Mutation Research, 283 (1992) 119-123 © 1992 Elsevier Science Publishers B.V. All rights reserved 0165-7992/92/$05.00
119
MUTLET 0711
Evaluation of the ligase chain reaction (LCR) for the detection of point mutations I. K~ilin a, S. Shephard a and U. Candrian b Institute of Toxicology, Swiss Federal Institute of Technology, Schwerzenbach/Ziirich, Switzerland and b Laboratory of Food Chemistry, Institute of Biochemistry, Universityof Bern, Bern, Switzerland a
(Received 10 April 1992) (Accepted 15 June 1992)
Keywords: Point mutation; Ras; Ligase chain reaction; Polymerase chain reaction; Mutagenicity testing
Summary The ligase chain reaction (LCR) was evaluated as an amplification method for an in vivo mutation assay. Specifically, the ligase was tested for its ability to selectively amplify a DNA sequence mutated at a single base, in the presence of an excess of wild-type DNA. As a model template a 370-bp DNA fragment of the mouse Ha-ras protooncogene containing an A to T mutation at the second position of codon 61 was used. With the commercially available ligase Ampligase (Epicenter), 250 molecules of mutant fragments could be detected by an enzyme-linked immunoassay with digoxigenin marker (giving a theoretical detection limit of 1 target gene per 104 copies of genome). In the analysis of mixtures with corresponding wild-type D N A fragments, a 1 : 1 mixture resulted in a clearly stronger signal than control samples lacking wild-type and mutant DNA. However, the signal obtained from a 100-fold dilution of the mutant D N A with wild-type D N A could not be distinguished from the background noise. In this particular form, LCR lacks sufficient selectivity to be applied to an in vivo situation, where the ratio of mutant to wild-type D N A sequences might be expected to lie around 1 : 106.
Tumor induction by genotoxic carcinogens is the result of an accumulation of mutations in a number of critical genes. Various types of mutations appear to be involved (Vogelstein et al.,
Correspondence: Dr. U. Candrian, Laboratory of Food Chemistry, Institute of Biochemistry, University of Bern, Freiestrasse 3, CH-3012 Bern, Switzerland.
Abbreviations." LCR, ligase chain reaction; PCR, polymerase chain reaction; PAGE, polyacrylamide gel electrophoresis; ARMS, amplification refractory mutation system.
1990). Base-pair substitutions, for instance, can result in an activation of oncogenes. As an exampie, an A T to T A transversion at the second position of codon 61 in the Ha-ras oncogene has been found in 6 of 7 hepatomas induced in mice by vinyl carbamate, the proximate carcinogen of ethyl carbamate (urethane; Wiseman et al., 1986). Recently developed molecular biology techniques allow rapid amplification of specific DNA base sequences (polymerase chain reaction PCR: Saiki et al., 1988; ligase chain reaction LCR: Barany, 1991a). These methods for the quantitative analysis of mutations should be evaluated as
120
possible short-term mutagenicity test systems in animals. The main question is whether specific base-pair substitutions occurring in a small clone of initiated cells can be identified in a DNA sample containing million-fold larger amounts of wild-type DNA sequences from normal tissue. By the use of ARMS-PCR (Newton et al., 1989), Ehlen and Dubeau (1989) could detect one copy of mutant DNA in a background of 10 7 copies of wild-type DNA. Kumar et al. (1990) modified a method based on restriction fragment length polymorphism (Haliassos et al., 1989) and found a detection limit of one copy of mutant DNA per 10 4 copies of wild-type DNA. Nakazawa et al. (1990) employed a similar method to identify mutated sequences in a 106-fold excess of normal DNA. In this communication, we report our attempts at using the ligase chain reaction (Barany, 1991b) to recognize and amplify the DNA sequence ... ACAGCAGGTCTAGAAGAGTAT
...
