VIROLOGY
191,
72-80
(1992)
Evidence of Human Polyomavirus BK and JC Infection in Normal Brain Tissue CORNELIA ELSNER AND KRISTINA DijRRIES’ lnstitut for Virologie und lmmunbiologie der UniversitGt Wslrzburg, Versbacherstrasse Received March 2, 1992; accepted July 6, 1992
7, D-8700 WUrzburg, BRD
Infection with the polyomaviruses JC and BK is ubiquitous in the human population and JCV is the only virus associated with the central nervous system disease progressive multifocal leukoencephalopathy. In the attempt to analyze the pathogenesis of polyomavirus infections we asked whether human polyomaviruses invade the brain during persistence. Brain autopsy material from 67 individuals with disorders other than PML was examined for the presence of polyomavirus DNA. Southern blot analysis demonstrated JCV-specific full-length virus genomes in healthy brain tissue in about 200/o of the patients. Type-specific analysis with polymerase chain reaction and sequencing confirmed these data. Additionally, the presence of BKV DNA sequences covering an early gene fragment and the control region with flanking early and late protein coding sequences was detected. Cloning of the complete BKV genome from two cases supported the assumption that not only full-length JCV DNA was present in those tissue specimens but also BKV genomes. The data obtained demonstrate that dual infection of the brain with the polyomaviruses JCV and BKV is a common event and give strong evidence that both viruses frequently establish a latent CNS infection. o 1992 Academic Press,
Inc.
INTRODUCTION
nosuppression without pathological disorder, but in cases of severe impaired immunocompetence as induced by malignant diseases, after organ transplantation (Walker and Padgett, 1983) or during AIDS (Schmidbauer eta/., 1990) JCV is etiologically related to the fatal demyelinating central nervous system disease progressive multifocal leukoencephalopathy (PML). Although the virus is easily identified in disseminated areas of PML autopsy material (Walker and Padgett, 1983) the pathogenic question of whether PML is due to a primary central nervous system infection or results from reactivation of a latent JC virus infection during immunosuppression is not yet answered. Therefore we looked for the presence of JCV DNA in brain tissue of non-PML individuals. The data obtained demonstrate that not only neurotropic JCV but also BKV frequently invade the human brain and establish a latent CNS infection.
infection with the polyomaviruses JC and BK is endemic in the human population. Both viruses are usually acquired early in life and seroconversion rates are increasing from 70% in young adults to almost 90% in the elderly (Arthur and Shah, 1989; Kitamura et a/., 1990). Primary infection occurs without clinical disease leading to latent viral persistence predominantly in the kidney (Arthur and Shah, 1989; McCance, 1983; Chesters et al., 1983; Ddrries and ter Meulen, 1983). Occasionally polyomavirus DNA was found in lung and liver tissue and in cells of the lymphatic system (Grinnel et a/., 1983; Houff et a/., 1988) but was never detected in the central nervous system of asymptomatic patients (Chesters et a/., 1983; Grinnel et a/., 1983; McCance, 1983). Infection with JCV and BKV was proven in individuals after kidney and bone marrow transplantation by detection of viruses in urine or rise in antibody titers against both viruses (Arthur and Shah, 1989). Demonstration of both viruses in urine of pregnant women (Coleman et a/., 1980) and in kidney tissue of nonimmunocompromised patients (Chesters et al., 1983; McCance, 1983; Ddrries and Elsner, 1991; Flaegstad et a/., 199 1) confirms that concomitant persistence of JC and BK virus frequently occurs in man. However, compared to findings in younger patients, JCV particles were more often found in the urine of nonimmunocompromised older patients, thus pointing to a higher incidence of JCV reactivation with increasing age (Kitamura et al., 1990). Persistent virus infection is reactivated under immu-
MATERIALS AND METHODS Patients material Autopsy material was collected from 67 patients who died of diseases other than PML. The cases included neurological diseases (multiple sclerosis and Huntington’s disease) and nonneurological diseases. This group included malignant systemic tumors such as carcinoma of rectum, prostate, lung (two cases), pancreas, and liver (two cases), malignant lymphoma (two cases) and leukemia (two cases), cardiac diseases (six cases), pneumonia (four cases), diabetes class II (three cases), peritonitis, ulcer, road accident, asphyxia during birth, and five cases with unknown
’ To whom reprint requests should be addressed. 0042-6822192
$5.00
CopyrIght 0 1992 by Academic Press. Inc. All rkghts of reproduction in any form reserved
72
BKV AND JCV INFECTION
diagnosis. Brain tissue specimens were removed from frontal white matter, frontal cortex, parietal white matter, caudate nucleus, putamen, or cerebellar cortex from patients in each group and frozen at -70’. Autopsy material and histopathological diagnosis were kindly provided by the MRC Brain Tissue Bank, Department of Neurology, Cambridge, and the Departments of Pathology in Gottingen and WUrzburg. Blot analysis Cellular DNA was isolated from frozen autopsy material as described previously (Ddrries, 1984). Dot blot analysis was performed with 10 kg cellular DNA/dot. Binding capacity was tested for each filter batch. For Southern blot analysis 20 pg of cellular DNA was cleaved by restriction enzymes at 200 U/20 pg of DNA and separated by electrophoresis in 1Yo agarose gels. Each DNA specimen was hybridized to radioactively labeled vector DNA in nonstringent (tM - 30”) hybridization and used only when found to be negative for bacterial DNA sequences. Cloned genomic JCV or BKV DNA was purified from vector DNA and radioactively labeled to specific activities of l-3 x 10’ cpm 32P/pg JCV DNA by nick translation (Dtirries, 1984) or transcribed in ssRNA (Ddrries and Elsner, 1991). This provided a sensitivity of about 1 pg JCV DNA per 20 pg cellular DNA or 1 genome equivalent in 20 cells as evaluated by reconstruction experiments with homologous virus DNA. High-stringency hybridization of 10” below tM, washing conditions, and autoradiography were as described previously (Ddrries and Elsner, 199 1). Amplification and sequencing by polymerase chain reaction
of virus-specific (PCR)
DNA
For PCR, 1 pg total cellular DNA from each case was amplified with @globin primers as control for amplification (Saiki et a/., 1986). Specimens positive in P-globin PCR were amplified with 50 pmol primer JC-TEPl (5’GAGGAATGCATGCAGATCTACAG3’) and PEP-2 (Arthur et al., 1989) for an early region fragment in a reaction volume of 50 ~1 with 1U/20 cycles of taq polymerase (GIBCO-BRL) in the recommended buffer with of viral DNA was 2.5 mM MgCI,. Amplification achieved by 40 cycles of 1.5 min at 72’, 4 min at 55”, and 1.5 min at 94” following an initial denaturation step of 10 min at 96” in a Techne thermocycler (Ddrries and Elsner, 1991). All reactions were performed in a separate laboratory in parallel with negative and positive controls, and all reagents were pretested for the presence of polyomavirus-specific DNA. Electrophoretic separation of the products was in 3% Nusieve/l% GTG agarose (FMC Bioproducts) in Tris-acetate buffer at 10 V/cm. Standard alkaline blotting was performed overnight onto nylon membranes. JCV- and BKV-specific internal primers (JEP-1, BEP-1) were labeled with T4
IN NORMAL
BRAIN
73
polynucleotide kinase ([32P]ATP, sp act 3000 Ci/mmol) to a specific activity of about 5 X 1O7cpmlpg (Arthur et al., 1989; Flaegstad et a/., 199 1) and hybridized overnight at 1O7cpm/cm2 at 55” in a buffer of 6X SSPE, 5x Denhardt’s solution, 0.5% SDS, 250 pg herring sperm DNA/ml. Washing conditions were in 6X SSPE, 1% SDS at RT and 10 min at 70”. Sensitivity was less than 0.1 pg polyomavirus DNA/fig cellular DNA. Direct sequencing of asymmetric PCR products was performed with PEP-l and PEP-2 (Arthur eta/., 1989; Flaegstad et al., 1991). For PCR of the control region 1 pg total cellular DNA from each case was amplified with 50 pmol of each primer BKTT-1 and BKTT-2 (Flaegstad et a/., 1991) in a 50-~1 reaction volume with 1 U/20 cycles of taq-polymerase in the recommended buffer plus 2.5 mM MgCI,. Products were cleaved to completion with the enzyme HindIll at 20 U/reaction. Electrophoretic separation of the products was at 10 V/cm in 3% Nusieve/l% GTG agarose. Hybridization of the products was performed with a radioactively labeled ssRNA BKV-specific probe that covered the Sstl fragment within the BKV control region and included the 500-bp HindIll DNAfragment of the BKV-amplification product. Cloning of JCV- and BKV-genomic
