Vaccine 33 (2015) 2254–2260

Contents lists available at ScienceDirect

Vaccine journal homepage: www.elsevier.com/locate/vaccine

Evaluation of the protective efficacy of four novel identified membrane associated proteins of Streptococcus suis serotype 2 Yang Zhou a,1 , Yan Wang b,1 , Limei Deng b , Chengkun Zheng b , Fangyan Yuan d , Huanchun Chen b , Weicheng Bei b,∗ , Jinquan Li c,∗ a

State Key Laboratory of Agricultural Microbiology, College of Fisheries, Huazhong Agricultural University, Wuhan 430070, PR China State Key Laboratory of Agricultural Microbiology, College of Veterinary Medicine, Huazhong Agricultural University, Wuhan 430070, PR China c State Key Laboratory of Agricultural Microbiology, College of Food Science and Technology, Huazhong Agricultural University, Wuhan 430070, PR China d Hubei Key Laboratory of Animal Embryo and Molecular Breeding, Institute of Animal Husbandry and Veterinary Sciences, Hubei Academy of Agricultural Sciences, Wuhan 430070, China b

a r t i c l e

i n f o

Article history: Received 20 July 2014 Received in revised form 20 February 2015 Accepted 12 March 2015 Available online 25 March 2015 Keywords: Streptococcus suis serotype 2 Membrane associated proteins Protective antigen

a b s t r a c t Streptococcus suis serotype 2 (S. suis 2) is an important zoonotic pathogen that can also cause epidemics of life-threatening infections in humans. Surface proteins of pathogens play a critical role in the interaction with host system or environment, as they take part in processes like virulence, cytotoxicity, adhesion, signaling or transport, etc. Thus, surface proteins identified by the screening of immunoproteomic techniques are promising vaccine candidates or diagnostic markers. In this study, four membrane associated proteins (MAP) identified by immunoproteomic method were cloned and expressed as recombinant proteins with his-tag. Screening for vaccine candidates were firstly performed by protection assay in vivo and immunization with Sbp markedly protected mice against systemic S. suis 2 infection. The immune responses and protective of Sbp were further evaluated. The results showed that Sbp could elicit a strong humoral antibody response and protect mice from lethal challenge with S. suis 2. The antiserum against Sbp could efficiently impede survival of bacterial in whole blood killing assay and conferred significant protection against S. suis 2 infection in passive immunization assays. The findings indicate that Sbp may serve as an important factor in the pathogenesis of S. suis 2 and would be a promising subunit vaccine candidate. © 2015 Elsevier Ltd. All rights reserved.

1. Introduction Streptococcus suis is an important pathogen, associated with a variety of life-threatening infections that include meningitis, endocarditis, arthritis, septicemia and even sudden death in pigs [1]. The worldwide pig industry has been suffering great economic losses from it [2]. Among the 33 known serotypes, Streptococcus suis serotype 2 (S. suis 2) is considered the most prevalent capsular type as well as the most virulent isolated from diseased pigs. Although only sporadic cases of S. suis infection have been reported in humans, two outbreaks (14 deaths in Jiangsu in 1998 and 38 deaths in Sichuan in 2005) in China and other countries have raised considerable concerns among public health and food safety professionals in recent years [3]. However, the lack of effective vaccine

∗ Corresponding author. Tel.: +86 27 87288629; fax: +86 27 872817952608. E-mail addresses: [email protected] (W. Bei), [email protected] (J. Li). 1 These authors contributed equally to this work. http://dx.doi.org/10.1016/j.vaccine.2015.03.038 0264-410X/© 2015 Elsevier Ltd. All rights reserved.

and limited knowledge on the pathogenic mechanisms of S. suis impede the attempts to control this organism. Surface proteins of pathogens have received increasing attention since these proteins have the highest chances to be recognized by the immune system, which may raise effective immune responses and become effective vaccine formulations against infection [4,5]. Previous studies have attempted to test several surface/extracellular proteins of S. suis as potential vaccine targets, such as extracellular protein factor, muramidase-released protein (MRP) [6] and suilysin [7]. However, clinical isolates from some geographical regions lacking these antigens may result in incomplete coverage when these proteins are served as a single ingredient [8–10]. Therefore, identification of new potential candidates is necessary to the development of monovalent or a multivalent subunit vaccine for S. suis. For subunit vaccine development, the conventional approach depending on the process of evaluating potential candidates of pathogen one at a time. It has been revolutionized by proteomescale, parallel strategies for discovering new candidates. For example, the proteomic platforms make the vaccine development

