based on fast Fourier transform. Nucleic Acids Res 30:3059–3066. Khalesi B, Bonne N, Stewart M, Sharp M, Raidal S. 2005. A comparison of haemagglutination, haemagglutination inhibition and PCR for the detection of psittacine beak and feather disease virus infection and a comparison of isolates obtained from loriids. J Gen Virol 86:3039–3046. Kundu S, Faulkes CG, Greenwood AG, Jones CG, Kaiser P, Lyne OD, Black SA, Chowrimootoo A, Groombridge JJ. 2012. Tracking viral evolution during a disease outbreak: The rapid and complete selective sweep of a circovirus in the endangered Echo Parakeet. J Virol 86:5221– 5229. Mackie JT, Black D, Prior H. 2003. Enteritis associated with adenovirus-like particles in captive lorikeets. Aust Vet J 81:293–295. Massaro M, Ortiz-Catedral L, Julian L, Galbraith JA, Kurenbach B, Kearvell J, Kemp J, Van Hal J, Elkington S, Taylor G, et al. 2012. Molecular characterisation of beak and feather disease virus (BFDV) in New Zealand and its implications for managing an infectious disease. Arch Virol 157:1651–1663. Orange-Bellied Parrot Recovery Team. 2013. National recovery plan for the Orange-bellied Parrot (Neophema chrysogaster). http://www.environment.gov. au/biodiversity/threatened/publications/orangebellied-parrot-recovery.html. Accessed August 2013. Ortiz-Catedral L, McInnes K, Hauber ME, Brunton DH. 2009. First report of beak and feather disease virus (BFDV) in wild Red-fronted Parakeets (Cyanoramphus novaezelandiae) in New Zealand. Emu 109:244–247. Patterson EI, Swarbrick CMD, Roman N, Forwood JK, Raidal SR. 2013. Differential expression of two isolates of beak and feather disease virus capsid protein in Escherichia coli. J Virol Methods 1889:118–124. Perry RA. 1981. A psittacine combined beak and feather disease syndrome with particular reference to the Australian Cockatoos Cacatua galerita (Sulphur-crested Cockatoo), Cacatua leadbeateri (Major Mitchell or Pink Cockatoo), Cacatua roseicapella (Galah or Rose-breasted Cockatoo) and Cacatua sanguinea (Little Corella). In: Proceedings No. 55 Refresher Course on Aviary and Caged Birds. The Post-graduate Committee in Veterinary Science. Sydney, Australia, pp. 81–108.
Powell AM. 1903. Nude Cockatoos. Emu 3:55–56. Pritchard R. 2012. Update on the Orange-bellied Parrot Recovery Program. http://www.birdlife. org.au/documents/OBP-Rec-Team-Update-26Jul12. pdf. Accessed August 2013. Raidal SR, Cross GM. 1994. The hemagglutination spectrum of psittacine beak and feather disease virus. Avian Pathol 23:621–630. Raidal SR, McElnea CL, Cross GM. 1993. Seroprevalence of psittacine beak and feather disease in wild psittacine birds in New South Wales. Aust Vet J 70:137–139. Raidal SR, Cross GM, Tomaszewski E, Graham DL, Phalen DN. 1998. A serologic survey for avian polyomavirus and Pacheco’s disease virus in Australian cockatoos. Avian Pathol 27:263–268. Saitou N, Nei M. 1987. The neighbor-joining method: A new method for reconstructing phylogenetic trees. Mol Biol Evol 4:406–425. Smith KF, Sax DF, Lafferty KD. 2006. Evidence for the role of infectious disease in species extinction and endangerment. Conserv Biol 20:1349–1357. Stojanovic D, Webb M, Roshier D, Saunders D, Heinsohn R. 2012. Ground-based survey methods both overestimate and underestimate the abundance of suitable tree-cavities for the endangered Swift Parrot. Emu 112:350–356. Swinnerton KJ, Greenwood AG, Chapman RE, Jones CG. 2005. The incidence of the parasitic disease trichomoniasis and its treatment in reintroduced and wild Pink Pigeons Columba mayeri. Ibis 147:772–782. Swinton J, Harwood J, Grenfell BT, Gilligan CA. 1998. Persistence thresholds for phocine distemper virus infection in harbour seal Phoca vitulina metapopulations. J Anim Ecol 67:54–68. Varsani A, Regnard GL, Bragg R, Hitzeroth II, Rybicki EP. 2011. Global genetic diversity and geographical and host-species distribution of beak and feather disease virus isolates. J Gen Virol 92:752–767. Yilmaz A, Kaleta EF. 2004. Disinfectant tests at 20 and 10 degrees C to determine the virucidal activity against circoviruses. Dtsch Tieraerztl Wochenschr 111:248–251. Ypelaar I, Bassami MR, Wilcox GE, Raidal SR. 1999. A universal polymerase chain reaction for the detection of psittacine beak and feather disease virus. Vet Microbiol 68:141–148. Submitted for publication 22 May 2013. Accepted 20 August 2013.