(mutant DNA) in an excess of the sequence ... ACAGCAGGTCAAGAAGAGTAT ... (wild-type) using ligase substrates (oligonucleotides) that match the mutated but not the wildtype sequence. Materials and methods Oligonucleotides
The sequences of the oligonucleotides used for PCR and LCR are listed in Table 1. All oligonucleotides were obtained from Microsynth, Win-
disch, Switzerland. For LCR, LHR2 and LHR3 at concentrations of 20 /xM were 5'-phosphorylated in 70 mM Tris (pH 7.6) containing 10 mM MgC12, 5 mM DTF, 100 mM dATP (Promega, Madison, WI) and 10 units of T4 polynucleotide kinase (BRL, Bethesda, MD). The volume of the reactions was 25/xl. After incubation at 37°C for 30 min, an additional 10 units of T4 polynucleotide kinase were added, and the reaction was continued for another 30 min. Finally, the kinase was heat-inactivated at 65°C for 20 rain. Model template
DNA was isolated from B6C3F1 mouse liver as described by Gupta et al. (1982). The primerdirected enzymatic amplification of Ha-ras gene fragments was carried out essentially as described by Saiki et al. (1988). Briefly, amplification reactions took place in 100 ~1 reaction mixtures with 10 ng of isolated template DNA in 10 mM Tris (pH 8.4) containing 50 mM KCI, 1.5 mM MgC12, 0.01% gelatin, 200 /xM dNTP (Promega), oligonucleotides (0.5 tzM HR1N and HR4 for production of wild-type model template, 0.5 /~M HR1CT and HR4 to produce mutated model template) and 2.5 units Taq polymerase (Promega). After the samples were covered with 80 txl of mineral oil to prevent evaporation, the amplification reaction was performed using a programmable heating block (Hybaid thermal reactor, Teddington, Middlesex, UK). Segment times and temperatures were 30 s at 95°C, 1 min at 55°C, and 1 min at 72°C. Forty cycles were per-
TABLE 1 O L I G O N U C L E O T I D E S USED F O R PCR AND LCR Oligonucleotides ~ r PCR: HRIN:
5'-T'CTA'CTG'GAC'ATC'TTA'GAC'ACA'GCA'GGT'CCA'GAA'GAG'TAT'-3'
HRICT:
5'-T'CTA'CTG'GAC'ATC'TTA'GAC'ACA'GCA'GGT'CTA'GAA'GAG'TAT'-3'
HR4:
5'-T'GAC'CTG'GCT'GCT'CGC'ACT-3 f
Oligonucleotides ~ r LCR: LHRI 5'-Dig-GAC'ATC'TTA'GAC'ACA'GCA'GGT'C-3'
LHR3 5'-TA'GAA'GAG'TAT'AGT'GCC'ATG'CGG-3'
3'-CTG'TAG'AAT'CTG'TGT'CGT'CCA'G-5'
3'-AT'CTT'CTC'ATA'TCA'CGG'TAC'GCC-5'
LHR2
LHR4
Codon 61 of the mouse Ha-ras is underlined. Bases corresponding to the mutant form of Ha-ras are in bold type (Ruta et al., 1986; Fox et al., 1990; Brown et al., 1988). LHR1 was 5'-labeled with digoxigenin.
121 formed. PCR products were separated from mouse template DNA by electrophoresis in 1% low-melting agarose and the desired 370-bp DNA fragments (length assumed to match the known rat sequences) excised. Additional amplifications under the described conditions were performed with a 1000-fold dilution of the gel slices. This final PCR product was purified by ether extraction.
LCR conditions LCR was carried out essentially as described by Barany (1991b). The reactions took place in 10 /zl reaction mixture containing 20 nM analytical oligonucleotides (LHR1, LHR2) and 20 nM discriminating oligonucleotides (LHR3, LHR4) in 20 mM Tris (pH 7.6) containing 25 mM K-acetate, 10 mM Mg-acetate, 10 mM DTT, 0.6 mM NAD, 0.1% Triton X-100, 4/xg herring sperm DNA, 0.5 nick-closing units Ampligase (Epicenter, Madison, WI) and differing amounts of model template (25 to 2.5 x 105 molecules). After covering with 20 ~zl of mineral oil, the samples were incubated on a Hybaid thermal reactor for 3 rain at 94°C. Twenty to forty cycles were performed using the following segment times and temperatures: 15 s at 94°C, 4 min at 63°C. Alternatively, reactions with 0.1 units of Ampligase were incubated for 15 s at 94°C and 6 min at 63°C.
Electrophoresis, Southern blot and DNA detection The completed LCRs were analyzed by electrophoresis in 16% polyacrylamide gel (PAGE), which separated the ligation products from nonligated oligonucleotides. The gels were transferred to nylon filters (Boehringer, Indianapolis, IN) using 0.4 M NaOH (Sambrock et al., 1989). Subsequently, filters were neutralized on filter paper soaked with 1 M Tris-HC1 (pH 7.6) and baked for 30 min at 120°C. DNA was visualized by the detection of the hapten digoxigenin of LHR1 by an enzyme-linked immunoassay using an antibody-conjugate (alkaline phosphatase) and subsequent enzyme-catalyzed color reaction with 5bromo-4-chloro-indolyl phosphate (BCIP) and nitroblue tetrazolium salt (NBT; Genius T M Detection Kit, Boehringer).