Y. Zhou et al. / Vaccine 33 (2015) 2254–2260

of Group A streptococcus and Streptococcus pneumoniae more efficiently [11,12]. In S. suis 2, extracellular antigens were systematically identified by a combination of proteomic approach and Western-blot, using convalescent or hyperimmune sera [13–15]. More than twenty vaccine candidates have been discovered and the protective effect against the infection of S. suis 2 is worthy to be determined. In this study, the protective effects of four membrane associated proteins, including L-lactate dehydrogenase (Ldh), Dihydrolipoamide dehydrogenase (Dldh), Pyruvate dehydrogenase E1 component, ɑ subunit of (Pec) and amino acid ABC substrate binding protein (Sbp) identified by the immuno-proteomic approach were evaluated. Finally, Sbp and anti-Sbp serum in active and passive immunization assays were shown to protect mice against S. suis 2 infection and impede the survival of S. suis 2 in blood, indicating Sbp is a promising protective antigen against S. suis 2 infection. 2. Materials and methods 2.1. Bacterial strain and growth conditions Strain SC19 (S. suis 2), which was isolated from the brain tissue of a diseased piglet in Sichuan Province in 2005, was used in the study. S. suis was cultured in tryptic soy broth or on tryptic soy agar (Difco, USA), in which, 5% newborn bovine sera was added (Sijiqing, China) at 37 ◦ C in aerobic conditions. E. coli DH5a (TaKaRa, China) was used for cloning and E. coli BL21 (DE3) (Novagen, China) was used for expressing of the recombinant plasmid that embody the protein. Luria-bertani broth or agar (Oxoid, UK) added with kanamycin (50 ␮g/mL) was used to culture E. coli DH5a or E. coli BL21 strains at 37 ◦ C in aerobic conditions. 2.2. Cloning, expressing and purification of the recombinant proteins Genomic DNA was isolated from strain SC19. The DNA region encoding the memberane associated proteins without the putative secreted signal or transmembrane domain were amplified using the primers as listed in Table 1, with PrimeSTAR HS DNA polymerase (TaKaRa). The PCR products, digested with EcoRI/SalI (TaKaRa), were cloned into pET30a (Novagen) and transformed into E. coli BL21 strain for expression. The recombinant proteins were induced at 37 ◦ C in LB grown to log phase by the addition of 0.1 mM isopropyl-beta-D-thiogalactopyranoside (Sigma, USA) and incubation for 3 h. According to the QIAexpress manual (Qiagen), the whole lysates were centrifuged after sonication on ice and the recombinant protein from the supernatants was purified by Ni-NTA affinity chromatography. Endotoxin was removed by ToxinEraserTM Endotoxin Removal Kit (Genscript, USA). The quantity and quality of the recombinant proteins were determined by the Bradford method and SDS-PAGE analysis, respectively. Finally, the purified proteins were concentrated by membrane ultrafiltration (Millipore) and stored in PBS at –80 ◦ C.