Journal of Wildlife Diseases, 50(2), 2014, pp. 288–296 # Wildlife Disease Association 2014
EVIDENCE OF PSITTACINE BEAK AND FEATHER DISEASE VIRUS SPILLOVER INTO WILD CRITICALLY ENDANGERED ORANGEBELLIED PARROTS (NEOPHEMA CHRYSOGASTER) Andrew Peters,1 Edward I. Patterson,1 Barry G. B. Baker,2 Mark Holdsworth,3 Subir Sarker,1 Seyed A. Ghorashi,1 and Shane R. Raidal1,4 1
School of Animal and Veterinary Sciences, E. H. Graham Centre for Agricultural Innovation, Charles Sturt University, Boorooma St., Wagga Wagga, New South Wales 2678, Australia 2 Institute of Marine and Antarctic Studies, University of Tasmania, Private Bag 22, Hobart, Tasmania 7001, Australia 3 Biodiversity Conservation Branch, Department of Primary Industries, Parks, Water and Environment, 134 Macquarie St., Hobart, Tasmania 7001, Australia 4 Corresponding author (email: [email protected])
We report the recent emergence of a novel beak and feather disease virus (BFDV) genotype in the last remaining wild population of the critically endangered Orange-bellied Parrot (Neophema chrysogaster). This virus poses a significant threat to the recovery of the species and potentially its survival in the wild. We used PCR to detect BFDV in the blood of three psittacine beak and feather disease (PBFD)–affected wild Orange-bellied Parrot fledglings captured as founders for an existing captive breeding recovery program. Complete BFDV genome sequence data from one of these birds demonstrating a 1,993-nucleotide-long read encompass the entire circular genome. Maximum-likelihood (ML) and neighbor-joining (NJ) phylogenetic analysis supported the solitary position of this viral isolate in a genetically isolated branch of BFDV. On Rep gene sequencing, a homologous genotype was present in a second wild orange-bellied parrot and the third bird was infected with a distantly related genotype. These viruses have newly appeared in a population that has been intensively monitored for BFDV for the last 13 yr. The detection of two distinct lineages of BFDV in the remnant wild population of Orange-bellied Parrots, consisting of fewer than 50 birds, suggests a role for other parrot species as a reservoir for infection by spillover into this critically endangered species. The potential for such a scenario to contribute to the extinction of a remnant wild animal population is supported by epidemiologic theory. Key words: Circovirus, PBFD, psittacine beak and feather disease, threatened species, wildlife disease.
ABSTRACT:
by histopathologic examination. Chronic latent infection with few clinical signs of feather pathology can occur in more resistant species such as lorikeets and neotropical parrots, with the latter seldom developing clinical PBFD. Nevertheless, affected birds are highly susceptible to secondary infections because of immunosuppression, and it is this aspect of the disease that can degrade flock health and immunologic fitness. The etiologic agent of PBFD, beak and feather disease virus (BFDV), is a member of the Circoviridae and one of the smallest viruses known to exist in terms of both physicochemical and genetic characteristics. BFDV has a relatively simple but compact circular single-stranded DNA (ssDNA) genome of approximately 2,000 nucleotides encoding two proteins, the
INTRODUCTION
Psittacine beak and feather disease (PBFD) is a chronic, debilitating, and ultimately fatal disease of Psittaciformes primarily involving the integument, alimentary, and immune systems of affected birds. In most psittacine bird species chronic infection and the development of clinical signs are associated with high levels of morbidity and eventual mortality. The disease can be expressed either acutely, ranging from sudden death, particularly in highly susceptible species such as the Gang Gang Cockatoo (Callocephalon fimbriatum), or with a chronic prolonged course of feather dystrophy ultimately leading to mortality (Perry, 1981). In Neophema and Psephotus parrots feather lesions may be subtle and best detectable 288
PETERS ET AL.—ORANGE-BELLIED PARROT, BEAK AND FEATHER DISEASE VIRUS