DNA
For cloning of human polyomavirus DNA in the phage lambda insertion vector NM1 151 (Murray, 1983) cellular DNA was cleaved to completion with the restriction enzyme BarnHI which cuts once in the JCV and BKV genome (Loeber and Dorries, 1988; Frisque et al., 1984; Seif et al., 1979; Yang and Wu, 1979). Vector and recombinant DNA were prepared essentially as described by Sambrook et al. (1989). l-5 X 1O5 clones/pg DNA were obtained by in vitro packaging of recombinant molecules into phage heads. Amplification was carried out in Escherichia coliLE392 cells and screening for virus-specific sequences was conducted by plaque hybridization. Polyomavirus-specific inserts were demonstrated by plaque hybridization with a radioactive JCV-specific RNA probe that detected BKV-specific clones with identical sensitivity. Genetic complexity and type specificity of cloned polyomavirus inserts were determined after two cycles of plaque purification by restriction mapping and Southern blot analyses. RESULTS Detection of full-length polyomavirus DNA in the CNS of non-PML patients by Southern blot analysis Brain tissue from 32 cases with multiple sclerosis and Huntington’s disease in addition to 35 cases without apparent neurological disease were examined (Table 1). Specimens from different segments of each brain were first analyzed for the presence of JCV DNA by dot blot analysis. Hybridization to a radioactive JCV-
ELSNER AND DORRIES
74
TABLE 1 PRESENCEOF POLYOMAVIRUSDNA IN BRAIN TISSUEOF INDIVIDUALSWITHOUTPML JCVd Histopathological diagnosis Neurological diseases Multiple sclerosis Huntington’s disease Nonneurological diseases Malignant diseasec Systemic diseased Total
Number of cases
a
Cases
i-a
Age (years)
BKVb
Specific genomes
24
44-67
22-34 20-90
218 4124
2/a 3124
11 24 67
9-19 20-38
o-a5 26-93
6/l 1 7124 19167
6/l 1 7124 18167
B Five-kilobase genomic DNA determined by JCV-specific Southern blot hybridization with a sensitivity of 0.5 pg of virus DNA/20 pg total cellular DNA, by direct sequencing of the PCR product of the early coding region and cloning of full-length JCV genomes from cases 20 and 23. b BKV-specific sequences as determined by BKV-specific hybridization of an early region PCR product, species-specific restriction analysis with the enzyme HindIll. and cloning of full-length BKV genomes from cases 20 and 23. c Including carcinoma of rectum, prostate, lung (2) pancreas, and liver (2) malignant lymphoma (2) leukemia (2). d Including cases with diabetes class II (3) ulcer (1) road accident (1) peritonitis (1) asphyxia during birth (1) pneumonia (4) cardiac diseases (6) unknown diagnosis (7).
specific probe revealed positive signals in several specimens after 4 weeks of autoradiography (data not shown). The topographical distribution of JCV DNA was determined by examination of several specimens from different parts of the brain. Specimens from frontal white matter, frontal cortex, parietal white matter, caudate nucleus, putamen, and cerebellar cortex were tested. In individual cases JCV DNA was localized only in particular specimens; however, all areas were occasionally found positive. Therefore it can be supposed that JCV has no preference for the infection of particular CNS segments. The amount of JCV-specific sequences in different specimens ranged between 1 and 100 genome equivalents in 20 cells as calculated from reconstruction experiments. Southern blot analysis of hybridizing DNA sequences confirmed the presence of free genomic JCV DNA in positive specimens. Although band positions of circular DNA were barely visible in most specimens (Fig. 1, left), cleavage with the restriction enzyme BarnHI linearized genomic DNA to one band of about 5 kb in length (Fig. 1, right) thus visualizing XV-specific DNA in 19 of 67 cases (about 20%) (Table 1). As hybridization with radioactive probes for human polyomavirus BK was repeatedly negative, it was concluded that genomic JCV DNA was present in the CNS of individuals without JCV-induced neurological disease. Species-specific characterization of polyomavirus DNA in non-PML brain tissue by PCR amplification, specific hybridization and sequencing Although presence of BKV in the CNS was without precedence, genetic relationship between human poly-
omaviruses did not allow conclusive determination of the virus species by hybridization techniques alone (Dorries and Elsner, 1991). For virus characterization, cellular DNA was subjected to PCR with oligonucleotide primers specific for a 199-bp DNA segment within the coding region of JCV and BKV large T antigen (Arthur et al., 1989; Frisque et al., 1984; Seif et al., 1979; Yang and Wu, 1979; Tavis et al., 1989; Loeber and Dbrries, 1988). PCR-amplification products that appeared in the same band position as products generated from cloned virus DNA (Fig. 2A) and following Southern blot hybridization with a radioactively labeled JCV-specific internal oligonucleotide, demonstrated that those products were JCV-specific (Fig. 2B). Direct nucleotide sequencing of the amplification products (Flaegstad eta/., 1991) in positive cases confirmed that those sequences were of the JCV type (Frisque et a/., 1984; Loeber et al., 1988). As high concentration of JCV-amplification products would obscure minute amounts of BKV-specific products, virus specificity was further examined by a species specific endonuclease cleavage with BarnHI. This palindrome is highly conserved at an internal position within the JCV DNA fragment but has never been reported in BKV early gene sequences (Seif et al., 1979; Yang and Wu, 1979; Tavis et al., 1989). As shown in Fig. 2C, product bands from cellular DNA were reduced to a length of 146 and 53 bp as expected for JCV-specific sequences. However, highly sensitive Southern blot hybridization of those gels with a BKVspecific internal oligonucleotide revealed faint bands at a position of uncleaved products (Fig. 2D) and no reaction at positions of JCV-specific bands. This pointed to
BKV AND JCV INFECTION
IN NORMAL
75
BRAIN
BarnHI
cases 15115215336
cases
40 39 23 22 20 19
39
23
22
20
51 40
17 151152
153
Fo
II III I
FIG. 1. Demonstration of free circular JCV DNA in Southern blots of CNS autopsy material of non-PML patients. Total cellular DNA (20 pg) was cleaved with the restriction enzymeXhol (left) that leaves BKV and JCV circular DNA intact or with BarnHI (right) that linearized polyomavirus DNA to one molecule of 5 kb in length. Numbers represent individual cases; 1 5,-3 represent specimens from different regions of the same case. Fo, Form I, II, Ill JCV DNA from purified virions used as a marker. Autoradiography was for 8 and 6 weeks at -7O”, respectively.
the presence of BKV-specific sequences in almost all cases involving JCV genomes, although the number of molecules appeared to be considerably lower than that of JCV DNA. Due to the low amount of BKV sequences, the essential question of the genomic complexity of the BKV DNA molecules could not be answered by Southern blot analysis. Therefore a second segment of BKV target DNA was characterized that included the control region and flanking early- and late-coding DNA segments (Flaegstad et al., 1991). If PCR was performed with primers of greater homology to the BKV sequence as opposed to JCV, amplification products of about 750 bp in length were observed (Fig. 3A). Specificity of those products for BKV was demonstrated by hybridization of Southern blot with a ssRNA probe covering the Sstl fragment within the BKV control region (Seif et a/., 1979). The reaction generated autoradiographic bands with cellular amplification products and the cloned BKV DNAcontrol, whereas cloned JCV DNA remained negative (Fig. 3B). Species-specific restriction analysis with the enzyme HindIll rendered mainly two DNA fragments of the BK type (500 and 240 bp) (Fig. 3C) (Seif et a/., 1979; Yang and Wu, 1979; Tavis et a/., 1989). As expected from the DNA sequence, the ssRNA probe hybridized to the 500-bp HindIll fragment only, thus confirming that the amplification products were BKVspecific (Fig. 3D). The appearance of additional faint JCV-specific fragments in several cases (600 and 150 bp) (Frisque et a/., 1984; Loeber and Dorries, 1988) even after preferential amplification of BKV target DNA, was probably due to the higher concentration of JCV-
specific DNA the presence normal brain BKV genome
in those cases. Those findings confirmed of DNA sequences of both virus types in tissue and suggested that the complete was present.