2.3. SDS-PAGE and Western blotting In SDS-PAGE analysis, polyacrylamide vertical slab gel (12%) with stacking gel (5%) was used to separate recombinant proteins. For Western-blot, the gel was electrotransfered to a PVDF membrane (Invitrogen). The PVDF membrane was blocked at 4 ◦ C with 0.5% skimmed milk in TBST (20 mM Tris–HCl, 150 mM NaCl and 0.05% Tween-20) overnight. Convalescent sera against S. suis 2 and goat anti-IgG (H + L)-HRP (1:5000) (Southern Biotech, USA) were used as the first and the second antibody to determine the specific band. After washing, the PVDF membrane was developed using substrate solution 3, 3 -diaminobenzidine (Sigma). 2.4. Mice immunization and challenge All the animal experimental protocols performed in the study were approved by the Laboratory Animal Monitoring Committee of Huazhong Agricultural University and performed accordingly. The animals were euthanized when moribund during the experiment or at the end of the experiments. 4 week old Female BALB/c mice were used in this study as described previously [16]. For immunization assay, 50 ␮g purified recombinant protein in 100 ␮L PBS emulsified with 150 ␮L aluminum hydroxide Al(OH)3 adjuvant was used to immune mice by intraperitoneal injection. Mice immunized with PBS emulsified in Al(OH)3 were considered as negative control and mice injected with PBS were considered as blank control. The primary immune and subquent booster immune have a 14 days interval. 10 days after the booster immune, blood samples were collected from tail vain and then all the mice in each group were intraperitoneally infected with 5 × 109 CFU (2 × 109 CFU for primary screening) S. suis SC19 strain in 200 ␮L PBS. All the mice were monitored for two weeks after infection. Meanwhile morbidity and mortality were recorded. Passive immune assays were carried out as described with some modifications [17]. Groups of ten female 6 week old BABL/c mice were immunized with 100 ␮L of hyperimmune serum specific for amino acid ABC substrate binding protein (Sbp) by intraperitoneal injection, while the serum from PBS (PBS emulsified in Al(OH)3 ) immune mice served as negative control and PBS serve as blank control. At 24 h after immunization, all the mice were infected with 5 × 109 CFU of S. suis SC19 strain by intraperitoneal injection. 2.5. Antibody determination and FACS analysis The IgG titers of serum from immunized mice were determined by enzyme-linked immunosorbent assay (ELISA) as described previously [17]. IgG isotype (IgG1 and IgG2a) was also determined by ELISA method. Briefly, 96 well microtiter plates were coated with purified proteins (250 ng/100 ␮L) diluted in sodium carbonate buffer (PH 9.6) at 4 ◦ C overnight. The plates were incubated with 0.5% skim milk at 37 ◦ C for 1 h and washed with PBST (PBS containing 0.05% Tween-20). Serially diluted serum were added and incubated for 30 min at 37 ◦ C. After washing three times with PBST, goat anti-mouse IgG-HRP (Southern biotech, USA), rabbit anti

Table 1 Amplification primers of gene sequence. Gene

Primer sequence used for clone (5 to 3 )

L-lactate dehydrogenase (Ldh)

Forward: CGCCGAATTCATGACTGCAACTAAACAACACAAA Reverse: CCCCGTCGACTTAGTTTTTTACACCAGCTGCAA Forward: CGCCGAATTCATGGCAATTGAAATTATTATGCC Reverse: CCCCGTCGACTTATTTGCGTTTTGGTGGGT Forward: CGCCGAATTCATGGTATCTATCACAAAAGAACAACA Reverse: CCCCGTCGACCTAGTCTACAAACACATCCTCATAAGC Forward: CGCCGAATTCGGTACATCGAATAGTACAGACCAAA Reverse: CCCCGTCGACTTACTTAGCTTTTGATACGTCTTCAC

Dihydrolipoamide dehydrogenase (Dldh) Pyruvate dehydrogenase E1 component, ɑ subunit of (Pec) Amino acid ABC substrate binding protein (Sbp)

2255

2256

Y. Zhou et al. / Vaccine 33 (2015) 2254–2260

mouse IgG1-HRP or IgG2a-HRP (Sigma) diluted 1:5000 in PBST was incubated for 30 min at 37 ◦ C. The plates were washed three times with PBST and the colour was developed with 100 ␮L of the substrate solution (sodium citrate buffer, containing 1 mg/mL 3,3,5,5-tetramethylbenzidine and 0.03% H2 O2 ) and reacting in dark for 10 min. The reaction in each well was stopped by 50 ␮L of 0.25% hydrofluoric acid. The 96 well microtiter plates were test by plate reader (Bio-Tek Instruments, USA) at absorbance of 630 nm. Fuorescence-activated cell sorting (FACS) analysis was applied to investigate the subcellular location of Sbp and whether anti-Sbp antibody is accessible to the bacteria. Sample was analyzed on a FACScan (Becton Dickinson, CA, USA) with mouse Anti-Sbp serum as the primary antibody and FITC-conjugated goat anti-mouse IgG (Invitrogen) as the second antibody. Negative serum served as the control.