replication initiator protein (Rep) required for the initiation of replication and the capsid protein (Cap). The small genome of the virus facilitates whole-genome viral epidemiologic analysis. Like RNA and other ssDNA viruses, BFDV is prone to a high rate of genetic mutation, although the Rep gene is relatively conserved, which conveniently assists with diagnosing infection by PCR detection methods (Ypelaar et al., 1999). Within Psittaciformes, BFDV exhibits quasispecies characteristics with emerging geographic or host specificity demonstrable within various clades (Varsani et al., 2011) and the observed occurrence of closely related clades in highly divergent parrot species is evidence of host switching or host generalism in several BFDV lineages (Varsani et al., 2011; Julian et al., 2012; Kundu et al., 2012; Massaro et al., 2012). The Orange-bellied Parrot (Neophema chrysogaster) is a critically endangered, endemic psittacine bird of southeastern Australia (Higgins, 1999; BirdLife International, 2012). Fewer than 50 wild Orange-bellied Parrots are thought to exist (Pritchard, 2012). The species has been the subject of conservation efforts over the past three decades, including the management of a captive insurance population and release of captive-bred birds to bolster wild population (Orange-Bellied Parrot Recovery Team, 2013). There is a growing awareness that threatened species or those with limited distribution are at increased risk from disease. The emergence of avian malaria as a key threatening process for several species of Hawaiian land birds has been frequently given as an example of this process. Nevertheless, the magnitude of decline and extinction of species due to disease remains poorly characterized (Smith et al., 2006). Furthermore, epidemiologic theory suggests that infectious disease is only likely to extirpate a species under particular conditions that may not occur often (De Castro and Bolker, 2005). In other cases, rather than directly threatening remnant wild populations, disease
289
can impact recovery attempts. In Mauritius, captive breeding of the endangered (BirdLife International, 2012) Pink Pigeon (Nesoenas mayeri) has been hampered by morbidity and mortality caused by trichomonosis in squabs (Swinnerton et al., 2005; Bunbury et al., 2007, 2008). Psittacine beak and feather disease was recognized as a disease of concern in the first National Recovery Plan for the Orange-bellied Parrot (Brown, 1988) because the establishment of the captivebreeding program in 1985 was set back by an outbreak of the disease. It seems likely that PBFD was in the founders collected as juveniles from the wild and the outbreak was thought to have been exacerbated by poor siting of the breeding facility at Bridgewater, Tasmania, which experienced cold, damp winters. In 1989, the aviaries were relocated to more a favorable climatic area (Taroona, Tasmania), and PBFD appeared to be no longer a problem. Releases of birds to the wild were conducted in 1993 after PBFD was confirmed in one wild bird with clinical signs collected at Swan Island, Victoria. The disease disappeared from the captive and wild populations of Orange-bellied Parrots, despite intensive serologic and PCR surveillance since 2000 on all translocated birds, until 2006 when the disease emerged once more in captive birds. The wild infected birds described here are part of this more recent outbreak of clinical PBFD in Orange-bellied Parrots and are the first wild Orange-bellied Parrots to be affected by PBFD. In 2001 PBFD was listed as a key threat to at least 25 threatened Australian species or subspecies under the Australian Environment Protection and Biodiversity Conservation Act of 1999. Very little data exist implicating BFDV or other infectious disease in the decline of other Australian psittacine birds, despite suggestions that disease should be considered as a factor in the extinction of the Paradise Parrot (Psephotus pulcherrimus) (Garnett, 1992). Nevertheless, PBFD has been long recognized
290
JOURNAL OF WILDLIFE DISEASES, VOL. 50, NO. 2, APRIL 2014
TABLE 1. Primer pair combinations used in this study to amplify the full genome of beak and feather disease virus isolated from an Orange-bellied Parrot (Neophema chrysogaster). Segment
Repa Capb Cap-Repb Rep-Capb
Forward primer
Reverse primer
P2: AACCCTACAGACGGCGAG OBPCAPF: GAGGGCTGTAGTCTGTGTCG CAPFWD1: ACCGTCGAAAGGTGCCAGCG REPFWD1: CGGAGCTGTTGCTGCCGTGA
a
Described by Ypelaar et al. (1999).
b
Designed and described in this study.