Restriction analysis of model templates and LCR products with XbaI In contrast to wild-type template, mutant template contains a restriction site for the enzyme XbaI, created by the AT to TA transversion. Therefore, LCR products and also the mutant model template could be cut into two doublestranded fragments by incubating LCR product with XbaI (Boehringer). Fragments were visualized by the enzyme-catalyzed color reaction (Boehringer) described above. Results and discussion
The Ha-ras protooncogene of the mouse was chosen as a model gene for detecting specific point mutations in DNA by Ampligase-LCR. The potential of this amplification method to detect a low number of mutated DNA molecules in a high background of wild-type DNA was evaluated. After separation by PAGE and transfer to nylon filter, LCR reaction products were visualized using the digoxigenin detection system. On most nylon filters, three different-sized bands were detected: the lowest band was identified as the single-stranded digoxigenin-labeled oligonucleotide (LHR1). The L H R 1 / L H R 2 duplex showed a significantly reduced mobility in the gel. The slowest mobility was exhibited by the desired LCR reaction product, whose identity was confirmed by XbaI digestion (data not shown). Lanes 1-6 of Fig. 1 show the detection limit of the method (reactions with 0.5 units of Ampligase, incubated for 15 s at 94°C and 4 min at 63°C) with respect to the number of template copies required (0 to 250,000). The method had a detection limit of 250 copies of mutant target DNA. This is in the same range as determined by Barany (1991b). Given that one haploid copy of the human or rodent genome contains approx. 3 pg of DNA, and that a maximum of 4 #g DNA can be analyzed per sample tube, the theoretical detection limit for this method would be one target gene per 10 4 copies of genome. In these experiments, using 40 amplification cycles, a weak background signal was observed in samples without template (Fig. 1, lane 1). This background was most probably caused by blunt-
122
LCR product LHR1/LHR2 duplex LHR1
Lane
t
2
3
4
5
6
7
8
9
Fig. 1. LCR reaction mixtures following amplification, separation by PAGE, transfer to nylon filter and visualization of digoxigenin-labeled bands by enzyme-linked immunoassay. Lanes 1-6: reaction mixtures containing 0; 25; 250; 2500; 25,000 and 250,000 copies of mutant target DNA, respectively. Lanes 7-9: amplification in the presence of wild-type DNA. Lane 7: a t : 1 mixture of mutant and wild-type D N A (both 25,000 copies). Lane 8: control, lacking both mutant and wild-type DNA. Lane 9: a 1 : 100 mixture of mutant to wild-type DNA (250:25,000 copies).
end ligation of the two oligonucleotide duplexes ( L H R 1 / L H R 2 and L H R 3 / L H R 4 ) p r e s e n t in the reaction. That the background was due to contamination by spurious mutant ras templates could be excluded by control experiments in which L H R 1 / L H R 2 were replaced by a pair of oligonucleotides with a sequence unrelated to Ha-ras. No natural template DNA exists for the resulting oligonucleotide combination nor had this construct previously been synthesized in our laboratory. Despite the lack of template, LCR product was again obtained, confirming blunt-end ligation (data not shown). This background signal became predominant when more than 40 cycles were carried out, even using herring sperm DNA as carrier, and although (according to the manufacturer) the ligase used in this study, Ampligase, should have no activity on blunt-ended doublestranded DNA. The background could possibly be reduced by using overhanging oligonucleotides as recommended by Barany (1991a). Using 0.1 units of Ampligase and 6 min at 63°C, the ability of the described Ampligase-LCR procedure to detect mutated DNA in a high background of wild-type PCR fragments was evaluated. As a positive control, a 1:1 mixture of mutant and wild-type DNA was chosen. As shown in Fig. 1 (lane 7), such a mixture gave a significantly stronger signal than the negative control without target DNA (lane 8). This is in agree-
ment with Barany (1991b). However, when the amount of mutant DNA in the mixture was reduced 100-fold (down to 250 copies), no significant increase in signal strength above background was noted (lane 9). The presence of wild-type DNA in the reaction mixture appeared to effectively suppress the amplification of mutant template. In yet larger copy numbers, the wild-type DNA competed with the mutant sequence as ligation template (data not shown). Thus, the effective detection limit in the presence of wildtype DNA lay at a mutation frequency of > 1%. We therefore conclude that while the Ampligase-LCR method is appropriate for detecting heterozygosity (Barany, 1991b), it lacks sufficient selectivity to be applied to an in vivo situation, where the ratio of mutant to wild-type DNA sequences might be expected to lie around 1 : 106.