2.6. Lymphocyte proliferation and detection of cytokines Lymphocyte proliferation experiment was carried out as described with some modifications [18]. The experiments were performed with cell proliferation kit (Promega, USA) according to the instructions. Three mice from each group were sacrificed on the 14th day after boost immunization. The spleen cells were suspended in RPMI medium (Gbico, USA). 200 ␮L of cells (2 × 104 cells) were cultured in 96-well culture plate. The cells were stimulated by the proteins or concanavalin A (5 ␮g/well) (Wako, Japan) at 37 ◦ C in a 5% CO2 incubator for 48 h. At last, the lymphocytes were cultured in 96-well plate with MTS reagent for 4 h and the absorbance was test at 490 nm. For detection of cytokines, the supernatants from stimulated spleen cell cultures were harvested 48 h after stimulation. The levels of IL-6 and IFN-␥ in the culture supernatants were confirmed by an ELISA kit (NeoBioscience, China) according to the manufacturer’s instructions.

2.7. Bactericidal assays To evaluate the bactericidal activity of mouse anti-Sbp serum, the whole blood killing assay was accomplished as described previously with some modifications [19]. SC19 strain was cultured, washed three times and diluted with sterilized PBS. 103 bacteria cell in 10 ␮L dilution was mixed with 190 ␮L diluted serum sample to be tested which included 95 ␮L serum sample and 95 ␮L sterilized PBS. The mixture was firstly incubated at 37 ◦ C for 15 min and then kept on ice for 15 min. 300 ␮L of heparinized and non-immune whole blood was added into the mixture and the mixture was cultured at 37 ◦ C incubator with shaking for 1 h. At last, the samples were plated on TSA that contained 5% newborn calf serum with serial dilution and colonies were counted. The data are presented as means ± SD of actual CFU/mL. The results shown are representative of three independent experiments. To investigate whether antiSbp antibody enhanced the opsonophagocytosis, we conducted murine neutrophils killing assay. Neutrophils were isolated by Ficoll-Hypaque (Haoyang Biological Manufacture Co. Ltd., Tianjin, China). Log-phase bacteria were pre-opsonized using anti-Sbp serum or negative control serum for 15 min at 37 ◦ C. Neutrophils at a concentration of 1 × 106 cells/mL were mixed with equal volume (100 ␮L) of 5 × 104 CFU/mL opsonized bacteria. After incubation with neutrophils for 1 h at 37 ◦ C, cells were lysed with sterile water and serially diluted and plated on TSA plates. Tubes with bacteria alone were treated similarly and used as controls. Colonies were counted, and the percentage of bacteria survived in opsonophagocytic killing assay was calculated as (CFU with neutrophils/CFU without neutrophils) × 100%.

2.8. Bioinformatic and statistical analysis Subcellular locations of the proteins were predicted using the software SignalP 3.0 Server (http://www.cbs.dtu.dk/services/ SignalP/) and PSORTb v3.0.2 (http://www.psort.org/psortb/). Unless otherwise specified, Data are presented as the mean ± SD and comparisons between data sets were performed using the student t-test. For in vivo protection experiments, survival curves were analyzed with the Log Rank test. Statistical significance was defined at P < 0.05 in all the tests. 3. Results 3.1. Expression of the four potential antigens as His-tag fusion proteins The DNA fragment encoding the protein of L-lactate dehydrogenase (Ldh), Dihydrolipoamide dehydrogenase (Dldh), Pyruvate dehydrogenase E1 component, ɑ subunit (Pec) and amino acid ABC substrate binding protein (Sbp) without secreted signal were successfully cloned into pET30a, confirmed by sequencing and the digestion of EcoRI/SalI (Fig. 1A). Plasmid containing the exogenous gene was transformed into E. coli BL21 strain respectively and the potential antigen was expressed as His-tag fusion proteins. The lysates from each strains were analyzed by SDS–PAGE and the molecular weight of specific band indicate the four potential antigens were successfully expressed (Fig. 1B). 3.2. Effect of protection of four antigens in mice Table 2 showed the protective efficacy of four antigens against lethal challenge by SC19. The results showed that Ldh, Dldh, Pec and Sbp provided 2/6 (33.3%), 4/6 (66.7%), 3/6 (50%), and 5/6 (83.3%) protection, respectively, compared with the adjuvant group and the PBS (blank control) after challenging with SC19 at a dose of 2 × 109 CFU (P < 0.05). Thus, the subsequent study was to further evaluate the immure responses and protective efficacy of Sbp. 3.3. Immune response to amino acid ABC substrate binding protein (Sbp) The results showed in Fig. 2A demonstrated that IgG antibody against Sbp from Sbp immunized group were significantly increased when compared with the PBS or adjuvant groups (P < 0.05). Anti-Sbp antibodies could bind to the bacterial surface, which indicates that Sbp is displayed on the surface and accessible to the antibodies (Fig. 2B,C). To further reveal the type of immune response, the levels of IgG2a and IgG1 subclasses were determined. The results demonstrated that both of the IgG1 and IgG2a levels were significantly higher in the Sbp immunized groups compared to the negative or blank control groups. In addition, IgG1 responses predominated over IgG2a responses (P < 0.01) (Fig. 2D). The results indicate that Sbp could induce significant Th1-/Th2immune responses. As shown in Fig. 3A, the strong proliferative T-cell immune response was observed in the Sbp immunized group (P < 0.05). A significant T cell proliferative response was also observed in concanavalin A (Con A), which considered as a positive control, while the blank or negative control groups did not elicit an obvious proliferative T-cell response. The amounts of IL-6 and IFN-␥ from supernatants of splenocytes stimulated by Sbp were significantly higher in Sbp immunized group while compared with the negative and blank control groups (Fig. 3B and C). The results indicated that immunization of mice with Sbp triggered a Th2-type immune response.