in Australian wild birds (Powell, 1903; Perry, 1981; Raidal et al., 1993), with the first record of an epidemic with PBFD-like syndrome occurring in Red-rumped Parrots (Psephotus haematonotus) from 1887 to 1888 in the Adelaide Hills, South Australia, which was blamed for the almost complete extirpation of the species from that area for more than 20 yr (Ashby, 1907). In New Zealand, Mauritius and South Africa PBFD is recognized as a threat to many threatened psittacine bird species (Heath et al., 2004; Ortiz-Catedral et al., 2009). We present evidence for the reemergence of BFDV and the presence of previously unidentified BFDV genotypes in the Orange-bellied Parrot. MATERIALS AND METHODS
A fledgling Orange-bellied Parrot was collected from the wild in southwestern Tasmania in January 2011 to contribute as a founder to the captive population. Routine sampling was carried out on this bird for a complete health assessment. Blood taken at the nest prior to collection was positive on PCR for BFDV, whereas feathers did not cause hemagglutination (HA) and no response was observed on hemagglutination inhibition (HI) assay of serum. The PBFD diagnostic assays were carried out by the Veterinary Diagnostic Laboratory, Charles Sturt University, following published methods (Ypelaar et al., 1999; Khalesi et al., 2005). These tests have formed the basis for intensive monitoring of wild Orange-bellied Parrots for BFDV since 2000. Two months later diagnostic assays for PBFD were repeated on this bird while it was held at an Orange-bellied Parrot captive breeding facility in Tasmania, yielding identical results and confirming ongoing infection. The PCR product from this diagnostic testing, covering a
P4: GTCACAGTCCTCCTTGTACC OBPCAPR: TACCGCAGACGTCACATCAG REPREV1: ACGGCAGCAACAGCTCCGTC CAPREV2: ACCCGCTGGCACCTTTCGAC
700-nucleotide segment of the Rep gene of BFDV, was purified with the use of a commercial kit (QIAquick PCR Purification kit, Qiagen, Shanghai, China) and sequenced by a commercial laboratory (AGRF Ltd., Sydney, NSW, Australia) with the use of a Sanger-based AB 3730xl unit (Applied Biosystems, Carlsbad, California, USA). The sequenced Rep gene and a published Cap gene from a captive BFDV-infected Orange-bellied Parrot in 2008 (GenBank accession KC121340) (Patterson et al., 2013) were used to design primer pairs covering the regions between these two genes in the circular genome of the virus (Table 1). Geneious 6.0.5 (Drummond et al., 2011) was used for primer design, and for subsequent alignments and phylogenetic analyses. Optimized cycling conditions for primer pair combinations described for the first time in this study were 95 C for 15 min, followed by 40 cycles of 95 C for 30 sec, annealing for 30 sec and 72 C for 2 min, followed by a final extension at 72 C for 5 min. Annealing temperatures were 60 C for the CapRep, 58 C for the Rep-Cap and 58 C for the Cap primer pair combinations. Heat-activated DNA polymerase was used (HotStarTaq, Qiagen) and the concentration of each primer in the reactions was 0.4 mM. The PCR amplification using the described primer pairs was carried out on DNA extracted (DNeasy Blood and Tissue kit, Qiagen) from whole blood from the infected Orange-bellied Parrot. The amplified products of 700–1,000 nucleotides were visualized with agar gel electrophoresis and purified from the sequence reaction before bidirectional sequencing with the amplifying primers as described above. Sequences were trimmed and bidirectionally aligned with the use of Sequencher v. 5.0.1 (Gene Codes Corp, Ann Arbor, Michigan, USA). Alignment and construction of the full genome sequence was carried out in a pairwise method with overlapping of between 265 and 394 nucleotides between the sequenced segments. Each aligned pair had no ambiguities
PETERS ET AL.—ORANGE-BELLIED PARROT, BEAK AND FEATHER DISEASE VIRUS
and was used to generate a consensus sequence before aligning with the next sequence. Pairwise alignment used the inbuilt MAFFT v. 6.814b L-INS-i alignment algorithm in Geneious (Katoh et al., 2002). The full circovirus genome sequence constructed was aligned with the use of the same MAFFT algorithm against all full BFDV genomes available on GenBank (see Supplementary Material Table S1). A columbid circovirus (GenBank accession EU840176) and two porcine circovirus-1 (GenBank accessions NC_001792 and AF071879) strains were included as outgroups. Following alignment, NJ and ML phylogenetic analyses (Edwards and Cavalli-Sforza, 1964; Saitou and Nei, 1987) were carried out in Geneious. GTR with four categories was the optimal model of nucleotide substitution in jModelTest 2.1.3 (Darriba et al., 2012) and was used for ML, and Hasegawa, Kishino, and Yano (HKY) was used for the NJ method (Hasegawa et al., 1985). Each analysis was bootstrapped with 1,000 iterations and a majority consensus topology produced was produced for NJ. The BFDV Rep gene of two further unrelated wild circovirus PCR-positive Orange-bellied Parrots sampled in March and May of 2011 were amplified directly from blood with the use of the diagnostic PCR assay described above. These were sequenced and aligned against all full-genome sequences of BFDV available and a single Swift Parrot (Lathamus discolor) using the MAFFT L-INS-i algorithm implemented in Geneious. Aligned nucleotides with gaps were removed, leaving an alignment of the Rep gene only, and NJ and ML phylogenetics were performed as described for the full-genome analysis. HA and HI assays for BFDV antigen in feathers and antibodies to BFDV in serum were negative for these birds. RESULTS
Four overlapping sequence segments covering the entire genome of BFDV were successfully amplified from the extracted whole blood of the infected Orangebellied Parrot. The fully assembled genome of this circovirus strain (GenBank accession number KC693651) was 1,993 nucleotides long and circular, and had less than 95% pairwise homogeneity with all of the other 142 BFDV isolates for which a full genome sequence is available. ML and NJ consensus bootstrapped phylogenies