Acknowledgements We would like to thank Drs. Christian Sengstag and Francis Barany for helpful discussions and Prof. Christian Schlatter for financial support.
References Barany, F. (1991a) The ligase chain reaction in a PCR world, PCR Meth. Appl., 1, 5-16.
123 Barany, F. (1991b) Genetic disease detection and DNA amplification using cloned thermostable ligase, Proc. Natl. Acad. Sci. USA, 88, 189-193. Brown, K., B. Bailleul, M. Ramsden, F. Fee, R. Krumlauf and A. Balmain (1988) Isolation and characterization of the 5' flanking region of the mouse c-Harvey-ras gene, Mol. Carcinogen., 1, 161-170. Ehlen, Th., and L. Dubeau (1989) Detection of ras point mutations by polymerase chain reaction using mutationspecific, inosine-containing oligonucleotide primers, Biochem. Biophys. Res. Commun., 160, 441-447. Fox, T.R., A.M. Schumann, P.G. Watanabe, B.L. Yano, V.M. Maher and J.J. McCormick (1990) Mutational analysis of the H-ras oncogene in spontaneous C 5 7 B L / 6 x C 3 H / H e mouse liver tumors and tumors induced with genotoxic and nongenotoxic hepatocarcinogens, Cancer Res., 50, 4014-4019. Gupta, R.C., and K. Randerath (1982) 32p-Postlabeling analysis of nonradioactive aromatic carcinogen-DNA adducts, Carcinogenesis, 3, 1081-1092. Haliassos, A., J.C. Chomel, S. Grandjouan, J. Kruh, J.C. Kaplan and A. Kitzis (1989) Detection of minority point mutations by modified PCR technique: a new approach for a sensitive diagnosis of tumor-progression markers, Nucleic Acids Res., 17, 8093-8099. Kumar, R., S. Sukumar and M. Barbacid (1990) Activation of ras oncogenes preceding the onset of neoplasia, Science, 248, 1101-1104. Nakazawa, H., A-M. Aguelon and H. Yamasaki (1990) Relationship between chemically induced Ha-ras mutation and transformation of BALB/c 3T3 cells: Evidence for chemical-specific activation and cell type-specific recruitment of oncogene in transformation, Mol. Carcinogen., 3, 202-209.
Newton, C.R., A. Graham, L.E. Heptinstall, S.J. Powell, C. Summers, N. Kalsheker, J.C. Smith and A.F. Markham (1989) Analysis of any point mutation in DNA. The amplification refractory system (ARMS), Nucleic Acids Res., 17, 2503-2516. Ruta, M., R. Wolford, D. Dhar, D. Defeo-Jones, R.W, Ellis and E.M. Scolnick (1986) Nucleotide sequence of the two rat cellular H-ras genes, Mol. Cell. Biol., 6, 1706-1710. Saiki, R.K., D.H. Gelfand, S. Stoffel, S.J. Scharf, R. Higuchi, G.T. Horn, K.B. Mullis and H.A. Erlich (1988) Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase, Science, 239, 487-491. Sambrook, J., E.F. Fritsch and T. Maniatis (1989) Molecular Cloning, A Laboratory Manual, 2nd edn., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, pp. 9.31-9.57. Vogelstein, B., C.1. Civin, A.C. Preisinger, J.P. Krischer, P. Steuber, Y. Ravindranath, H. Weinstein, E. Elfferich and J. Bos (1990) Ras gene mutations in childhood acute myeloid leukemia: a pediatric oncology group study, Genes Chromosomes Cancer, 2, 159-162. Wiseman, R.W., S.J. Stowers, E.C. Miller, M.W. Anderson and J.A. Miller (1986) Activating mutations of the c-Ha-ras protooncogene in chemically induced hepatomas of the male B6C3 F1 mouse, Proc. Natl. Acad. Sci. USA, 83, 5825 -5829. Wu, D.Y., and R.B. Wallace (1989) The ligation amplification reaction (LAR). Amplification of specific DNA sequences using sequential rounds of template-dependent ligation, Genomics, 4, 560-569.