Cloning of full-length JCV and BKV genomes brain tissue of two non-PML cases
from
The complete virus genome was not successfully amplified by PCR. Therefore we cloned polyomavirusspecific DNA from two cases that were positive for JCV and BKV DNA in PCR analysis in the unique BarnHI site of the highly effective phage lambda insertion vector system (Murray, 1983). Polyomavirus-specific inserts were detected in 12 (case 20) and 19 (case 23) recombinant clones, respectively. Southern blot analysis of virus-specific inserts with the restriction enzyme BarnHI rendered a uniform length of 5 kb similar to that of JCV- and BKV-linearized control DNA(Fig. 4A). Analysis with the type-specific enzyme combination BarnHI/ Xbal revealed two different fragment patterns that were specific for JCV and BKV DNA as compared to that of virus-specific controls (Fig. 4A, 4B). Further cleavage with the enzyme combination BamHIIPvull for inserts of the JCV type and BamHIIHindIII for inserts of the BKV type rendered a fragment pattern that was indicative for either the complete JCV or the complete BKV genome (Fig. 4A, 4B). Cloning and mapping of full-length intact JCV and BKV genomes that derived from CNS tissue specimens of two patients without neurological disease confirmed the findings of the PCR and supported concurrent infection of the human polyomavi-
ELSNER AND DiiRRlES
76
cases
a
b
56 53 51-51.
44 40
39 36
-
20 22
17 15,15,14.14,
13
12 10
3
2
abM
A
199
B
C
199 146 53
D
199
FIG. 2. Detection of T antigen DNA sequences specific for human polyomaviruses in autopsy material of non-PML patients by PCR. (A) Amplification products representing the 199-bp fragment in the early coding region, from cases found positive in Southern blot analysis, were separated on agarose gels after one amplification experiment. (6) Southern blot hybridization of PCR products with a JCV-specific radioactive oligonucleotide probe. Autoradiography was for 1 day. (C) Restriction analysis of the 199.bp products from two combined reactions by cleavage with the enzyme BamHl that resulted in the expected JCV-specific fragments of 146- and 53.bp and full-length products 199 bp in length. (D) Southern blot hybridization of BamHI cleaved PCR products with a BKV-specific radioactive oligonucleotide probe. Autoradiographyof non-PML cases was for 2 weeks. BKV a, product from 50 ng cloned BKV DNA; BKV b. product cleaved by BarnHI; JCV a, product from 50 ng cloned JCV DNA; JCV b, product cleaved by BarnHI; numbers represent individual cases: 1 5,,2, 14,,, , 5 1 ,,2 show products from different regions of the same case. bp indicates length of individual fragments; M, marker bands are phiXl74/Haelll DNA fragments from 1358-l 94 bp in length.
ruses JCV and BKV in brain tissue of non-PML patients and normal individuals (Table 1). DISCUSSION Infection with the human polyomaviruses BK and JC is followed by lifelong viral persistence that can be reactivated repeatedly to a clinically inapparent infection. Under prolonged impairment of the immune system BKV is related to severe urinary tract disorder
caused by reactivation of an inapparent persistent infection of the kidney. The second virus JC is associated with CNS disease. To date, it is argued that the disease results from cytolytic invasion of the tissue under severe immunosuppression and not as a consequence of a preceding persistent infection (Chesters eta/., 1983; Grinnel et a/., 1983; McCance, 1983). However, application of highly sensitive hybridization methods enabled us to detect frequent JCV infection in brain tissue
BKV AND JCV INFECTION
IN NORMAL
BRAIN
77
cases
JCV
BKV
A
a-
b
3
2
40
56
53
52
51
44 17 151 152 153 14, 142 13 12
a-b
M
bp
bp
750
-870 ‘600
A
B
D
FIG. 3. Presence of BKV-specific DNA including the control region and flanking early and late coding sequences in brain tissue of non-PML patients. (A) Amplification of BKV-specific DNA sequences with a primer pair for the control region in cellular autopsy DNA from individual cases yielded PCR fragments of about 750 bp in length. BKV a, product from 50 ng cloned BKV DNA; JCV a, product from 50 ng cloned JCV DNA, M, marker bands are phiXl74/Haelll DNA fragments from 1358-l 18 bp. (B) Southern blot hybridization of PCR products with a BKV-specific radioactive ssRNA probe covering the complete control region and flanking sequences. Autoradiography was for 1 day. (C) Products of two individual PCR reactions for each DNA specimen were combined and cleaved with the restriction enzyme HindIll that predominantly rendered fragments of BKV-specific length. At least in cases 15 and 44 faint JCV-specific bands were also visible. (D) Southern blot hybridization of HindIll-cleaved PCR products with the radioactive BKV ssRNA probe that is specific for the 500-bp BKV HindIll fragment within amplified DNA. Autoradiography was for 1 day. A, B, HindIll fragments; BKV b. 500 and 250 bp in length; JCV b, about 600 and 150 bp in length. M, marker bands are phiXl74/Haelll DNA fragments from 1358-l 94 bp. Numbers represent DNA specimens from individual cases; 15,_, , 14,_, represent products from two regions of the same case.
of multiple patients without polyomavirus-associated CNS disease by the demonstration of free, full-length polyomavirus genomes. Compared to thousands of genome equivalents per cell in most specimens from partitular cases of PML (Dbrries et al., 1979; Walker and Padgett, 1983), the number of positives ranged between 1 and 4 in 10 specimens of non-PML tissue. The
amount of virus-specific DNA is estimated in a range of 1 to 1000 genome equivalents per 200 cells. In addition to JCV DNA, human polyomavirus BK DNA was detected in all but one case by PCR amplification and species-specific Southern blot mapping of CNS-derived virus DNA. Interestingly, the concentration of BKV DNA was considerably lower compared to
78
ELSNER AND DijRRlES
A
Bana JCVBKV
a
bcde
f
JCVBKV
BamEI/HindIII
BaaEI/PvuII
BaaII/XbaI a
b
c
d
e
JCV c
f
d
f
a
b
e
BKV
kb
5.1 3.0 2.7 2.0 1.3
0.4
0.9 I
2760 0.1 I
2010
0.23 I
0.5 I
660
BKV
1410
0.98
I
BamHI/XbaI
I
370
0.710.72 II
BamHI/PvuII
1100
1940
0.97
0.23
0.98 BamHI/XbaI
1290
3800 0.17 I 1930
980
I 0.0
I
0.540.62 0.72 I I I 420 510
I
I
I
I
0.5
I
I
0.98 I
BamHI/HindIII
1320
I
I
I
mu
1.0
FIG. 4. Characterization of polyomavirus-specific genomes cloned directly from autopsy specimens of two patients without CNS disease by restriction mapping and Southern blot analysis. (A) BarnHI: Determination of the genomic length of polyomavirus-specific recombinant DNA. Virus-specific inserts were released from vector DNA by the restriction endonuclease BarnHI. BamHIIXbal: restriction endonuclease mapping of cloned virus genomes. BarnHI-released inserts were characterized by additional type-specific cleavage with the enzymeXbal. Bands in position of full-length 5-kb genomes were due to incomplete cleavage. BamHIlPvull: determination of the genetic complexity of cloned JCV genomes from case 20 and 23. BamHIIHindlll: determination of the genetic complexity of cloned BKV genomes from cases 20 and 23. Lanes a-c, recombinant clones derived from cellular brain DNA of case 20; lanes d-f recombinant clones derived from case 23; JCV-, BKV-cloned genomic DNA (JCV Mad-l strain, BKV Dunford strain) released from vector pBR322 by the enzyme BarnHI, cleaved by BamHWbal and BamHIIPvulI or BamHIIHindlll. respectively; kb, length of complete virus genomes and JCV and BKV restriction fragments of a BamHWbal enzyme reaction. A-E BamHIIHindIII fragments of the BKV type. A-D BamHIIPvull fragments of the JCV type. (B) Restriction map of BKV (Dunford strain) (Seif et a/., 1979) and JCV (Mad-l strain) (Frisque ef a/., 1984). DNA Fragments are indicated by length in base pairs, map units (mu) were calculated according to the sequence length of BKV and JCV genomic DNA.