291
produced a similar topology, with the exception that ML resolved several internal branches that were polytomous with NJ (ML tree provided in Supplementary Material Figure S1). The BFDV isolates formed a clade divergent from columbid circovirus, as expected. The Orange-bellied Parrot strain of BFDV fell in its own branch in an unresolved polytomy of strains from diverse species including captive and wild South American, African, Asiatic and Australasian parrot species from Australia, Germany, Japan, New Caledonia, New Zealand, Portugal, South Africa, Thailand, the UK and the USA (see Figure 2 and Supplementary Material Table S1). The topology supports the divergence of the BFDV strain in the wild Orange-bellied Parrot from all other previously sequenced BFDV strains (Heath et al., 2004; Ortiz-Catedral et al., 2009; Varsani et al., 2011). ML and NJ trees of Rep gene sequences from the two other wild Orange-bellied Parrots suggested the inclusion of one (isolate CS12082720214, GenBank KC693653) in the same clade as the isolate described above. The Rep gene of this isolate was homologous with that of the isolate for which full-genome sequencing was achieved. The last isolate (CS12082720203, GenBank KC693652) exhibited 94.8% identity from the other two wild Orange-bellied Parrot isolates and fell into a separate clade containing a Long-billed Corella (Cacatua tenuirostris) and a Major Mitchell’s Cockatoo (Lophochroa leadbeateri) isolate, both from Australia. Although these Rep genes can be used to infer genotypic difference from known BFDV genotypes, they are not valid for phylogenetic inference (Varsani et al., 2011). DISCUSSION
We demonstrated unique genotypes of BFDV infecting wild Orange-bellied Parrots, most likely representing recent introductions to the species considering the absence of BFDV in wild Orange-bellied
292
JOURNAL OF WILDLIFE DISEASES, VOL. 50, NO. 2, APRIL 2014
FIGURE 1. Outline of the genome of beak and feather disease virus (BFDV) isolated from an Orangebellied Parrot, illustrating the Rep (red) and Cap (dark blue) genes and four primer pairs (green, yellow, magenta, and cyan, respectively) used to perform full genome sequencing.
Parrots during intensive serologic and PCR surveillance since 2000. It has been suggested that because of the significant negative selection occurring at the Rep gene of these viruses, it is necessary to examine their phylogenetic relationships based on full genome sequences (Varsani et al., 2011). Nevertheless, the significant distance observed at the Rep gene of the third isolate examined is sufficient to confirm that the three wild Orange-bellied Parrots were infected with at least two separate isolates of BFDV. The distant phylogenetic isolation of the circovirus genotype for which the full genome was sequenced is likely to be a result of recombination, genetic isolation of this lineage of BFDV in the Orangebellied Parrot as a host, or due to the lack of phylogenetic resolution and poor
sampling density among BFDV strains in wild Australian parrots. The ability of circoviruses to persist in the environment for prolonged periods and their demonstrated ability to infect closely related hosts makes the former proposition unlikely. The possibility that identical or closely related BFDV lineages are found in other parrots in Australia but simply remain so far undetected is far more likely. The disease is common throughout all of Australia (Ashby, 1907; Raidal et al., 1993) and there is evidence for it occurring in wild Budgerigars (Melopsittacus undulatus) in 1936 when an outbreak was described near Blackall, Queensland. Many more isolates of circovirus from wild Australian parrots need to be analyzed to provide a more complete understanding on the phylogenies currently being examined.
PETERS ET AL.—ORANGE-BELLIED PARROT, BEAK AND FEATHER DISEASE VIRUS
293
The threshold susceptible population size required to maintain BFDV endemically in psittacine populations is unknown but, with less than 50 individuals, the wild population of Orange-bellied Parrots is almost certainly too small to maintain one, let alone two, BFDV genotypes on its own (Raidal et al., 1993, 1998; Swinton et al., 1998). Nevertheless, the three wild birds we investigated represent more than 6% of the wild population of this species. In endemically infected flocks high antibody prevalence balanced by low disease prevalence reflects self-sustaining cycles of infection and immunologic stimulation, which supports the development and maintenance of flock immunity (Raidal et al., 1993). The absence of detectable antibody in the blood of wild Orangebellied Parrots also supports the absence of endemic BFDV in this species. For more than two decades, over which the Orange-bellied Parrot has retained a very small remnant wild population, the species has probably lost some endemic pathogens and it is likely that the flock behaves as a metapopulation for the newly discovered BFDV genotypes and perhaps further strains. The BFDV genotypes we detected currently infecting the species are likely to be the result of spillover through contact with other psittacine birds, because the species is known to forage in mixed flocks. High titers of BFDV are excreted in feces and feather material by infected birds and BFDV virions are capable of surviving in the environment of nest hollows for long periods. Like other circoviruses, BFDV is resilient and can readily withstand temperatures of 80–85 C, r
FIGURE 2. Maximum-likelihood (ML) tree of all available full genomes of beak and feather disease virus (BFDV). Branching with greater than 50% support over 1,000 bootstraps is shown, and sup
ported subtrees are collapsed. Internal branches resolved with ML, but not present on neighborjoining (NJ) reconstruction of the same data, are shown with an asterisk. A scale bar is included (nucleotide substitutions/site). The porcine circovirus strains used as a root are not shown. CoCV: columbid circovirus. For the complete ML phylogram see Figure S1, on-line supporting material.