Y. Zhou et al. / Vaccine 33 (2015) 2254–2260

2257

Fig. 1. (A) Confirmation of recombinant plasmids (pET30a-pec, pET30a-dldh, pET30a-ldh, and pET30a-sbp) by enzyme digestion. (B) SDS-PAGE analysis of recombinant proteins. Lanes 1–5 indicate samples from the non-induced E. coli cells, the induced Pec, Dldh, Ldh, and Sbp producer E. coli cells, respectively. The protein markers are indicated on the left in kDa. Table 2 Protective efficacy of four antigens in a mouse model. No.

Group

No. of surviving animals/total no. of animals

1 2 3 4 5 6

Ldh Dldh Pec Sbp Adjuvant control Blank control

2/6 (33.3%) 4/6 (66.7%) 3/6 (50%) 5/6 (83.3%) 0/6 (0%) 0/6 (0%)

3.5. Bactericidal assays To determine whether anti-Sbp antibodies are opsonic, whole blood killing assay was performed. Survival rate of S. suis 2 pretreated with Sbp-immune serum in whole blood was clearly reduced comparing to that with the control serum (PBS-immune serum) (Fig. 5A). This was further supported in the neutrophils killing assay. In the presence of anti-Sbp serum, the survival ratio of bacteria after neutrophils killing decreased significantly relative to that in the absence of specific humoral response, which indicates antibodies against Sbp could efficiently induce opsonphagocytic killing (Fig. 5B).

3.4. Protective efficacy of Sbp in vivo The results showed that immunization of Sbp conferred 70% protection, compared with the negative (adjuvant) and the blank (PBS) control group after challenging with SC19 at a high dose of 5 × 109 CFU (P < 0.05). All the mice in the negative and blank control groups were morbid within 48 h and all mice in the negative and blank control groups died in 2 days after the challenge of SC19, while the Sbp immunized groups received good protective effects within the observation days (P < 0.05) (Fig. 4A). To further confirm that protection was related to stimulation of Sbp specific immune responses, groups of 10 mice were injected with anti-Sbp hyperimmune sera 24 h before the lethal challenge. Although mild clinical signs were observed among some mice in antiserum immune group, the antiserum immune group exhibited higher survival rate (Fig. 4B). These results indicated that protection was at least partially mediated by the antibodies against Sbp.