JCV DNA ranging from 1 to about 20 genome equivalents per 200 cells. As BKV seroconversion is approximately 99% by the age of 10 years (Arthur and Shah, 1989) the number of positive cases probably reflects the high rate of BKV infection in the population, whereas the amount of viral DNA indicates reduced viral activity in the CNS compared to that of JCV. Although BKV appears not to be related to any known neurological disease (Arthur and Shah, 1989)
integrated BKV DNA and subgenomic sequences were occasionally detected in human brain tumors (Dorries et a/., 1987; Negrini et a/., 1990). Analysis of the physical state and the genetic complexity of virus sequences in healthy tissue by cloning of polyomavirus sequences resulted exclusively in unique full-length BKV- and JCV-specific genomes. The genetic complexity was identical with that of infectious virus DNA as shown by complete virus-specific restriction maps
BKV AND JCV INFECTION
with enzymes that generate a complex fragment pattern. This result affirmed that virus DNA in healthy brain tissue is not integrated and it is conceivable to assume that the episomal state of polyomavirus DNA is indicative for a latent virus infection. Obviously, besides the kidney (Arthur and Shah, 1989; Coleman et a/., 1980) the CNS is a target for human polyomavirus persistence as evidenced by the detection of free, full-length virus genomes belonging to both polyomavirus species in most infected patients. This implicates that JCV probably infects the CNS long before the induction of clinically overt PML. Although the amount of virus-specific DNA was much lower than in PML tissue, analysis of multiple areas of the brain disclosed that JC virus DNA is similarly distributed as typically described in PML tissue (Walker and Padgett, 1983). This suggests that latent polyomavirus infection in the CNS is restricted to a few isolated cells. The number of cells might increase under severe immunosuppressive disease as indicated by an increased incidence of polyomavirus DNA in multiple CNS specimens of patients with malignancies. In combination with the finding of elevated virus-specific antibody titers in tumor patients (Hogan et al., 1983) it can be assumed that impairment of the immune system, as induced by malignant tumor growth, favors involvement of the CNS in polyomavirus infection. In summary, the presented data prove that human polyomavirus infection is associated with subclinical virus entry into the CNS. In case of severe immunosuppression it is very likely that inapparent JCV infection leads to increased incidence of viral reactivation (Kleihues et al., 1985). Consequently, highly active virus variants might develop (Ddrries and Elsner, 1991; Yogo et a/., 1991) that are believed to be a prerequisite for the progredient cytolytic infection of oligodendroglia cells leading to PML.
ACKNOWLEDGMENT This study was supported by the Deutsche schaft, Sonderforschungsbereich SFB 165.
Forschungsgemein-
REFERENCES ARTHUR, R. R., DAGOSTIN, S., and SHAH, K. V. (1989). Detection of BK virus and JC virus in urine and brain tissue by the polymerase chain reaction. 1. C/in. Microbial. 27, 1 174-l 179. ARTHUR, R. R., and SHAH, K. V. (1989). Occurrence and significance of papovaviruses BK and JC in the urine. frog. Med. Viral. 36, 42-6 1. CHESTERS, P. M., HERITAGE,J., and MCCANCE, D. J. (1983). Persistence of DNA sequences of BK virus and JC virus in normal human tissues and in diseased tissues. J. Infect. Dis. 147, 676-684. COLEMAN, D. V., WOLFENDALE, M. R., DANIEL, R. A., DHANJAL, N. K.. GARDNER,S. D.. GIBSON, P. E., and FIELD, A. M. (1980). A prospec-
IN NORMAL
BRAIN
79
tive study of human polyomavirus infection in pregnancy. 1, /nfecr. Dis. 142, 1-8. D~RRIES, K. (1984). Progressive multifocal leukoencephalopathy: Analysis of JC virus DNA from brain and kidney tissue. Virus Res. 1, 25-38. D~RRIES. K.. and ELSNER,C. (1991). Persistent polyomavirus infection in kidney tissue of patients with diseases other than progressive multifocal leukoencephalopathy. Virology (Life Sci. A&.) 10, 5 I61. D~RRIES, K., JOHNSON,R. T.. and TER MEULEN, V. (1979). Detection of Polyoma virus DNA in PML-brain tissue by (in situ) hybridization. J. Gen. Wrol. 42, 49-57. D~RRIES, K., LOEBER, G., and MEIXENSBERGER,J. (1987). Association of polyoma viruses JC, SV40 and BK with human brain tumors. Virology 160, 268-270. D~RRIES, K., and TER MEULEN, V. (1983). Detection of papovavirus JC in kidney tissue. /. Med. Viral. 11, 307-317. FLAEGSTAD,T., SUNDSFJORD,A., ARTHUR, R. R., PEDERSEN,M., TRAAVIK, T., and SUBRAMANI,S. (1991). Amplification and sequencing of the control regions of BK and JC virus from human urine by polymerase chain reaction. Virology 160, 553-560. FRISQUE, R. J., BREAM, G. L., and CANNELIA, M. T. (1984). Human polyomavirus JC genome. J. Viral. 51, 458-469. GRINNEL, B. W., PADGET, B. L., and WALKER, D. L. (1983). Distribution of nonintegrated DNA from JC papovavirus in organs of patients with progressive multifocal leukoencephalopathy. /. infect. Dis. 147, 669-675. HOGAN, T. H., PADGETT, B. L.. WALKER, D. L., BORDEN, E. C., and FRIAS, Z. (1983). Survey of human polyomavirus (JCV, BKV) infections in 139 patients with lung cancer, melanoma or lymphoma. In “Polyomaviruses and Human Neurological Diseases,” pp. 31 l324. A. R. Liss, New York. HOUFF, S. A., MAJOR, E. O., KATZ, D. A., KUFTA, C. V., SEVER, J. L., PITTALUGA,S., ROBERTS,J. R., GITT, J., SAINI, N., and Lux, W. (1988). Involvement of JC virus-infected mononuclear cells from the bone marrow and spleen in the pathogenesis of progressive multifocal leukoencephalopathy. N. Engl. J. Med. 318, 301-305. KITAMURA,T., Aso, Y., KUNIYOSHI,N., HARA, K., and YOGO, Y. (1990). High incidence of urinary JC virus in nonimmunosuppressed older patients. 1. Infecf. Dis. 161, 1 128-l 133. KLEIHUS, P., LANG, W., BURGER,P. C., BUDKA. H., VOGT, M.. MAURER, R., LUTHY, R., and SIEGENTHALER,W. (1985) Progressive diffuse leukoencephalopathy in patients with acquired immune deficiency syndrome (AIDS). Acta Neuropathol. (Berlin) 68, 333-339. LOEBER, G., and D~RRIES, K. (1988). DNA rearrangements in organspecific variants of polyomavirus JC strain GS. J. Viral. 62, 17301735. MCCANCE, D. J. (1983). Persistence of animal and human papovaviruses in renal and nervous tissues. In “Polyomaviruses and Human Neurological Diseases,” pp. 343-357. A. R. Liss. New York. MURRAY, N. E. (1983). ln “Lambda II” (R. W. Hendrix, J. W. Roberts, F. W. Stahl, and R. A. Weisberg, Eds.) Cold Spring Harbor Press, Cold Spring Harbor, New York. NEGRINI, M., RIMESSI, P., MANTOVANI, C., SABBIONI, S., CORALLINI, A., GEROSA, M. A., and BARBANTI-BRODANO,G. (1990). Characterization of BK virus variants rescued from human tumours and tumour cell lines. J. Gen. Viral. 71, 2731-2736. SAIKI, R. K., SCHARF, S., FALOONA, F., MULLIS, K. B., HORN, G. T., ERLICH, H. A., and ARNHEIM, N. (1986). Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science 230, 1350-l 354. SAMBROOK. J., FRITSCH, E. F., and MANIATIS, T. (1989). “Molecular cloning: A Laboratory Manual.” Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York.
60
ELSNER AND DiiRRlES
SCHMIDBAUER, M., BUDKA,H., and SHAH, K. V. (1990). Progressive multifocal leukoencephalopathy (PML) in AIDS and in the pre-AIDS era. Acfa Neuropathol. 80, 375-380. SEIF, I., KHOURY,G., and DHAR, R. (1979). The genome of human polyomavirus BK. Cell 18, 963-977. TAVIS.J. E., WALKER,D. L., GARDNER,S. D., and FRISQUE, R. J. (1989). Nucleotide sequence of the human polyomavirus AS Virus, an antigenic variant of BK virus. 1. Viral. 63, 901-91 1. SUNDSFJORD, A., JOHANSEN, T., FLAEGSTAD, T., MOENS,U., VILLAND,P., SUBRAMANI, S., and TRAAVIK,T. (1990). At least two types of control
regions can be found among naturally occurring BK virus strains. J. Virol. 64, 3864-3871. WALKER,D. L., and PADGET, B. L. (1983). Progressive multifocal leukoencephalopathy. Comp. Viral. 18, 161-l 93. YANG,R. C. A., and Wu, R. (1979). BK virus DNA: Complete nucleotide sequence of a human tumor virus. Science 206,456-462. YOGO,Y., KITAMUR~,T., SUGIMOTO, C., HARA,K., IIDA,T., TAGUCHI,F.. TAJIMA,A., KAWABE,K., and Aso, Y. (1991). Sequence rearrangement in JC virus DNA’s molecularly cloned from immunosuppressed renal transplant patients. J. Viral. 65, 2422-2428.