294
JOURNAL OF WILDLIFE DISEASES, VOL. 50, NO. 2, APRIL 2014
which may lead to the long-term contamination of nest hollows, perhaps for many years. The oral or cloacal transmission and environmental persistence of BFDV, as well as the predisposition of young birds to become infected, suggests a potentially significant role of shared nest hollows in facilitating spillover, allowing abundant parrot species to act as reservoirs for circovirus infection in very sparse or small populations of species such as the Orangebellied Parrot. An analogous situation has been documented in Mauritius, where BFDV transmission occurs between invasive and abundant Rose-ringed Parakeets (Psittacula krameri) and the endemic, endangered Echo Parakeet (Psittacula echo) (Kundu et al., 2012). The existence of reservoirs for BFDV in wild parrots throughout Tasmania is highly likely. The discovery of two divergent circovirus genotypes with different host affinities in two sibling Swift Parrot nestlings that had died acutely from PBFD in Tasmania demonstrates the likelihood of infection following shared nest-hollow use by different parrot species (Khalesi et al., 2005). The Swift Parrot is uniquely analogous to the Orange-bellied Parrot in that it is a small endangered migratory psittacine that breeds in nest hollows in Tasmania. The species has been observed reusing nest hollows (Stojanovic et al., 2012) when flowering conditions are favorable. It is not surprising that PBFD infects birds through shared nest hollows, for although a degree of host specificity is seen in psittacine circoviruses, considerable host generalism is also observed in several lineages (Varsani et al., 2011; Kundu et al., 2012; Massaro et al., 2012). Furthermore, the likely prolonged environmental persistence of circovirus virions (Raidal and Cross, 1994; Yilmaz and Kaleta, 2004) provides a mechanism by which transmission can occur in otherwise ecologically disconnected species. This is of particular significance in Australia, where 47 species of psittacine birds nest in tree hollows (Gibbons and Lindenmayer,
2002). At least four of these—the Sulphurcrested Cockatoo (Cacatua galerita), Little Corella (Cacatua sanguine), Galah (Eolophus roseicapillus), and Rainbow Lorikeet (Trichoglossus haematodus)—have expanded their range and population, and are known to occupy hollows used by other psittacine species. Cacatua galerita, the Sulphur-crested Cockatoo, was the first species in which PBFD was described and is known to maintain a high prevalence of antibody to BFDV in wild populations (Raidal et al., 1993). The role of natural and artificial nest hollows in the transmission of BFDV and other viruses (Raidal et al., 1998; Mackie et al., 2003) in wild Australian psittacine birds needs to be much better characterized. Although emerging infectious diseases of wildlife are receiving increasing attention as a potential cause of species extinction or endangerment (Daszak et al., 2000; Harvell et al., 2002), there remains limited evidence that infectious disease is a significant threatening process for the vast majority of the world’s endangered species (perhaps with the exception of amphibians) (Smith et al., 2006). This is in part because of the epidemiologic limitations on pathogen maintenance in small populations (De Castro and Bolker, 2005). There are, however, some circumstances under which, in theory at least, pathogens can lead to the extinction of their host. Key among these are 1) the introduction of a novel pathogen into a new host species; 2) the pre-epidemic host population is small; and 3) the use of other abiotic or biotic reservoirs by the pathogen (De Castro and Bolker, 2005; Smith et al., 2006). It is possible that the emergence of PBFD in Orange-bellied Parrots represents a scenario incorporating all of these conditions. There is an urgent need to identify potential reservoir hosts for BFDV infection in southeastern Australia. This may be achieved through spatial and temporal analysis of full-genome phylogenies of PBFD in Orange-bellied Parrots and
PETERS ET AL.—ORANGE-BELLIED PARROT, BEAK AND FEATHER DISEASE VIRUS