Communicated by B. Lambert
119
MUTLET 0711
Evaluation of the ligase chain reaction (LCR) for the detection of point mutations I. K~ilin a, S. Shephard a and U. Candrian b Institute of Toxicology, Swiss Federal Institute of Technology, Schwerzenbach/Ziirich, Switzerland and b Laboratory of Food Chemistry, Institute of Biochemistry, Universityof Bern, Bern, Switzerland a
(Received 10 April 1992) (Accepted 15 June 1992)
Keywords: Point mutation; Ras; Ligase chain reaction; Polymerase chain reaction; Mutagenicity testing
Summary The ligase chain reaction (LCR) was evaluated as an amplification method for an in vivo mutation assay. Specifically, the ligase was tested for its ability to selectively amplify a DNA sequence mutated at a single base, in the presence of an excess of wild-type DNA. As a model template a 370-bp DNA fragment of the mouse Ha-ras protooncogene containing an A to T mutation at the second position of codon 61 was used. With the commercially available ligase Ampligase (Epicenter), 250 molecules of mutant fragments could be detected by an enzyme-linked immunoassay with digoxigenin marker (giving a theoretical detection limit of 1 target gene per 104 copies of genome). In the analysis of mixtures with corresponding wild-type D N A fragments, a 1 : 1 mixture resulted in a clearly stronger signal than control samples lacking wild-type and mutant DNA. However, the signal obtained from a 100-fold dilution of the mutant D N A with wild-type D N A could not be distinguished from the background noise. In this particular form, LCR lacks sufficient selectivity to be applied to an in vivo situation, where the ratio of mutant to wild-type D N A sequences might be expected to lie around 1 : 106.
Tumor induction by genotoxic carcinogens is the result of an accumulation of mutations in a number of critical genes. Various types of mutations appear to be involved (Vogelstein et al.,
Correspondence: Dr. U. Candrian, Laboratory of Food Chemistry, Institute of Biochemistry, University of Bern, Freiestrasse 3, CH-3012 Bern, Switzerland.
Abbreviations." LCR, ligase chain reaction; PCR, polymerase chain reaction; PAGE, polyacrylamide gel electrophoresis; ARMS, amplification refractory mutation system.
1990). Base-pair substitutions, for instance, can result in an activation of oncogenes. As an exampie, an A T to T A transversion at the second position of codon 61 in the Ha-ras oncogene has been found in 6 of 7 hepatomas induced in mice by vinyl carbamate, the proximate carcinogen of ethyl carbamate (urethane; Wiseman et al., 1986). Recently developed molecular biology techniques allow rapid amplification of specific DNA base sequences (polymerase chain reaction PCR: Saiki et al., 1988; ligase chain reaction LCR: Barany, 1991a). These methods for the quantitative analysis of mutations should be evaluated as
120
possible short-term mutagenicity test systems in animals. The main question is whether specific base-pair substitutions occurring in a small clone of initiated cells can be identified in a DNA sample containing million-fold larger amounts of wild-type DNA sequences from normal tissue. By the use of ARMS-PCR (Newton et al., 1989), Ehlen and Dubeau (1989) could detect one copy of mutant DNA in a background of 10 7 copies of wild-type DNA. Kumar et al. (1990) modified a method based on restriction fragment length polymorphism (Haliassos et al., 1989) and found a detection limit of one copy of mutant DNA per 10 4 copies of wild-type DNA. Nakazawa et al. (1990) employed a similar method to identify mutated sequences in a 106-fold excess of normal DNA. In this communication, we report our attempts at using the ligase chain reaction (Barany, 1991b) to recognize and amplify the DNA sequence ... ACAGCAGGTCTAGAAGAGTAT
...