191,
72-80
(1992)
Evidence of Human Polyomavirus BK and JC Infection in Normal Brain Tissue CORNELIA ELSNER AND KRISTINA DijRRIES’ lnstitut for Virologie und lmmunbiologie der UniversitGt Wslrzburg, Versbacherstrasse Received March 2, 1992; accepted July 6, 1992
7, D-8700 WUrzburg, BRD
Infection with the polyomaviruses JC and BK is ubiquitous in the human population and JCV is the only virus associated with the central nervous system disease progressive multifocal leukoencephalopathy. In the attempt to analyze the pathogenesis of polyomavirus infections we asked whether human polyomaviruses invade the brain during persistence. Brain autopsy material from 67 individuals with disorders other than PML was examined for the presence of polyomavirus DNA. Southern blot analysis demonstrated JCV-specific full-length virus genomes in healthy brain tissue in about 200/o of the patients. Type-specific analysis with polymerase chain reaction and sequencing confirmed these data. Additionally, the presence of BKV DNA sequences covering an early gene fragment and the control region with flanking early and late protein coding sequences was detected. Cloning of the complete BKV genome from two cases supported the assumption that not only full-length JCV DNA was present in those tissue specimens but also BKV genomes. The data obtained demonstrate that dual infection of the brain with the polyomaviruses JCV and BKV is a common event and give strong evidence that both viruses frequently establish a latent CNS infection. o 1992 Academic Press,
Inc.
INTRODUCTION
nosuppression without pathological disorder, but in cases of severe impaired immunocompetence as induced by malignant diseases, after organ transplantation (Walker and Padgett, 1983) or during AIDS (Schmidbauer eta/., 1990) JCV is etiologically related to the fatal demyelinating central nervous system disease progressive multifocal leukoencephalopathy (PML). Although the virus is easily identified in disseminated areas of PML autopsy material (Walker and Padgett, 1983) the pathogenic question of whether PML is due to a primary central nervous system infection or results from reactivation of a latent JC virus infection during immunosuppression is not yet answered. Therefore we looked for the presence of JCV DNA in brain tissue of non-PML individuals. The data obtained demonstrate that not only neurotropic JCV but also BKV frequently invade the human brain and establish a latent CNS infection.
infection with the polyomaviruses JC and BK is endemic in the human population. Both viruses are usually acquired early in life and seroconversion rates are increasing from 70% in young adults to almost 90% in the elderly (Arthur and Shah, 1989; Kitamura et a/., 1990). Primary infection occurs without clinical disease leading to latent viral persistence predominantly in the kidney (Arthur and Shah, 1989; McCance, 1983; Chesters et al., 1983; Ddrries and ter Meulen, 1983). Occasionally polyomavirus DNA was found in lung and liver tissue and in cells of the lymphatic system (Grinnel et a/., 1983; Houff et a/., 1988) but was never detected in the central nervous system of asymptomatic patients (Chesters et a/., 1983; Grinnel et a/., 1983; McCance, 1983). Infection with JCV and BKV was proven in individuals after kidney and bone marrow transplantation by detection of viruses in urine or rise in antibody titers against both viruses (Arthur and Shah, 1989). Demonstration of both viruses in urine of pregnant women (Coleman et a/., 1980) and in kidney tissue of nonimmunocompromised patients (Chesters et al., 1983; McCance, 1983; Ddrries and Elsner, 1991; Flaegstad et a/., 199 1) confirms that concomitant persistence of JC and BK virus frequently occurs in man. However, compared to findings in younger patients, JCV particles were more often found in the urine of nonimmunocompromised older patients, thus pointing to a higher incidence of JCV reactivation with increasing age (Kitamura et al., 1990). Persistent virus infection is reactivated under immu-
MATERIALS AND METHODS Patients material Autopsy material was collected from 67 patients who died of diseases other than PML. The cases included neurological diseases (multiple sclerosis and Huntington’s disease) and nonneurological diseases. This group included malignant systemic tumors such as carcinoma of rectum, prostate, lung (two cases), pancreas, and liver (two cases), malignant lymphoma (two cases) and leukemia (two cases), cardiac diseases (six cases), pneumonia (four cases), diabetes class II (three cases), peritonitis, ulcer, road accident, asphyxia during birth, and five cases with unknown
’ To whom reprint requests should be addressed. 0042-6822192
$5.00
CopyrIght 0 1992 by Academic Press. Inc. All rkghts of reproduction in any form reserved
72
BKV AND JCV INFECTION
diagnosis. Brain tissue specimens were removed from frontal white matter, frontal cortex, parietal white matter, caudate nucleus, putamen, or cerebellar cortex from patients in each group and frozen at -70’. Autopsy material and histopathological diagnosis were kindly provided by the MRC Brain Tissue Bank, Department of Neurology, Cambridge, and the Departments of Pathology in Gottingen and WUrzburg. Blot analysis Cellular DNA was isolated from frozen autopsy material as described previously (Ddrries, 1984). Dot blot analysis was performed with 10 kg cellular DNA/dot. Binding capacity was tested for each filter batch. For Southern blot analysis 20 pg of cellular DNA was cleaved by restriction enzymes at 200 U/20 pg of DNA and separated by electrophoresis in 1Yo agarose gels. Each DNA specimen was hybridized to radioactively labeled vector DNA in nonstringent (tM - 30”) hybridization and used only when found to be negative for bacterial DNA sequences. Cloned genomic JCV or BKV DNA was purified from vector DNA and radioactively labeled to specific activities of l-3 x 10’ cpm 32P/pg JCV DNA by nick translation (Dtirries, 1984) or transcribed in ssRNA (Ddrries and Elsner, 1991). This provided a sensitivity of about 1 pg JCV DNA per 20 pg cellular DNA or 1 genome equivalent in 20 cells as evaluated by reconstruction experiments with homologous virus DNA. High-stringency hybridization of 10” below tM, washing conditions, and autoradiography were as described previously (Ddrries and Elsner, 199 1). Amplification and sequencing by polymerase chain reaction
of virus-specific (PCR)
DNA
For PCR, 1 pg total cellular DNA from each case was amplified with @globin primers as control for amplification (Saiki et a/., 1986). Specimens positive in P-globin PCR were amplified with 50 pmol primer JC-TEPl (5’GAGGAATGCATGCAGATCTACAG3’) and PEP-2 (Arthur et al., 1989) for an early region fragment in a reaction volume of 50 ~1 with 1U/20 cycles of taq polymerase (GIBCO-BRL) in the recommended buffer with of viral DNA was 2.5 mM MgCI,. Amplification achieved by 40 cycles of 1.5 min at 72’, 4 min at 55”, and 1.5 min at 94” following an initial denaturation step of 10 min at 96” in a Techne thermocycler (Ddrries and Elsner, 1991). All reactions were performed in a separate laboratory in parallel with negative and positive controls, and all reagents were pretested for the presence of polyomavirus-specific DNA. Electrophoretic separation of the products was in 3% Nusieve/l% GTG agarose (FMC Bioproducts) in Tris-acetate buffer at 10 V/cm. Standard alkaline blotting was performed overnight onto nylon membranes. JCV- and BKV-specific internal primers (JEP-1, BEP-1) were labeled with T4
IN NORMAL
BRAIN
73
polynucleotide kinase ([32P]ATP, sp act 3000 Ci/mmol) to a specific activity of about 5 X 1O7cpmlpg (Arthur et al., 1989; Flaegstad et a/., 199 1) and hybridized overnight at 1O7cpm/cm2 at 55” in a buffer of 6X SSPE, 5x Denhardt’s solution, 0.5% SDS, 250 pg herring sperm DNA/ml. Washing conditions were in 6X SSPE, 1% SDS at RT and 10 min at 70”. Sensitivity was less than 0.1 pg polyomavirus DNA/fig cellular DNA. Direct sequencing of asymmetric PCR products was performed with PEP-l and PEP-2 (Arthur eta/., 1989; Flaegstad et al., 1991). For PCR of the control region 1 pg total cellular DNA from each case was amplified with 50 pmol of each primer BKTT-1 and BKTT-2 (Flaegstad et a/., 1991) in a 50-~1 reaction volume with 1 U/20 cycles of taq-polymerase in the recommended buffer plus 2.5 mM MgCI,. Products were cleaved to completion with the enzyme HindIll at 20 U/reaction. Electrophoretic separation of the products was at 10 V/cm in 3% Nusieve/l% GTG agarose. Hybridization of the products was performed with a radioactively labeled ssRNA BKV-specific probe that covered the Sstl fragment within the BKV control region and included the 500-bp HindIll DNAfragment of the BKV-amplification product. Cloning of JCV- and BKV-genomic