4. Discussion In recent studies, immunogenic proteins from the supernatant, membrane or cell wall of S. suis 2 have been identified by immunoproteomic analyses [13–15]. Proteins identified by immunoproteomic approach were immunoreactive to the convalescent or hyperimmune sera, which suggested that these proteins were expressed in vivo and had the potential to be a candidate of subunit vaccine. To further evaluate the possibility of these potential antigens for vaccine development, four candidate proteins identified by the immunoproteomic approach were studied. Sequence alignment revealed that the first candidate, extracellular l-lactate dehydrogenase (Ldh) is highly conserved among Streptococcus spp. The extracellular Ldh of Streptococcus suis shares 85% and 87% sequence homology with Streptococcus agalactiae and Streptococcus pyogene respectively. Although most of previous

Fig. 2. (A) Antibody titers against the Sbp in vivo. Sera samples were collected from immunized, blank or negative control groups and the antibody titer was determined by ELISA. (B) Western-blot of Sbp. (C) Extracellular detection of Sbp by FACS analysis. Black line, bacteria treated with negative serum; grey line, bacteria treated with anti-Sbp serum. (D) Levels of IgG1 and IgG2a in mouse aroused by the Sbp. Sera samples were same with (A), and both of IgG1 and IgG2a levels were determined with ELISA method. The results are presented as the mean absorbance ± SD.

2258

Y. Zhou et al. / Vaccine 33 (2015) 2254–2260

Fig. 3. (A) Lymphocyte proliferation test. 14 days after the booster immunization, the splenocytes collected from immunized group, blank and negative control group were cultured with 5 ␮g of Sbp and concanavalin A in a CO2 incubator at 37 ◦ C for 72 h; (B) and (C) IFN-␥ and IL-6 production in cultured splenic lymphocytes of mice immunized with Sbp or the negative control (adjuvant), respectively. Results represented as means ± SD. The asterisk indicates significance at P < 0.05 versus control.

Fig. 4. (A) Survival curve of mice immunized with Sbp, blank (PBS) or negative (adjuvant) control following infection with S. suis 2 (SC19). (B) Antiserum against the Sbp provided good passive protection against SC19 infection in vivo, while sera from non-immune mice did not confer significant protection. Significant differences of survival between different groups were analyzed by Log Rank test.

researches focused on the function of this enzyme, it was characterized as critical immunogenic protein in natural or experimental infection of Mycoplasma hyopneumoniae [20–22]. The second candidate is similar to the dihydrolipoamide dehydrogenase (Dldh), which catalyzes the NAD+ -dependent reoxidation of dihydrolipoamide in many multienzyme complexes. BLAST searches revealed that Dldh of Streptococcus suis shared 82% and 84% sequence similarity with the homologs in Streptococcus mutans and Streptococcus pyogenes respectively [23]. BLAST searches revealed that the third candidate, pyruvate dehydrogenase E1 component (Pdc) shares 74% and 84% sequence homology with the corresponding protein in Streptococcus pyogenes and Streptococcus mutans. Pyruvate dehydrogenase multienzyme complex belongs to the 2-oxo acid dehydrogenase multienzyme complexes family, involving in several central points of oxidative metabolism. The E1

subunit of pyruvate dehydrogenase multienzyme is considered as the critical component in the catalytic system, which play a role in the reversible transfer of an acetyl group from a pyruvate to the lipoyl group of E2 subunit lipoly domain [24]. The last candidate, amino acid ABC substrate binding protein (Sbp) has homolog in Bacillus smithii, which shows 55% similarity. Sbp are not only associated with ABC transporters, which is essential uptake system for amino acids, but are also important in ion linked transporters, ion channels, G protein-coupled receptors, and two-component regulatory systems [25]. The protection of four potential candidates against S. suis 2 infection was primary evaluated and amino acid ABC substrate binding protein was chose for further study. Amino acid ABC substrate binding protein (Sbp) was determined to protect mice against a lethal infection of S. suis 2 in vivo and induce high level of

Y. Zhou et al. / Vaccine 33 (2015) 2254–2260

2259

Fig. 5. Bactericidal assays. (A) Whole blood killing assay in the presence of anti-Sbp serum or negative serum. The data was presented as means ± SD of actual CFU/mL after killing assay. (B) Bacterial killing by murine neutrophils under opsonizing condition. The percentage of bacteria survived in opsonophagocytic killing assay was calculated as (CFU with neutrophils/CFU without neutrophils) × 100%.