(mutant DNA) in an excess of the sequence ... ACAGCAGGTCAAGAAGAGTAT ... (wild-type) using ligase substrates (oligonucleotides) that match the mutated but not the wildtype sequence. Materials and methods Oligonucleotides
The sequences of the oligonucleotides used for PCR and LCR are listed in Table 1. All oligonucleotides were obtained from Microsynth, Win-
disch, Switzerland. For LCR, LHR2 and LHR3 at concentrations of 20 /xM were 5'-phosphorylated in 70 mM Tris (pH 7.6) containing 10 mM MgC12, 5 mM DTF, 100 mM dATP (Promega, Madison, WI) and 10 units of T4 polynucleotide kinase (BRL, Bethesda, MD). The volume of the reactions was 25/xl. After incubation at 37°C for 30 min, an additional 10 units of T4 polynucleotide kinase were added, and the reaction was continued for another 30 min. Finally, the kinase was heat-inactivated at 65°C for 20 rain. Model template
DNA was isolated from B6C3F1 mouse liver as described by Gupta et al. (1982). The primerdirected enzymatic amplification of Ha-ras gene fragments was carried out essentially as described by Saiki et al. (1988). Briefly, amplification reactions took place in 100 ~1 reaction mixtures with 10 ng of isolated template DNA in 10 mM Tris (pH 8.4) containing 50 mM KCI, 1.5 mM MgC12, 0.01% gelatin, 200 /xM dNTP (Promega), oligonucleotides (0.5 tzM HR1N and HR4 for production of wild-type model template, 0.5 /~M HR1CT and HR4 to produce mutated model template) and 2.5 units Taq polymerase (Promega). After the samples were covered with 80 txl of mineral oil to prevent evaporation, the amplification reaction was performed using a programmable heating block (Hybaid thermal reactor, Teddington, Middlesex, UK). Segment times and temperatures were 30 s at 95°C, 1 min at 55°C, and 1 min at 72°C. Forty cycles were per-
TABLE 1 O L I G O N U C L E O T I D E S USED F O R PCR AND LCR Oligonucleotides ~ r PCR: HRIN:
5'-T'CTA'CTG'GAC'ATC'TTA'GAC'ACA'GCA'GGT'CCA'GAA'GAG'TAT'-3'
HRICT:
5'-T'CTA'CTG'GAC'ATC'TTA'GAC'ACA'GCA'GGT'CTA'GAA'GAG'TAT'-3'
HR4:
5'-T'GAC'CTG'GCT'GCT'CGC'ACT-3 f
Oligonucleotides ~ r LCR: LHRI 5'-Dig-GAC'ATC'TTA'GAC'ACA'GCA'GGT'C-3'
LHR3 5'-TA'GAA'GAG'TAT'AGT'GCC'ATG'CGG-3'
3'-CTG'TAG'AAT'CTG'TGT'CGT'CCA'G-5'
3'-AT'CTT'CTC'ATA'TCA'CGG'TAC'GCC-5'
LHR2
LHR4
Codon 61 of the mouse Ha-ras is underlined. Bases corresponding to the mutant form of Ha-ras are in bold type (Ruta et al., 1986; Fox et al., 1990; Brown et al., 1988). LHR1 was 5'-labeled with digoxigenin.
121 formed. PCR products were separated from mouse template DNA by electrophoresis in 1% low-melting agarose and the desired 370-bp DNA fragments (length assumed to match the known rat sequences) excised. Additional amplifications under the described conditions were performed with a 1000-fold dilution of the gel slices. This final PCR product was purified by ether extraction.
LCR conditions LCR was carried out essentially as described by Barany (1991b). The reactions took place in 10 /zl reaction mixture containing 20 nM analytical oligonucleotides (LHR1, LHR2) and 20 nM discriminating oligonucleotides (LHR3, LHR4) in 20 mM Tris (pH 7.6) containing 25 mM K-acetate, 10 mM Mg-acetate, 10 mM DTT, 0.6 mM NAD, 0.1% Triton X-100, 4/xg herring sperm DNA, 0.5 nick-closing units Ampligase (Epicenter, Madison, WI) and differing amounts of model template (25 to 2.5 x 105 molecules). After covering with 20 ~zl of mineral oil, the samples were incubated on a Hybaid thermal reactor for 3 rain at 94°C. Twenty to forty cycles were performed using the following segment times and temperatures: 15 s at 94°C, 4 min at 63°C. Alternatively, reactions with 0.1 units of Ampligase were incubated for 15 s at 94°C and 6 min at 63°C.
Electrophoresis, Southern blot and DNA detection The completed LCRs were analyzed by electrophoresis in 16% polyacrylamide gel (PAGE), which separated the ligation products from nonligated oligonucleotides. The gels were transferred to nylon filters (Boehringer, Indianapolis, IN) using 0.4 M NaOH (Sambrock et al., 1989). Subsequently, filters were neutralized on filter paper soaked with 1 M Tris-HC1 (pH 7.6) and baked for 30 min at 120°C. DNA was visualized by the detection of the hapten digoxigenin of LHR1 by an enzyme-linked immunoassay using an antibody-conjugate (alkaline phosphatase) and subsequent enzyme-catalyzed color reaction with 5bromo-4-chloro-indolyl phosphate (BCIP) and nitroblue tetrazolium salt (NBT; Genius T M Detection Kit, Boehringer).