DNA
For cloning of human polyomavirus DNA in the phage lambda insertion vector NM1 151 (Murray, 1983) cellular DNA was cleaved to completion with the restriction enzyme BarnHI which cuts once in the JCV and BKV genome (Loeber and Dorries, 1988; Frisque et al., 1984; Seif et al., 1979; Yang and Wu, 1979). Vector and recombinant DNA were prepared essentially as described by Sambrook et al. (1989). l-5 X 1O5 clones/pg DNA were obtained by in vitro packaging of recombinant molecules into phage heads. Amplification was carried out in Escherichia coliLE392 cells and screening for virus-specific sequences was conducted by plaque hybridization. Polyomavirus-specific inserts were demonstrated by plaque hybridization with a radioactive JCV-specific RNA probe that detected BKV-specific clones with identical sensitivity. Genetic complexity and type specificity of cloned polyomavirus inserts were determined after two cycles of plaque purification by restriction mapping and Southern blot analyses. RESULTS Detection of full-length polyomavirus DNA in the CNS of non-PML patients by Southern blot analysis Brain tissue from 32 cases with multiple sclerosis and Huntington’s disease in addition to 35 cases without apparent neurological disease were examined (Table 1). Specimens from different segments of each brain were first analyzed for the presence of JCV DNA by dot blot analysis. Hybridization to a radioactive JCV-
ELSNER AND DORRIES
74
TABLE 1 PRESENCEOF POLYOMAVIRUSDNA IN BRAIN TISSUEOF INDIVIDUALSWITHOUTPML JCVd Histopathological diagnosis Neurological diseases Multiple sclerosis Huntington’s disease Nonneurological diseases Malignant diseasec Systemic diseased Total
Number of cases
a
Cases
i-a
Age (years)
BKVb
Specific genomes
24
44-67
22-34 20-90
218 4124
2/a 3124
11 24 67
9-19 20-38
o-a5 26-93
6/l 1 7124 19167
6/l 1 7124 18167
B Five-kilobase genomic DNA determined by JCV-specific Southern blot hybridization with a sensitivity of 0.5 pg of virus DNA/20 pg total cellular DNA, by direct sequencing of the PCR product of the early coding region and cloning of full-length JCV genomes from cases 20 and 23. b BKV-specific sequences as determined by BKV-specific hybridization of an early region PCR product, species-specific restriction analysis with the enzyme HindIll. and cloning of full-length BKV genomes from cases 20 and 23. c Including carcinoma of rectum, prostate, lung (2) pancreas, and liver (2) malignant lymphoma (2) leukemia (2). d Including cases with diabetes class II (3) ulcer (1) road accident (1) peritonitis (1) asphyxia during birth (1) pneumonia (4) cardiac diseases (6) unknown diagnosis (7).
specific probe revealed positive signals in several specimens after 4 weeks of autoradiography (data not shown). The topographical distribution of JCV DNA was determined by examination of several specimens from different parts of the brain. Specimens from frontal white matter, frontal cortex, parietal white matter, caudate nucleus, putamen, and cerebellar cortex were tested. In individual cases JCV DNA was localized only in particular specimens; however, all areas were occasionally found positive. Therefore it can be supposed that JCV has no preference for the infection of particular CNS segments. The amount of JCV-specific sequences in different specimens ranged between 1 and 100 genome equivalents in 20 cells as calculated from reconstruction experiments. Southern blot analysis of hybridizing DNA sequences confirmed the presence of free genomic JCV DNA in positive specimens. Although band positions of circular DNA were barely visible in most specimens (Fig. 1, left), cleavage with the restriction enzyme BarnHI linearized genomic DNA to one band of about 5 kb in length (Fig. 1, right) thus visualizing XV-specific DNA in 19 of 67 cases (about 20%) (Table 1). As hybridization with radioactive probes for human polyomavirus BK was repeatedly negative, it was concluded that genomic JCV DNA was present in the CNS of individuals without JCV-induced neurological disease. Species-specific characterization of polyomavirus DNA in non-PML brain tissue by PCR amplification, specific hybridization and sequencing Although presence of BKV in the CNS was without precedence, genetic relationship between human poly-
omaviruses did not allow conclusive determination of the virus species by hybridization techniques alone (Dorries and Elsner, 1991). For virus characterization, cellular DNA was subjected to PCR with oligonucleotide primers specific for a 199-bp DNA segment within the coding region of JCV and BKV large T antigen (Arthur et al., 1989; Frisque et al., 1984; Seif et al., 1979; Yang and Wu, 1979; Tavis et al., 1989; Loeber and Dbrries, 1988). PCR-amplification products that appeared in the same band position as products generated from cloned virus DNA (Fig. 2A) and following Southern blot hybridization with a radioactively labeled JCV-specific internal oligonucleotide, demonstrated that those products were JCV-specific (Fig. 2B). Direct nucleotide sequencing of the amplification products (Flaegstad eta/., 1991) in positive cases confirmed that those sequences were of the JCV type (Frisque et a/., 1984; Loeber et al., 1988). As high concentration of JCV-amplification products would obscure minute amounts of BKV-specific products, virus specificity was further examined by a species specific endonuclease cleavage with BarnHI. This palindrome is highly conserved at an internal position within the JCV DNA fragment but has never been reported in BKV early gene sequences (Seif et al., 1979; Yang and Wu, 1979; Tavis et al., 1989). As shown in Fig. 2C, product bands from cellular DNA were reduced to a length of 146 and 53 bp as expected for JCV-specific sequences. However, highly sensitive Southern blot hybridization of those gels with a BKVspecific internal oligonucleotide revealed faint bands at a position of uncleaved products (Fig. 2D) and no reaction at positions of JCV-specific bands. This pointed to
BKV AND JCV INFECTION
IN NORMAL
75
BRAIN
BarnHI
cases 15115215336
cases
40 39 23 22 20 19
39
23
22
20
51 40
17 151152
153
Fo
II III I
FIG. 1. Demonstration of free circular JCV DNA in Southern blots of CNS autopsy material of non-PML patients. Total cellular DNA (20 pg) was cleaved with the restriction enzymeXhol (left) that leaves BKV and JCV circular DNA intact or with BarnHI (right) that linearized polyomavirus DNA to one molecule of 5 kb in length. Numbers represent individual cases; 1 5,-3 represent specimens from different regions of the same case. Fo, Form I, II, Ill JCV DNA from purified virions used as a marker. Autoradiography was for 8 and 6 weeks at -7O”, respectively.
the presence of BKV-specific sequences in almost all cases involving JCV genomes, although the number of molecules appeared to be considerably lower than that of JCV DNA. Due to the low amount of BKV sequences, the essential question of the genomic complexity of the BKV DNA molecules could not be answered by Southern blot analysis. Therefore a second segment of BKV target DNA was characterized that included the control region and flanking early- and late-coding DNA segments (Flaegstad et al., 1991). If PCR was performed with primers of greater homology to the BKV sequence as opposed to JCV, amplification products of about 750 bp in length were observed (Fig. 3A). Specificity of those products for BKV was demonstrated by hybridization of Southern blot with a ssRNA probe covering the Sstl fragment within the BKV control region (Seif et a/., 1979). The reaction generated autoradiographic bands with cellular amplification products and the cloned BKV DNAcontrol, whereas cloned JCV DNA remained negative (Fig. 3B). Species-specific restriction analysis with the enzyme HindIll rendered mainly two DNA fragments of the BK type (500 and 240 bp) (Fig. 3C) (Seif et a/., 1979; Yang and Wu, 1979; Tavis et a/., 1989). As expected from the DNA sequence, the ssRNA probe hybridized to the 500-bp HindIll fragment only, thus confirming that the amplification products were BKVspecific (Fig. 3D). The appearance of additional faint JCV-specific fragments in several cases (600 and 150 bp) (Frisque et a/., 1984; Loeber and Dorries, 1988) even after preferential amplification of BKV target DNA, was probably due to the higher concentration of JCV-
specific DNA the presence normal brain BKV genome
in those cases. Those findings confirmed of DNA sequences of both virus types in tissue and suggested that the complete was present.