IgG titer. Protection was also conferred by passive immune assay, and the results suggested that protective effect was mediated by specific immune responses to Sbp rather than non-specific immune responses. Levels of IFN-␥ and IL-6 in the supernatants of spleen cells stimulated by Sbp was significantly higher in the Sbp vaccinated group while compared with control groups, indicate that the Sbp can trigger the Th2-type immune responses. Since the Th1-type immune responses associated with the production of IgG2a subclass are particularly important in mediating bacterial opsonophagocytosis, the IgG2a subclass induced by Sbp confirmed the observation that the survival capacity of S. suis 2 in whole blood was rapidly decreased when pretreated with the anti-Sbp serum. S. suis 2 can rapidly disseminate from the blood post-inoculation, resulting in invasive infection and ultimately death. The findings above indicate that Sbp may play an important role in the survival capacity or invasive ability of S. suis 2 in the blood. Blockage of Sbp may impede the adaption or iteration of pathogen with the host, as the ATP-binding cassette (ABC) transporter has been reported as a critical uptake system for amino acids in some gram-positive pathogens [25]. The necessity of Sbp in pathogenesis was also revealed by the protein sequence alignment, since Sbp shows 100% identity among clinical isolates of the serotype 2 from different countries, such as China (05ZY33, 98HAH33), Netherlands (T15), United Kingdom (P1/7) and Vietnam (BM407). In conclusion, protective efficacy of four novel membrane associated proteins identified by selective proteomics approach was evaluated in this study. The results showed that immunization with Sbp could confer significant protection against infection of hypervirulent strain SC19 (S. suis 2), as compared with other candidates, and it may play important roles in pathogenesis. The role of amino acid ABC substrate binding protein and its homologous proteins in pathogens are remained to be study. In current study, partial protection in mice was observed using Al(OH)3 as an adjuvant with high challenge dose. In future studies, other immunization strategies or adjuvants could be helpful to enhance the protective effect of Sbp. Besides, Sbp could also be combined with other effective candidates to generate stronger and better protective immunity. The conservation of Sbp protein sequence in multi-serotype confirmed its potential as a component of a universal vaccine candidate against infection of S. suis, at least for the prevalent serotype 2 in different countries.

Conflict of interest statement There are no conflicts of interest of any authors listed on this manuscript.

Acknowledgements This research is supported by grants from the National Basic Research Program (No. 2011CB518805), the Fundamental Research Funds for the Central Universities (No. 52902-0900206143, 2013PY014), Hubei Funds for Distinguished Young Scientists (No. 2013CFA033), and Hubei Academy of Agricultural Sciences Youth Fund Key Projects (2011NKYJJ14).

References [1] Gottschalk M, Xu J, Calzas C, Segura M. Streptococcus suis: a new emerging or an old neglected zoonotic pathogen? Future Microbiol 2010;5(3):371–91. [2] Lun ZR, Wang QP, Chen XG, Li AX, Zhu XQ. Streptococcus suis: an emerging zoonotic pathogen. Lancet Infect Dis 2007;7(3):201–9. [3] Yu H, Jing H, Chen Z, Zheng H, Zhu X, Wang H, et al. Human Streptococcus suis outbreak, Sichuan, China. Emerg Infect Dis 2006;12(6):914–20. [4] Olaya-Abril A, Jiménez-Munguía I, Gómez-Gascón L, Rodríguez-Ortega MJ. Surfomics: shaving live organisms for a fast proteomic identification of surface proteins. J Proteomics 2014;97:164–76. [5] Zhang A, Chen B, Mu X, Li R, Zheng P, Zhao Y, et al. Identification and characterization of a novel protective antigen, enolase of Streptococcus suis serotype 2. Vaccine 2009;27(9):1348–53. [6] Wisselink HJ, Vecht U, Stockhofe-Zurwieden N, Smith HE. Protection of pigs against challenge with virulent Streptococcus suis serotype Z strains by a muramidase-released protein and extracellular factor vaccine. Vet Rec 2001;148(15):473–7. [7] Jacobs AA, van den Berg AJ, Loeffen PL. Protection of experimentally infected pigs by suilysin, the thiol-activated haemolysin of Streptococcus suis. Vet Rec 1996;139(10):225–8. [8] Gottschalk M, Lebrun A, Wisselink H, Dubreuil JD. Production of virulencerelated proteins by Canadian strains of Streptococcus suis capsular type 2. Can J Vet Res 1998;62(1):75–9. [9] Okwumabua O, Abdelmagid O, Chengappa MM. Hybridization analysis of the gene encoding a hemolysin (suilysin) of Streptococcus suis type 2: evidence for the absence of the gene in some isolates. FEMS Microbiol Lett 1999;181(1):113–21. [10] Galina L, Vecht U, Wisselink HJ, Pijoan C. Prevalence of various phenotypes of Streptococcus suis isolated from swine in the U.S.A. based on the presence of muraminidase-released protein and extracellular factor. Can J Vet Res 1996;60(1):72–4. [11] Sharma A, Arya DK, Sagar V, Bergmann R, Chhatwal GS, Johri AK. Identification of potential universal vaccine candidates against group A Streptococcus by using high throughput in silico and proteomics approach. J Proteome Res 2013;12(1):336–46. [12] Choi CW, Lee YG, Kwon SO, Kim HY, Lee JC, Chung YH, et al. Analysis of Streptococcus pneumoniae secreted antigens by immuno-proteomic approach. Diagn Microbiol Infect Dis 2012;72(4):318–27. [13] Zhang A, Xie C, Chen H, Jin M. Identification of immunogenic cell wall-associated proteins of Streptococcus suis serotype 2. Proteomics 2008;8(17):3506–15. [14] Zhang W, Lu CP. Immunoproteomics of extracellular proteins of Chinese virulent strains of Streptococcus suis type 2. Proteomics 2007;7(24): 4468–76. [15] Zhang W, Lu CP. Immunoproteomic assay of membrane-associated proteins of Streptococcus suis type 2 China vaccine strain HA9801. Zoonoses Public Health 2007;54(6-7):253–9.