Restriction analysis of model templates and LCR products with XbaI In contrast to wild-type template, mutant template contains a restriction site for the enzyme XbaI, created by the AT to TA transversion. Therefore, LCR products and also the mutant model template could be cut into two doublestranded fragments by incubating LCR product with XbaI (Boehringer). Fragments were visualized by the enzyme-catalyzed color reaction (Boehringer) described above. Results and discussion
The Ha-ras protooncogene of the mouse was chosen as a model gene for detecting specific point mutations in DNA by Ampligase-LCR. The potential of this amplification method to detect a low number of mutated DNA molecules in a high background of wild-type DNA was evaluated. After separation by PAGE and transfer to nylon filter, LCR reaction products were visualized using the digoxigenin detection system. On most nylon filters, three different-sized bands were detected: the lowest band was identified as the single-stranded digoxigenin-labeled oligonucleotide (LHR1). The L H R 1 / L H R 2 duplex showed a significantly reduced mobility in the gel. The slowest mobility was exhibited by the desired LCR reaction product, whose identity was confirmed by XbaI digestion (data not shown). Lanes 1-6 of Fig. 1 show the detection limit of the method (reactions with 0.5 units of Ampligase, incubated for 15 s at 94°C and 4 min at 63°C) with respect to the number of template copies required (0 to 250,000). The method had a detection limit of 250 copies of mutant target DNA. This is in the same range as determined by Barany (1991b). Given that one haploid copy of the human or rodent genome contains approx. 3 pg of DNA, and that a maximum of 4 #g DNA can be analyzed per sample tube, the theoretical detection limit for this method would be one target gene per 10 4 copies of genome. In these experiments, using 40 amplification cycles, a weak background signal was observed in samples without template (Fig. 1, lane 1). This background was most probably caused by blunt-
122
LCR product LHR1/LHR2 duplex LHR1
Lane
t
2
3
4
5
6
7
8
9
Fig. 1. LCR reaction mixtures following amplification, separation by PAGE, transfer to nylon filter and visualization of digoxigenin-labeled bands by enzyme-linked immunoassay. Lanes 1-6: reaction mixtures containing 0; 25; 250; 2500; 25,000 and 250,000 copies of mutant target DNA, respectively. Lanes 7-9: amplification in the presence of wild-type DNA. Lane 7: a t : 1 mixture of mutant and wild-type D N A (both 25,000 copies). Lane 8: control, lacking both mutant and wild-type DNA. Lane 9: a 1 : 100 mixture of mutant to wild-type DNA (250:25,000 copies).
end ligation of the two oligonucleotide duplexes ( L H R 1 / L H R 2 and L H R 3 / L H R 4 ) p r e s e n t in the reaction. That the background was due to contamination by spurious mutant ras templates could be excluded by control experiments in which L H R 1 / L H R 2 were replaced by a pair of oligonucleotides with a sequence unrelated to Ha-ras. No natural template DNA exists for the resulting oligonucleotide combination nor had this construct previously been synthesized in our laboratory. Despite the lack of template, LCR product was again obtained, confirming blunt-end ligation (data not shown). This background signal became predominant when more than 40 cycles were carried out, even using herring sperm DNA as carrier, and although (according to the manufacturer) the ligase used in this study, Ampligase, should have no activity on blunt-ended doublestranded DNA. The background could possibly be reduced by using overhanging oligonucleotides as recommended by Barany (1991a). Using 0.1 units of Ampligase and 6 min at 63°C, the ability of the described Ampligase-LCR procedure to detect mutated DNA in a high background of wild-type PCR fragments was evaluated. As a positive control, a 1:1 mixture of mutant and wild-type DNA was chosen. As shown in Fig. 1 (lane 7), such a mixture gave a significantly stronger signal than the negative control without target DNA (lane 8). This is in agree-
ment with Barany (1991b). However, when the amount of mutant DNA in the mixture was reduced 100-fold (down to 250 copies), no significant increase in signal strength above background was noted (lane 9). The presence of wild-type DNA in the reaction mixture appeared to effectively suppress the amplification of mutant template. In yet larger copy numbers, the wild-type DNA competed with the mutant sequence as ligation template (data not shown). Thus, the effective detection limit in the presence of wildtype DNA lay at a mutation frequency of > 1%. We therefore conclude that while the Ampligase-LCR method is appropriate for detecting heterozygosity (Barany, 1991b), it lacks sufficient selectivity to be applied to an in vivo situation, where the ratio of mutant to wild-type DNA sequences might be expected to lie around 1 : 106.