other Australian psittacine birds, especially those that share ecological space with this species. The re-emergence of BFDV in the wild Orange-bellied Parrot population is also a reminder that, even if infectious disease rarely is solely responsible for the extinction of a species, for populations that are critically endangered, emergent or introduced pathogens can present a significant risk. Indeed, Orangebellied Parrots are also at risk from several other pathogens such as avian polyomavirus (Raidal et al., 1998) that are capable of causing catastrophically high mortality (Harris, 2006) and could result in the extinction of the few remaining birds through stochastic processes. It is crucial therefore that management of critically endangered species is highly attentive to the risks of infectious disease. SUPPLEMENTARY MATERIAL
Supplementary Material for this article is online at http://dx.doi.org/10.7589/2013-05-121. ACKNOWLEDGMENTS
We acknowledge contributions of Peter Copley, Sheryl Hamilton, Jocelyn Hockley, Rupert Baker, Neil Murray, and Kristy Penrose of the Orange-bellied Parrot Recovery Team. This research was supported under Australian Research Council’s Discovery Projects funding scheme (DP1095408) and also would not have been possible without the foresight of Nicolai Bonne and Margaret Sharp, who archived samples and extracted DNA. LITERATURE CITED Ashby E. 1907. Parakeets moulting. Emu 6:193–194. BirdLife International. 2012. IUCN Red List of Threatened Species. Version 2013.1. www.iucn redlist.org. Accessed August 2013. Brown PB. 1988. A captive breeding program for Orange-bellied parrots. Aust Aviculture 42:165– 175. Bunbury N, Jones CG, Greenwood AG, Bell DJ. 2007. Trichomonas gallinae in Mauritian columbids: Implications for an endangered endemic. J Wildl Dis 43:399–407. Bunbury N, Jones CG, Greenwood AG, Bell DJ. 2008. Epidemiology and conservation implications of Trichomonas gallinae infection in the
295
endangered Mauritian pink pigeon. Biol Conserv 141:153–161. Darriba D, Taboada GL, Doallo R, Posada D. 2012. jModelTest 2: More models, new heuristics and parallel computing. Nat Methods 9:772. Daszak P, Cunningham AA, Hyatt AD. 2000. Emerging infectious diseases of wildlife: Threats to biodiversity and human health. Science 287: 443–449. De Castro F, Bolker B. 2005. Mechanisms of diseaseinduced extinction. Ecol Lett 8:117–126. Drummond AJ, Ashton B, Buxton S, Cheung M, Cooper A, Duran C, Field M, Heled J, Kearse M, Markowitz S, et al. 2011. Geneious v5.6. http://www.geneious.com/. Accessed December 2013. Edwards AWF, Cavalli-Sforza LL. 1964. Reconstruction of evolutionary trees. In: Phenetic and phylogenetic classification, McNeill J, Heywood VH, editors. Systematics Association, London, UK, pp. 67–76. Garnett S. 1992. Threatened and extinct birds of Australia. RAOU Report 82, Royal Australasian Ornithologists’ Union and Australian National Parks and Wildlife Service, Moonee Ponds, Australia. Gibbons P, Lindenmayer D. 2002. Tree hollows and wildlife conservation in Australia. CSIRO Publishing, Collingwood, Australia, 211 pp. Harris J. 2006. Pathology, diagnostics, implications and strategies in a breeding colony of Orangebellied Parrots (Neophema chrysogaster). In: Proceedings: Australian Committee Association of Avian Veterinarians, Cross G, editor. Association of Avian Veterinarians, Australian Committee, Sydney, Australia, pp. 143–145. Harvell CD, Mitchell CE, Ward JR, Altizer S, Dobson AP, Ostfeld RS, Samuel MD. 2002. Climate warming and disease risks for terrestrial and marine biota. Science 296:2158–2162. Hasegawa M, Kishino H, Yano T-A. 1985. Dating of the human–ape splitting by a molecular clock of mitochondrial DNA. J Mol Evol 22:160–174. Heath L, Martin DP, Warburton L, Perrin M, Horsfield W, Kingsley C, Rybicki EP, Williamson AL. 2004. Evidence of unique genotypes of beak and feather disease virus in southern Africa. J Virol 78:9277–9284. Higgins PJ, editor. 1999. Handbook of Australian, New Zealand and Antarctic birds. Volume 4: Parrots to Dollarbird. Oxford University Press, Melbourne, Australia, 1248 pp. Julian L, Lorenzo A, Chenuet JP, Bonzon M, Marchal C, Vignon L, Collings DA, Walters M, Jackson B, Varsani A. 2012. Evidence of multiple introductions of beak and feather disease virus into the Pacific islands of Nouvelle-Caledonie (New Caledonia). J Gen Virol 93:2466–2472. Katoh K, Misawa K, Kuma KA¨, Miyata T. 2002. MAFFT: A novel method for rapid multiple
296
JOURNAL OF WILDLIFE DISEASES, VOL. 50, NO. 2, APRIL 2014