2260

Y. Zhou et al. / Vaccine 33 (2015) 2254–2260

[16] Li J, Tan C, Zhou Y, Fu S, Hu L, Hu J, et al. The two-component regulatory system CiaRH contributes to the virulence of Streptococcus suis 2. Vet Microbiol 2011;148(1):99–104. [17] Zhou Y, Li L, Chen Z, Yuan H, Chen H, Zhou R. Adhesion protein ApfA of Actinobacillus pleuropneumoniae is required for pathogenesis and is a potential target for vaccine development. Clin Vaccine Immunol 2013;20(2): 287–94. [18] Khan MN, Bansal A, Shukla D, Paliwal P, Sarada SK, Mustoori SR, et al. Immunogenicity and protective efficacy of DnaJ (hsp40) of Streptococcus pneumoniae against lethal infection in mice. Vaccine 2006;24(37-39): 6225–31. [19] Li J, Xia J, Tan C, Zhou Y, Wang Y, Zheng C, et al. Evaluation of the immunogenicity and the protective efficacy of a novel identified immunogenic protein, SsPepO, of Streptococcus suis serotype 2. Vaccine 2011;29(38):6514–9. [20] Chen A, Hillman JD, Duncan M. l-(+)-Lactate dehydrogenase deficiency is lethal in Streptococcus mutans. J Bacteriol 1994;176(5):1542–5.

[21] Wyckoff HA, Chow J, Whitehead TR, Cotta MA. Cloning, sequence, and expression of the l-(+) lactate dehydrogenase of Streptococcus bovis. Curr Microbiol 1997;34(6):367–73. [22] Frey J, Haldimann A, Kobisch M, Nicolet J. Immune response against the llactate dehydrogenase of Mycoplasma hyopneumoniae in enzootic pneumonia of swine. Microb Pathog 1994;17(5):313–22. ˜ [23] Expósito Raya N, Mestre Luaces M, Silva Rodriguez R, Nazábal Gálvez C, Pena Rivero M, Martínez de la Puente N, et al. Preformulation study of the vaccine candidate P64k against Neisseria meningitidis. Biotechnol Appl Biochem 1999;29(Pt 2):113–7. [24] Sheng X, Liu Y. Theoretical study of the catalytic mechanism of E1 subunit of pyruvate dehydrogenase multienzyme complex from Bacillus stearothermophilus. Biochemistry 2013;52(45):8079–93. [25] Fulyani F, Schuurman-Wolters GK, Zagar AV, Guskov A, Slotboom DJ, Poolman B. Functional diversity of tandem substrate-binding domains in ABC transporters from pathogenic bacteria. Structure 2013;21(10):1879–88.