Acknowledgements We would like to thank Drs. Christian Sengstag and Francis Barany for helpful discussions and Prof. Christian Schlatter for financial support.
References Barany, F. (1991a) The ligase chain reaction in a PCR world, PCR Meth. Appl., 1, 5-16.
123 Barany, F. (1991b) Genetic disease detection and DNA amplification using cloned thermostable ligase, Proc. Natl. Acad. Sci. USA, 88, 189-193. Brown, K., B. Bailleul, M. Ramsden, F. Fee, R. Krumlauf and A. Balmain (1988) Isolation and characterization of the 5' flanking region of the mouse c-Harvey-ras gene, Mol. Carcinogen., 1, 161-170. Ehlen, Th., and L. Dubeau (1989) Detection of ras point mutations by polymerase chain reaction using mutationspecific, inosine-containing oligonucleotide primers, Biochem. Biophys. Res. Commun., 160, 441-447. Fox, T.R., A.M. Schumann, P.G. Watanabe, B.L. Yano, V.M. Maher and J.J. McCormick (1990) Mutational analysis of the H-ras oncogene in spontaneous C 5 7 B L / 6 x C 3 H / H e mouse liver tumors and tumors induced with genotoxic and nongenotoxic hepatocarcinogens, Cancer Res., 50, 4014-4019. Gupta, R.C., and K. Randerath (1982) 32p-Postlabeling analysis of nonradioactive aromatic carcinogen-DNA adducts, Carcinogenesis, 3, 1081-1092. Haliassos, A., J.C. Chomel, S. Grandjouan, J. Kruh, J.C. Kaplan and A. Kitzis (1989) Detection of minority point mutations by modified PCR technique: a new approach for a sensitive diagnosis of tumor-progression markers, Nucleic Acids Res., 17, 8093-8099. Kumar, R., S. Sukumar and M. Barbacid (1990) Activation of ras oncogenes preceding the onset of neoplasia, Science, 248, 1101-1104. Nakazawa, H., A-M. Aguelon and H. Yamasaki (1990) Relationship between chemically induced Ha-ras mutation and transformation of BALB/c 3T3 cells: Evidence for chemical-specific activation and cell type-specific recruitment of oncogene in transformation, Mol. Carcinogen., 3, 202-209.
Newton, C.R., A. Graham, L.E. Heptinstall, S.J. Powell, C. Summers, N. Kalsheker, J.C. Smith and A.F. Markham (1989) Analysis of any point mutation in DNA. The amplification refractory system (ARMS), Nucleic Acids Res., 17, 2503-2516. Ruta, M., R. Wolford, D. Dhar, D. Defeo-Jones, R.W, Ellis and E.M. Scolnick (1986) Nucleotide sequence of the two rat cellular H-ras genes, Mol. Cell. Biol., 6, 1706-1710. Saiki, R.K., D.H. Gelfand, S. Stoffel, S.J. Scharf, R. Higuchi, G.T. Horn, K.B. Mullis and H.A. Erlich (1988) Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase, Science, 239, 487-491. Sambrook, J., E.F. Fritsch and T. Maniatis (1989) Molecular Cloning, A Laboratory Manual, 2nd edn., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, pp. 9.31-9.57. Vogelstein, B., C.1. Civin, A.C. Preisinger, J.P. Krischer, P. Steuber, Y. Ravindranath, H. Weinstein, E. Elfferich and J. Bos (1990) Ras gene mutations in childhood acute myeloid leukemia: a pediatric oncology group study, Genes Chromosomes Cancer, 2, 159-162. Wiseman, R.W., S.J. Stowers, E.C. Miller, M.W. Anderson and J.A. Miller (1986) Activating mutations of the c-Ha-ras protooncogene in chemically induced hepatomas of the male B6C3 F1 mouse, Proc. Natl. Acad. Sci. USA, 83, 5825 -5829. Wu, D.Y., and R.B. Wallace (1989) The ligation amplification reaction (LAR). Amplification of specific DNA sequences using sequential rounds of template-dependent ligation, Genomics, 4, 560-569.
Communicated by B. Lambert