sequence alignment based on fast Fourier transform. Nucleic Acids Res 30:3059–3066. Khalesi B, Bonne N, Stewart M, Sharp M, Raidal S. 2005. A comparison of haemagglutination, haemagglutination inhibition and PCR for the detection of psittacine beak and feather disease virus infection and a comparison of isolates obtained from loriids. J Gen Virol 86:3039–3046. Kundu S, Faulkes CG, Greenwood AG, Jones CG, Kaiser P, Lyne OD, Black SA, Chowrimootoo A, Groombridge JJ. 2012. Tracking viral evolution during a disease outbreak: The rapid and complete selective sweep of a circovirus in the endangered Echo Parakeet. J Virol 86:5221– 5229. Mackie JT, Black D, Prior H. 2003. Enteritis associated with adenovirus-like particles in captive lorikeets. Aust Vet J 81:293–295. Massaro M, Ortiz-Catedral L, Julian L, Galbraith JA, Kurenbach B, Kearvell J, Kemp J, Van Hal J, Elkington S, Taylor G, et al. 2012. Molecular characterisation of beak and feather disease virus (BFDV) in New Zealand and its implications for managing an infectious disease. Arch Virol 157:1651–1663. Orange-Bellied Parrot Recovery Team. 2013. National recovery plan for the Orange-bellied Parrot (Neophema chrysogaster). http://www.environment.gov. au/biodiversity/threatened/publications/orangebellied-parrot-recovery.html. Accessed August 2013. Ortiz-Catedral L, McInnes K, Hauber ME, Brunton DH. 2009. First report of beak and feather disease virus (BFDV) in wild Red-fronted Parakeets (Cyanoramphus novaezelandiae) in New Zealand. Emu 109:244–247. Patterson EI, Swarbrick CMD, Roman N, Forwood JK, Raidal SR. 2013. Differential expression of two isolates of beak and feather disease virus capsid protein in Escherichia coli. J Virol Methods 1889:118–124. Perry RA. 1981. A psittacine combined beak and feather disease syndrome with particular reference to the Australian Cockatoos Cacatua galerita (Sulphur-crested Cockatoo), Cacatua leadbeateri (Major Mitchell or Pink Cockatoo), Cacatua roseicapella (Galah or Rose-breasted Cockatoo) and Cacatua sanguinea (Little Corella). In: Proceedings No. 55 Refresher Course on Aviary and Caged Birds. The Post-graduate Committee in Veterinary Science. Sydney, Australia, pp. 81–108.
Powell AM. 1903. Nude Cockatoos. Emu 3:55–56. Pritchard R. 2012. Update on the Orange-bellied Parrot Recovery Program. http://www.birdlife. org.au/documents/OBP-Rec-Team-Update-26Jul12. pdf. Accessed August 2013. Raidal SR, Cross GM. 1994. The hemagglutination spectrum of psittacine beak and feather disease virus. Avian Pathol 23:621–630. Raidal SR, McElnea CL, Cross GM. 1993. Seroprevalence of psittacine beak and feather disease in wild psittacine birds in New South Wales. Aust Vet J 70:137–139. Raidal SR, Cross GM, Tomaszewski E, Graham DL, Phalen DN. 1998. A serologic survey for avian polyomavirus and Pacheco’s disease virus in Australian cockatoos. Avian Pathol 27:263–268. Saitou N, Nei M. 1987. The neighbor-joining method: A new method for reconstructing phylogenetic trees. Mol Biol Evol 4:406–425. Smith KF, Sax DF, Lafferty KD. 2006. Evidence for the role of infectious disease in species extinction and endangerment. Conserv Biol 20:1349–1357. Stojanovic D, Webb M, Roshier D, Saunders D, Heinsohn R. 2012. Ground-based survey methods both overestimate and underestimate the abundance of suitable tree-cavities for the endangered Swift Parrot. Emu 112:350–356. Swinnerton KJ, Greenwood AG, Chapman RE, Jones CG. 2005. The incidence of the parasitic disease trichomoniasis and its treatment in reintroduced and wild Pink Pigeons Columba mayeri. Ibis 147:772–782. Swinton J, Harwood J, Grenfell BT, Gilligan CA. 1998. Persistence thresholds for phocine distemper virus infection in harbour seal Phoca vitulina metapopulations. J Anim Ecol 67:54–68. Varsani A, Regnard GL, Bragg R, Hitzeroth II, Rybicki EP. 2011. Global genetic diversity and geographical and host-species distribution of beak and feather disease virus isolates. J Gen Virol 92:752–767. Yilmaz A, Kaleta EF. 2004. Disinfectant tests at 20 and 10 degrees C to determine the virucidal activity against circoviruses. Dtsch Tieraerztl Wochenschr 111:248–251. Ypelaar I, Bassami MR, Wilcox GE, Raidal SR. 1999. A universal polymerase chain reaction for the detection of psittacine beak and feather disease virus. Vet Microbiol 68:141–148. Submitted for publication 22 May 2013. Accepted 20 August 2013.