Cloning of full-length JCV and BKV genomes brain tissue of two non-PML cases
from
The complete virus genome was not successfully amplified by PCR. Therefore we cloned polyomavirusspecific DNA from two cases that were positive for JCV and BKV DNA in PCR analysis in the unique BarnHI site of the highly effective phage lambda insertion vector system (Murray, 1983). Polyomavirus-specific inserts were detected in 12 (case 20) and 19 (case 23) recombinant clones, respectively. Southern blot analysis of virus-specific inserts with the restriction enzyme BarnHI rendered a uniform length of 5 kb similar to that of JCV- and BKV-linearized control DNA(Fig. 4A). Analysis with the type-specific enzyme combination BarnHI/ Xbal revealed two different fragment patterns that were specific for JCV and BKV DNA as compared to that of virus-specific controls (Fig. 4A, 4B). Further cleavage with the enzyme combination BamHIIPvull for inserts of the JCV type and BamHIIHindIII for inserts of the BKV type rendered a fragment pattern that was indicative for either the complete JCV or the complete BKV genome (Fig. 4A, 4B). Cloning and mapping of full-length intact JCV and BKV genomes that derived from CNS tissue specimens of two patients without neurological disease confirmed the findings of the PCR and supported concurrent infection of the human polyomavi-
ELSNER AND DiiRRlES
76
cases
a
b
56 53 51-51.
44 40
39 36
-
20 22
17 15,15,14.14,
13
12 10
3
2
abM
A
199
B
C
199 146 53
D
199
FIG. 2. Detection of T antigen DNA sequences specific for human polyomaviruses in autopsy material of non-PML patients by PCR. (A) Amplification products representing the 199-bp fragment in the early coding region, from cases found positive in Southern blot analysis, were separated on agarose gels after one amplification experiment. (6) Southern blot hybridization of PCR products with a JCV-specific radioactive oligonucleotide probe. Autoradiography was for 1 day. (C) Restriction analysis of the 199.bp products from two combined reactions by cleavage with the enzyme BamHl that resulted in the expected JCV-specific fragments of 146- and 53.bp and full-length products 199 bp in length. (D) Southern blot hybridization of BamHI cleaved PCR products with a BKV-specific radioactive oligonucleotide probe. Autoradiographyof non-PML cases was for 2 weeks. BKV a, product from 50 ng cloned BKV DNA; BKV b. product cleaved by BarnHI; JCV a, product from 50 ng cloned JCV DNA; JCV b, product cleaved by BarnHI; numbers represent individual cases: 1 5,,2, 14,,, , 5 1 ,,2 show products from different regions of the same case. bp indicates length of individual fragments; M, marker bands are phiXl74/Haelll DNA fragments from 1358-l 94 bp in length.
ruses JCV and BKV in brain tissue of non-PML patients and normal individuals (Table 1). DISCUSSION Infection with the human polyomaviruses BK and JC is followed by lifelong viral persistence that can be reactivated repeatedly to a clinically inapparent infection. Under prolonged impairment of the immune system BKV is related to severe urinary tract disorder
caused by reactivation of an inapparent persistent infection of the kidney. The second virus JC is associated with CNS disease. To date, it is argued that the disease results from cytolytic invasion of the tissue under severe immunosuppression and not as a consequence of a preceding persistent infection (Chesters eta/., 1983; Grinnel et a/., 1983; McCance, 1983). However, application of highly sensitive hybridization methods enabled us to detect frequent JCV infection in brain tissue
BKV AND JCV INFECTION
IN NORMAL
BRAIN
77
cases
JCV
BKV
A
a-
b
3
2
40
56
53
52
51
44 17 151 152 153 14, 142 13 12
a-b
M
bp
bp
750
-870 ‘600
A
B
D
FIG. 3. Presence of BKV-specific DNA including the control region and flanking early and late coding sequences in brain tissue of non-PML patients. (A) Amplification of BKV-specific DNA sequences with a primer pair for the control region in cellular autopsy DNA from individual cases yielded PCR fragments of about 750 bp in length. BKV a, product from 50 ng cloned BKV DNA; JCV a, product from 50 ng cloned JCV DNA, M, marker bands are phiXl74/Haelll DNA fragments from 1358-l 18 bp. (B) Southern blot hybridization of PCR products with a BKV-specific radioactive ssRNA probe covering the complete control region and flanking sequences. Autoradiography was for 1 day. (C) Products of two individual PCR reactions for each DNA specimen were combined and cleaved with the restriction enzyme HindIll that predominantly rendered fragments of BKV-specific length. At least in cases 15 and 44 faint JCV-specific bands were also visible. (D) Southern blot hybridization of HindIll-cleaved PCR products with the radioactive BKV ssRNA probe that is specific for the 500-bp BKV HindIll fragment within amplified DNA. Autoradiography was for 1 day. A, B, HindIll fragments; BKV b. 500 and 250 bp in length; JCV b, about 600 and 150 bp in length. M, marker bands are phiXl74/Haelll DNA fragments from 1358-l 94 bp. Numbers represent DNA specimens from individual cases; 15,_, , 14,_, represent products from two regions of the same case.
of multiple patients without polyomavirus-associated CNS disease by the demonstration of free, full-length polyomavirus genomes. Compared to thousands of genome equivalents per cell in most specimens from partitular cases of PML (Dbrries et al., 1979; Walker and Padgett, 1983), the number of positives ranged between 1 and 4 in 10 specimens of non-PML tissue. The
amount of virus-specific DNA is estimated in a range of 1 to 1000 genome equivalents per 200 cells. In addition to JCV DNA, human polyomavirus BK DNA was detected in all but one case by PCR amplification and species-specific Southern blot mapping of CNS-derived virus DNA. Interestingly, the concentration of BKV DNA was considerably lower compared to
78
ELSNER AND DijRRlES
A
Bana JCVBKV
a
bcde
f
JCVBKV
BamEI/HindIII
BaaEI/PvuII
BaaII/XbaI a
b
c
d
e
JCV c
f
d
f
a
b
e
BKV
kb
5.1 3.0 2.7 2.0 1.3
0.4
0.9 I
2760 0.1 I
2010
0.23 I
0.5 I
660
BKV
1410
0.98
I
BamHI/XbaI
I
370
0.710.72 II
BamHI/PvuII
1100
1940
0.97
0.23
0.98 BamHI/XbaI
1290
3800 0.17 I 1930
980
I 0.0
I
0.540.62 0.72 I I I 420 510
I
I
I
I
0.5
I
I
0.98 I
BamHI/HindIII
1320
I
I
I
mu
1.0
FIG. 4. Characterization of polyomavirus-specific genomes cloned directly from autopsy specimens of two patients without CNS disease by restriction mapping and Southern blot analysis. (A) BarnHI: Determination of the genomic length of polyomavirus-specific recombinant DNA. Virus-specific inserts were released from vector DNA by the restriction endonuclease BarnHI. BamHIIXbal: restriction endonuclease mapping of cloned virus genomes. BarnHI-released inserts were characterized by additional type-specific cleavage with the enzymeXbal. Bands in position of full-length 5-kb genomes were due to incomplete cleavage. BamHIlPvull: determination of the genetic complexity of cloned JCV genomes from case 20 and 23. BamHIIHindlll: determination of the genetic complexity of cloned BKV genomes from cases 20 and 23. Lanes a-c, recombinant clones derived from cellular brain DNA of case 20; lanes d-f recombinant clones derived from case 23; JCV-, BKV-cloned genomic DNA (JCV Mad-l strain, BKV Dunford strain) released from vector pBR322 by the enzyme BarnHI, cleaved by BamHWbal and BamHIIPvulI or BamHIIHindlll. respectively; kb, length of complete virus genomes and JCV and BKV restriction fragments of a BamHWbal enzyme reaction. A-E BamHIIHindIII fragments of the BKV type. A-D BamHIIPvull fragments of the JCV type. (B) Restriction map of BKV (Dunford strain) (Seif et a/., 1979) and JCV (Mad-l strain) (Frisque ef a/., 1984). DNA Fragments are indicated by length in base pairs, map units (mu) were calculated according to the sequence length of BKV and JCV genomic DNA.
JCV DNA ranging from 1 to about 20 genome equivalents per 200 cells. As BKV seroconversion is approximately 99% by the age of 10 years (Arthur and Shah, 1989) the number of positive cases probably reflects the high rate of BKV infection in the population, whereas the amount of viral DNA indicates reduced viral activity in the CNS compared to that of JCV. Although BKV appears not to be related to any known neurological disease (Arthur and Shah, 1989)
integrated BKV DNA and subgenomic sequences were occasionally detected in human brain tumors (Dorries et a/., 1987; Negrini et a/., 1990). Analysis of the physical state and the genetic complexity of virus sequences in healthy tissue by cloning of polyomavirus sequences resulted exclusively in unique full-length BKV- and JCV-specific genomes. The genetic complexity was identical with that of infectious virus DNA as shown by complete virus-specific restriction maps
BKV AND JCV INFECTION
with enzymes that generate a complex fragment pattern. This result affirmed that virus DNA in healthy brain tissue is not integrated and it is conceivable to assume that the episomal state of polyomavirus DNA is indicative for a latent virus infection. Obviously, besides the kidney (Arthur and Shah, 1989; Coleman et a/., 1980) the CNS is a target for human polyomavirus persistence as evidenced by the detection of free, full-length virus genomes belonging to both polyomavirus species in most infected patients. This implicates that JCV probably infects the CNS long before the induction of clinically overt PML. Although the amount of virus-specific DNA was much lower than in PML tissue, analysis of multiple areas of the brain disclosed that JC virus DNA is similarly distributed as typically described in PML tissue (Walker and Padgett, 1983). This suggests that latent polyomavirus infection in the CNS is restricted to a few isolated cells. The number of cells might increase under severe immunosuppressive disease as indicated by an increased incidence of polyomavirus DNA in multiple CNS specimens of patients with malignancies. In combination with the finding of elevated virus-specific antibody titers in tumor patients (Hogan et al., 1983) it can be assumed that impairment of the immune system, as induced by malignant tumor growth, favors involvement of the CNS in polyomavirus infection. In summary, the presented data prove that human polyomavirus infection is associated with subclinical virus entry into the CNS. In case of severe immunosuppression it is very likely that inapparent JCV infection leads to increased incidence of viral reactivation (Kleihues et al., 1985). Consequently, highly active virus variants might develop (Ddrries and Elsner, 1991; Yogo et a/., 1991) that are believed to be a prerequisite for the progredient cytolytic infection of oligodendroglia cells leading to PML.
ACKNOWLEDGMENT This study was supported by the Deutsche schaft, Sonderforschungsbereich SFB 165.
Forschungsgemein-
REFERENCES ARTHUR, R. R., DAGOSTIN, S., and SHAH, K. V. (1989). Detection of BK virus and JC virus in urine and brain tissue by the polymerase chain reaction. 1. C/in. Microbial. 27, 1 174-l 179. ARTHUR, R. R., and SHAH, K. V. (1989). Occurrence and significance of papovaviruses BK and JC in the urine. frog. Med. Viral. 36, 42-6 1. CHESTERS, P. M., HERITAGE,J., and MCCANCE, D. J. (1983). Persistence of DNA sequences of BK virus and JC virus in normal human tissues and in diseased tissues. J. Infect. Dis. 147, 676-684. COLEMAN, D. V., WOLFENDALE, M. R., DANIEL, R. A., DHANJAL, N. K.. GARDNER,S. D.. GIBSON, P. E., and FIELD, A. M. (1980). A prospec-
IN NORMAL
BRAIN
79
tive study of human polyomavirus infection in pregnancy. 1, /nfecr. Dis. 142, 1-8. D~RRIES, K. (1984). Progressive multifocal leukoencephalopathy: Analysis of JC virus DNA from brain and kidney tissue. Virus Res. 1, 25-38. D~RRIES. K.. and ELSNER,C. (1991). Persistent polyomavirus infection in kidney tissue of patients with diseases other than progressive multifocal leukoencephalopathy. Virology (Life Sci. A&.) 10, 5 I61. D~RRIES, K., JOHNSON,R. T.. and TER MEULEN, V. (1979). Detection of Polyoma virus DNA in PML-brain tissue by (in situ) hybridization. J. Gen. Wrol. 42, 49-57. D~RRIES, K., LOEBER, G., and MEIXENSBERGER,J. (1987). Association of polyoma viruses JC, SV40 and BK with human brain tumors. Virology 160, 268-270. D~RRIES, K., and TER MEULEN, V. (1983). Detection of papovavirus JC in kidney tissue. /. Med. Viral. 11, 307-317. FLAEGSTAD,T., SUNDSFJORD,A., ARTHUR, R. R., PEDERSEN,M., TRAAVIK, T., and SUBRAMANI,S. (1991). Amplification and sequencing of the control regions of BK and JC virus from human urine by polymerase chain reaction. Virology 160, 553-560. FRISQUE, R. J., BREAM, G. L., and CANNELIA, M. T. (1984). Human polyomavirus JC genome. J. Viral. 51, 458-469. GRINNEL, B. W., PADGET, B. L., and WALKER, D. L. (1983). Distribution of nonintegrated DNA from JC papovavirus in organs of patients with progressive multifocal leukoencephalopathy. /. infect. Dis. 147, 669-675. HOGAN, T. H., PADGETT, B. L.. WALKER, D. L., BORDEN, E. C., and FRIAS, Z. (1983). Survey of human polyomavirus (JCV, BKV) infections in 139 patients with lung cancer, melanoma or lymphoma. In “Polyomaviruses and Human Neurological Diseases,” pp. 31 l324. A. R. Liss, New York. HOUFF, S. A., MAJOR, E. O., KATZ, D. A., KUFTA, C. V., SEVER, J. L., PITTALUGA,S., ROBERTS,J. R., GITT, J., SAINI, N., and Lux, W. (1988). Involvement of JC virus-infected mononuclear cells from the bone marrow and spleen in the pathogenesis of progressive multifocal leukoencephalopathy. N. Engl. J. Med. 318, 301-305. KITAMURA,T., Aso, Y., KUNIYOSHI,N., HARA, K., and YOGO, Y. (1990). High incidence of urinary JC virus in nonimmunosuppressed older patients. 1. Infecf. Dis. 161, 1 128-l 133. KLEIHUS, P., LANG, W., BURGER,P. C., BUDKA. H., VOGT, M.. MAURER, R., LUTHY, R., and SIEGENTHALER,W. (1985) Progressive diffuse leukoencephalopathy in patients with acquired immune deficiency syndrome (AIDS). Acta Neuropathol. (Berlin) 68, 333-339. LOEBER, G., and D~RRIES, K. (1988). DNA rearrangements in organspecific variants of polyomavirus JC strain GS. J. Viral. 62, 17301735. MCCANCE, D. J. (1983). Persistence of animal and human papovaviruses in renal and nervous tissues. In “Polyomaviruses and Human Neurological Diseases,” pp. 343-357. A. R. Liss. New York. MURRAY, N. E. (1983). ln “Lambda II” (R. W. Hendrix, J. W. Roberts, F. W. Stahl, and R. A. Weisberg, Eds.) Cold Spring Harbor Press, Cold Spring Harbor, New York. NEGRINI, M., RIMESSI, P., MANTOVANI, C., SABBIONI, S., CORALLINI, A., GEROSA, M. A., and BARBANTI-BRODANO,G. (1990). Characterization of BK virus variants rescued from human tumours and tumour cell lines. J. Gen. Viral. 71, 2731-2736. SAIKI, R. K., SCHARF, S., FALOONA, F., MULLIS, K. B., HORN, G. T., ERLICH, H. A., and ARNHEIM, N. (1986). Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science 230, 1350-l 354. SAMBROOK. J., FRITSCH, E. F., and MANIATIS, T. (1989). “Molecular cloning: A Laboratory Manual.” Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York.
60
ELSNER AND DiiRRlES
SCHMIDBAUER, M., BUDKA,H., and SHAH, K. V. (1990). Progressive multifocal leukoencephalopathy (PML) in AIDS and in the pre-AIDS era. Acfa Neuropathol. 80, 375-380. SEIF, I., KHOURY,G., and DHAR, R. (1979). The genome of human polyomavirus BK. Cell 18, 963-977. TAVIS.J. E., WALKER,D. L., GARDNER,S. D., and FRISQUE, R. J. (1989). Nucleotide sequence of the human polyomavirus AS Virus, an antigenic variant of BK virus. 1. Viral. 63, 901-91 1. SUNDSFJORD, A., JOHANSEN, T., FLAEGSTAD, T., MOENS,U., VILLAND,P., SUBRAMANI, S., and TRAAVIK,T. (1990). At least two types of control
regions can be found among naturally occurring BK virus strains. J. Virol. 64, 3864-3871. WALKER,D. L., and PADGET, B. L. (1983). Progressive multifocal leukoencephalopathy. Comp. Viral. 18, 161-l 93. YANG,R. C. A., and Wu, R. (1979). BK virus DNA: Complete nucleotide sequence of a human tumor virus. Science 206,456-462. YOGO,Y., KITAMUR~,T., SUGIMOTO, C., HARA,K., IIDA,T., TAGUCHI,F.. TAJIMA,A., KAWABE,K., and Aso, Y. (1991). Sequence rearrangement in JC virus DNA’s molecularly cloned from immunosuppressed renal transplant patients. J. Viral. 65, 2422-2428.
